CN116024373A - SNP molecular marker related to grape cold resistance and application thereof - Google Patents
SNP molecular marker related to grape cold resistance and application thereof Download PDFInfo
- Publication number
- CN116024373A CN116024373A CN202211695652.2A CN202211695652A CN116024373A CN 116024373 A CN116024373 A CN 116024373A CN 202211695652 A CN202211695652 A CN 202211695652A CN 116024373 A CN116024373 A CN 116024373A
- Authority
- CN
- China
- Prior art keywords
- grape
- cold resistance
- primer
- snp
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000009754 Vitis X bourquina Nutrition 0.000 title claims abstract description 99
- 235000012333 Vitis X labruscana Nutrition 0.000 title claims abstract description 99
- 235000014787 Vitis vinifera Nutrition 0.000 title claims abstract description 99
- 239000003147 molecular marker Substances 0.000 title claims abstract description 25
- 240000006365 Vitis vinifera Species 0.000 title 1
- 241000219095 Vitis Species 0.000 claims abstract description 100
- 238000000034 method Methods 0.000 claims abstract description 24
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 22
- 238000009395 breeding Methods 0.000 claims abstract description 14
- 230000001488 breeding effect Effects 0.000 claims abstract description 12
- 230000002068 genetic effect Effects 0.000 claims abstract description 5
- 238000012216 screening Methods 0.000 claims abstract description 5
- 238000003205 genotyping method Methods 0.000 claims abstract description 4
- 238000001514 detection method Methods 0.000 claims description 19
- 239000000463 material Substances 0.000 claims description 18
- 238000012408 PCR amplification Methods 0.000 claims description 14
- 239000002773 nucleotide Substances 0.000 claims description 13
- 125000003729 nucleotide group Chemical group 0.000 claims description 13
- 238000012163 sequencing technique Methods 0.000 claims description 12
- 230000003321 amplification Effects 0.000 claims description 8
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 8
- 241000219094 Vitaceae Species 0.000 claims description 7
- 235000021021 grapes Nutrition 0.000 claims description 7
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 7
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 6
- 239000000523 sample Substances 0.000 claims description 6
- 210000000349 chromosome Anatomy 0.000 claims description 5
- 239000008367 deionised water Substances 0.000 claims description 4
- 229910021641 deionized water Inorganic materials 0.000 claims description 4
- 239000000203 mixture Substances 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 238000012258 culturing Methods 0.000 claims description 2
- 230000035772 mutation Effects 0.000 abstract description 5
- 238000009396 hybridization Methods 0.000 abstract description 2
- 238000009412 basement excavation Methods 0.000 abstract 1
- 238000011156 evaluation Methods 0.000 abstract 1
- 238000005457 optimization Methods 0.000 abstract 1
- 238000005516 engineering process Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 3
- 229910052664 nepheline Inorganic materials 0.000 description 3
- 239000010434 nepheline Substances 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 235000013399 edible fruits Nutrition 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000010354 integration Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 239000002689 soil Substances 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 208000009084 Cold Injury Diseases 0.000 description 1
- 238000000018 DNA microarray Methods 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 108091081024 Start codon Proteins 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 230000002595 cold damage Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 230000009746 freeze damage Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 238000005065 mining Methods 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a SNP molecular marker related to grape cold resistance and application thereof, wherein a VvCML gene with obvious expression difference between a grape variety with strong cold resistance and a grape variety with weak cold resistance is obtained through early screening, and a SNP locus with obvious difference is obtained through excavation on the VvCML gene, and the mutation locus is 148bpC/T mutation. According to the invention, through identifying the relation between the VvCML gene sequence and the cold resistance of the grape, the SNP molecular marker related to the cold resistance is developed, and the four-primer method is further used for direct PCR typing, so that the direct and rapid genetic identification of grape seedlings is realized, the wild resource domestication breeding and the early evaluation of traditional hybridization breeding can be accelerated, the breeding progress is accelerated, the variety optimization is promoted, and the SNP locus genotyping can be effectively realized by designing the specific primer, and the method has the characteristics of simplicity and convenience in operation, low cost and the like.
Description
Technical Field
The invention belongs to the technical field of fruit tree molecular biology, and particularly relates to SNP molecular markers related to grape cold resistance and a method for detecting grape cold resistance.
Background
Single nucleotide polymorphism (Si ngl e-Nuc l eot ide Po lymorph i sm, SNP) refers to a polymorphism of a DNA fragment in the genomic deoxynucleic acid (DNA) sequence caused by variation of a single deoxynucleotide. SNPs involve single base variations, in the form of transitions, transversions, insertions and deletions. SNP has various detection methods at present, and common methods include PC direct detection, DNA chip, high-throughput second-generation sequencing technology and the like. Detection of genotypes by detecting SNP loci is a method of increasing in recent years. The molecular marker has been applied to horticultural crop breeding for a period of time, compared with the traditional breeding method, the molecular breeding technology greatly improves the breeding efficiency, saves the breeding time and the cost, and opens a search path for breeders on the molecular level.
Grape is widely used for brewing, processing and eating as one of the global important economic fruit crops. In recent decades, chinese grape planting, whether the cultivation area and the yield, has been rapidly developed. Main planting areas of grapes in China are located in cold, arid and semiarid areas, and most of the areas are cold in winter and dry in climate. Whereas the main cultivated European and American hybrid grapes in China are poor in adaptability to low-temperature drought climate. The problems of grape cold injury and freeze injury are the main problems facing grape production in China, especially in northern areas. The main measures adopted in the field at present are cold prevention by soil burying under a frame, but the heavy workload of the cold prevention can consume a great deal of manpower and financial resources. Meanwhile, the tree body and the root system are easy to be damaged in the soil burying process, and the production life of the tree body is shortened; therefore, cultivating high-quality cold-resistant grape varieties and improving the cold resistance of grapes are important problems to be solved by the grape industry in China.
The grape cold resistance is quantitative character controlled by multiple genes, is difficult to be quickly improved by a conventional breeding method, cannot clearly distinguish character differences, and can effectively improve breeding efficiency by identifying main genes or molecular markers related to the grape cold resistance through a molecular biological technology, and meanwhile, provides a certain basis for traditional breeding.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to grape cold resistance and application thereof, and the SNP molecular marker can effectively realize SNP locus genotyping by designing a specific primer for PCR, and has the characteristics of simple and convenient operation, low cost and the like.
The invention aims at realizing the following technical scheme: a SNP molecular marker related to grape cold resistance is positioned at 8876325bp of grape chromosome 2 and is positioned in a VvCML gene, the nucleotide sequence is shown as SEQ ID NO.1, and the 148 th base R in the sequence is T/C, so that polymorphism of grape cold resistance is caused.
The application of the SNP molecular marker related to the cold resistance of the grape in the identification of the SNP chip with the nucleotide sequence of SEQ ID NO.1 or the SNP locus of the 148 th base in the nucleotide sequence of SEQ ID NO.1 is the last base of the 3' end of the probe.
The application of SNP molecular markers related to grape cold resistance in preparing a kit or a detection device for identifying grape cold resistance comprises one or more primers or a combination of primers and probes for specifically detecting a nucleotide sequence SEQ ID NO.1, wherein 148 th base R in the sequence is T/C.
Further, the primer and/or probe is selected from: specific primers and sequencing primers for sequencing detection, wherein the sequences of the primers are respectively shown as an outer primer F, an inner primer R, an inner primer F and an outer primer R, and the specific steps are as follows;
outer primer F:5'-ATGAGCGTGGATGAACCG-3'
Inner primer R:5'-GTCCAGCTGCTCGGA-3'
Inner primer F:5'-GGTCTGAAACCAAATC-3'
Outer primer R:5'-CTAGGCCCATGAATTATCAA-3'.
Further, the application of the SNP molecular labeled reagent in preparing a kit or a detection device for identifying the cold resistance of the grape comprises the following steps:
outer primer F:5'-ATGAGCGTGGATGAACCG-3'
Inner primer R:5'-GTCCAGCTGCTCGGA-3'
Inner primer F:5'-GGTCTGAAACCAAATC-3'
Outer primer R:5'-CTAGGCCCATGAATTATCAA-3'.
Use of a kit in at least one of the following 1) -3), in particular including the following aspects;
4) Identifying the cold resistance of grape varieties;
5) Screening grape varieties with strong cold resistance or eliminating grape varieties with weak cold resistance;
6) And (3) culturing grape varieties with strong cold resistance through genetic improvement.
A method for identifying a grape cold resistance trait, comprising the steps of:
4) Extracting genomic DNA of grape leaves to be detected;
5) Taking genomic DNA of the grape to be detected as a template, adopting two primer combinations, and utilizing an outer primer F and an inner primer R; the inner primer F and the outer primer R are respectively subjected to PCR amplification;
6) Sequencing the amplified product, and judging the cold resistance of the grape according to the sequencing comparison result: the type of the 148 th base of the amplified product is C, and the cold resistance is stronger than that of the type of the 148 th base of the amplified product is T.
A method for identifying a grape cold resistance trait, comprising the steps of:
5) Extracting genomic DNA of grape leaves to be detected;
6) Taking genomic DNA of the grape to be detected as a template, and adopting two primer combinations to respectively carry out PCR amplification; the two primer combinations are an outer primer F and an inner primer R, and an inner primer F and an outer primer R;
7) The PCR products of the two were mixed well, and SNP was typed using 1% agarose gel electrophoresis detection products.
8) The SNP molecular marker as set forth in claim 1, wherein the C/C homozygous grape material can amplify 162bp specific band by analyzing the typing result. The T/T homozygous grape material can amplify 360bp specific band. The C/T heterozygous grape material can amplify two band types of 162bp and 360 bp. The T/T genotype is strong in cold resistance, the C/C genotype is weak in cold resistance, and the C/T genotype is intermediate type.
A method for breeding a grape variety with high cold resistance, comprising the following steps:
genotyping the SNP molecular marker of claim 1; crossing two C/T genotypes or the C/C genotype and CT genotype grape, and screening the filial generation of the C/C genotype.
An application of identifying the cold resistance of grape features that the genomic DNA of grape to be detected is used as template, two kinds of primer combination are used, and the external primer F and internal primer R are used; the inner primer F and the outer primer R are respectively subjected to PCR amplification, wherein a reaction system 10u l used for the PCR amplification reaction is expressed as follows: 1000ng/uL genomic DNA1uL,2×Taq Master Mi× 5uL,PCR Pr imer mi x 1uL, deionized water supplemented with 10uL; the PCR amplification reaction has the amplification procedures that; 95 ℃ 5min;95 ℃ for 30s; 30s at 60 ℃; 30s at 72 ℃ for 30 cycles; 10min at 72 ℃;4 ℃ is infinity.
Compared with the prior art, the invention has the beneficial effects that:
the invention provides an SNP molecular marker suitable for identifying grape cold resistance, wherein the molecular marker is derived from grape VvCML genes. Aiming at the defects in the prior art, an accurate, efficient and low-cost grape cold-resistant character identification method is provided, and the method has potential application value for large-scale breeding related to grape cold resistance.
Drawings
FIG. 1 is a 'red earth' x 'double-preferred' hybrid population integration genetic map in cM. FIG. 2 is a map of the integration inheritance of the 'Chardonnay' x 'North Binghong' hybrid population, in cM. FIG. 3 is a partial sequence difference site alignment result of the grape VvCML cold-resistant genotype and the sensitive genotype.
FIG. 4 is a chart of cold resistance electrophoresis bands of different grape varieties identified by using a cold resistance molecular marker Vach 1;
the labels in fig. 4 are as follows, notes: 1 is red earth, 2 is nepheline, 3 is Cabernet Sauvignon, 4 is Victoria, 5 is Shuangyou, 6 is North Binghong, 7 is LevoU red, 8 is Beda M2000 maker.
FIG. 5 is a chart of electrophoresis bands for identifying cold resistance of grape hybrid offspring by using a cold resistance molecular marker Vach 1;
the labels in fig. 5 are as follows, notes: 1 is 9-1-16,2 is 9-1-17,3 is 9-1-68,4 is 9-1-309,5 is 9-1-2,6 is 9-1-6,7 is 9-1-30,8 is 9-1-41M 2000maker.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments, and all other embodiments obtained by those skilled in the art without making creative efforts based on the embodiments of the present invention are included in the protection scope of the present invention.
As shown in FIGS. 1-4, the present invention utilizes a combination of transcriptome sequencing and QTL localization to screen for molecular markers. Three grape hybridization populations are used, the parents of which are respectively: ' red earth ' double excellent ', ' nepheline ' x ' north ice red ', ' cabernet pearl ' x ' left excellent red '. The cold resistance phenotype data of three groups 2019 and 2020 are collected, and the QTL location is carried out through a complex interval mapping method and a Multiple QTL Model (MQM) by combining with the grape genetic map constructed by the subject group, so that stable QTL sites between different years are found and are located on grape chromosome 2. And (3) carrying out low-temperature treatment on dormant buds of one cold-resistant variety (Shuangyou) and one cold-resistant variety (red earth), and carrying out transcriptome sequencing on samples before and after treatment. The transcriptome sequencing result and the QTL positioning result are combined to obtain genes with obvious differences, wherein the genes comprise VvCML genes, and the qRT-PCR technology is used for analyzing the space-time expression quantity so as to strengthen verification. Cloning the VvCML gene in a filial generation group ('red earth' X 'double-optimal') and 6 grape varieties ('red earth', 'double-optimal', 'Chardonnay', 'North ice red', 'Cabernet Sauvignon', 'left optimal red'), and mining SNP loci according to allelic variation of C to T of 148 th nucleotide of the VvCML gene, and verifying in varieties with known cold resistance characters.
The invention provides an SNP molecular marker related to grape cold resistance.
The SNP molecular marker is positioned at 8876325bp locus of grape chromosome 2 and is positioned at the VvCML gene, the gene sequence information is shown as SEQ ID NO.1, and the mutation locus is 148C/T mutation. The VvCML gene (gene id: vitvi02g 0074, database link:https://www.ncbi.nlm.nih.gov/gene/？term＝LOC100241974) When the base of 148bp locus is detected to be homozygous C/C type, the VvCML gene initiation codon is taken as +1, and the grape variety is judged to have strong cold resistance and is excellent high cold resistance; when the base at 148bp locus is detected to be homozygous T/T type or heterozygous C/T type, the grape variety is judged to be weak in cold resistance and is not cold-resistant.
SNP sequence information
2:8876325 locus and 25-bp each before and after
AAGATCATTAGGTCTGAAACCAACT[C/T]CAGAGCAGCTGGACGCCCTAAGTCA
The invention provides a group of primers for amplifying the SNP molecular marker, the pairing situation of the primers and SNP loci is shown in figure 1, and the sequences of the primers are as follows:
outer primer F:5'-ATGAGCGTGGATGAACCG-3'
Inner primer R:5'-GTCCAGCTGCTCGGA-3'
Inner primer F:5'-GGTCTGAAACCAAATC-3'
Outer primer R:5'-CTAGGCCCATGAATTATCAA-3'.
The invention provides a method for detecting the genotype of a candidate gene VvCML of grape cold resistance, which comprises the steps of carrying out SNP detection on the nucleotide of 8876325bp locus (gene id: vitvi02g00774, database link:) of a chromosome 2 of grape, and judging whether the gene of the grape VvC ML is C/C, T/T or C/T according to the detection result. The SNP detection method used in the present application is a four-primer amplified blocked mutation system PCR (Tetra-pr-imer ARMS-PCR).
First embodiment;
the SNP markers are utilized to efficiently identify the cold resistance of different varieties of grapes;
1 materials and methods
1.1 Material selection and DNA extraction
The materials tested were ' red earth ', ' double eutectoid ', ' nepheline ' north ice red ', ' cabernet ' red ', ' left eutectoid ' victoria ' and beta, all from the Shenyang agricultural university grape resource nursery. Young leaves of a single grape plant to be detected are selected and stored in a refrigerator at 4 ℃, DNA of all samples is extracted by adopting an improved CTA B method, the quality of the DNA is detected by agarose gel electrophoresis, and then the obtained product is placed in the refrigerator at-20 ℃ for later experiments.
1.2PCR amplification of base fragment the genomic DNA of grape to be detected is used as template, and the two primer combinations (outer primer F and inner primer R; inner primer F and outer primer R) provided by the invention are adopted to respectively carry out PCR amplification. The PCR reaction system is as follows: premix TaqTM 5. Mu.l, ddH2O 3. Mu.l, DNA 1. Mu.l, primers 0.5. Mu.l each. The PCR reaction conditions were as follows: 1000ng/uL genomic DNA1uL,2 xTaq Master M ix 5uL,PCR Pr imer mix 1uL, deionized water supplemented with 10uL; the PCR amplification reaction has the amplification procedures that; 95 ℃ 5min;95 ℃ for 30s; 30s at 60 ℃; 30s at 72 ℃ for 30 cycles; 10min at 72 ℃;4 ℃ is infinity.
1.3 typing Condition analysis
The PCR products of the two were mixed well, and SNP was typed using 1% agarose gel electrophoresis detection products.
And identifying the cold resistance of the grape to be detected according to the size of the PCR product, and amplifying the 162bp specific band by using the C/C homozygous grape material. The T/T homozygous grape material can amplify 360bp specific band. The C/T heterozygous grape material can amplify two band types of 162bp and 360 bp. The T/T genotype is strong cold resistance, and the C/C, C/T genotype is weak cold resistance.
The results are shown in Table 1 and FIG. 4, wherein each of the 4 cold-resistant varieties exhibits a 360bp band type, and each of the 4 cold-resistant varieties exhibits 2 band types of 360bp and 162 bp.
TABLE 1 amplification detection of DNA of different grape varieties by SNP molecular markers related to Cold resistance
The second embodiment is;
the SNP markers are utilized to efficiently identify the cold resistance of the grape filial generation;
1 materials and methods
1.1 Material selection and DNA extraction
The test materials are 8 red earth ' X ' double-excellent ' hybrid F1 generations, samples are all from Shenyang agricultural university grape resource nursery, young leaves of a single grape plant to be tested are selected and stored in a refrigerator at 4 ℃, DNA of all samples is extracted by adopting an improved CTAB method, DN A quality is detected by agarose gel electrophoresis, and then the samples are placed in the refrigerator at-20 ℃ for later experiment.
1.2PCR amplification of base fragment the genomic DNA of grape to be detected is used as template, and the two primer combinations (outer primer F and inner primer R; inner primer F and outer primer R) provided by the invention are adopted to respectively carry out PCR amplification. The PCR reaction system is as follows: premix TaqTM 5. Mu.l, ddH2O 3. Mu.l, DNA 1. Mu.l, primers 0.5. Mu.l each. The PCR reaction conditions were as follows: 1000ng/uL genomic DNA1uL,2 xTaq Master M ix 5uL,PCR Pr imer mix 1uL, deionized water supplemented with 10uL; the PCR amplification reaction has the amplification procedures that; 95 ℃ 5min;95 ℃ for 30s; 30s at 60 ℃; 30s at 72 ℃ for 30 cycles; 10min at 72 ℃;4 ℃ is infinity.
1.3 typing Condition analysis
The PCR products of the two were mixed well, and SNP was typed using 1% agarose gel electrophoresis detection products.
And identifying the cold resistance of the grape to be detected according to the size of the PCR product, and amplifying the 162bp specific band by using the C/C homozygous grape material. The T/T homozygous grape material can amplify 360bp specific band. The C/T heterozygous grape material can amplify two band types of 162bp and 360 bp. The T/T genotype is strong cold resistance, and the C/C, C/T genotype is weak cold resistance.
The results are shown in Table 2 and FIG. 5, wherein each of the 4 cold-resistant varieties exhibits a 360bp band type, and each of the 4 cold-resistant varieties exhibits 2 band types of 360bp and 162 bp.
TABLE 2 amplification detection of Cold-resistance-related SNP molecular markers on grape variety hybrid progeny DNA
It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.
Furthermore, it should be understood that although the present disclosure describes embodiments, not every embodiment is provided with a separate embodiment, and that this description is provided for clarity only, and that the disclosure is not limited to the embodiments described in detail below, and that the embodiments described in the examples may be combined as appropriate to form other embodiments that will be apparent to those skilled in the art.
A sequence table;
1. 25bp nucleotide sequence before and after sensitive SNP locus
AAGATCATTAGGTCTGAAACCAACT[T]CAGAGCAGCTGGACGCCCTAAGTCAGAAAGC A；
2. 25bp nucleotide sequence before and after cold-resistant SNP locus
AAGATCATTAGGTCTGAAACCAACT[C]CAGAGCAGCTGGACGCCCTAAGTCAGAAAGC A。
Claims (10)
1. A SNP molecular marker related to grape cold resistance is characterized in that the SNP molecular marker is positioned at 8876325bp of grape chromosome 2 and positioned in a VvCML gene, the nucleotide sequence is shown as SEQ ID NO.1, and the 148 th base R in the sequence is T/C, so that polymorphism of grape cold resistance is caused.
2. The use of a SNP molecular marker related to grape cold resistance in identifying a SNP chip for grape cold resistance according to claim 1, wherein the nucleotide sequence of the chip is SEQ ID NO.1 or the last base at the 3' end of the probe is next to the SNP site of the 148 th base in the nucleotide sequence SEQ ID NO. 1.
3. The use of a SNP molecular marker associated with cold resistance of grape according to claim 2 for preparing a kit or a detection device for identifying cold resistance of grape, comprising one or more primers for specifically detecting the nucleotide sequence of SEQ ID No.1, wherein the 148 th base R in the sequence is T/C, or a combination of primers and probes.
4. The kit or the detection device for identifying cold resistance of grapes prepared by using the SNP molecular markers related to cold resistance of grapes according to claim 2, wherein the primers and/or probes are selected from the group consisting of: specific primers and sequencing primers for sequencing detection, wherein the sequences of the primers are respectively shown as an outer primer F, an inner primer R, an inner primer F and an outer primer R, and the specific steps are as follows;
outer primer F:5'-ATGAGCGTGGATGAACCG-3'
Inner primer R:5'-GTCCAGCTGCTCGGA-3'
Inner primer F:5'-GGTCTGAAACCAAATC-3'
Outer primer R:5'-CTAGGCCCATGAATTATCAA-3'.
5. Use of the SNP molecular marker reagent according to claim 1 for preparing a kit or a detection device for identifying cold resistance of grapes, comprising:
outer primer F:5'-ATGAGCGTGGATGAACCG-3'
Inner primer R:5'-GTCCAGCTGCTCGGA-3'
Inner primer F:5'-GGTCTGAAACCAAATC-3'
Outer primer R:5'-CTAGGCCCATGAATTATCAA-3'.
6. The use of a kit according to any one of claims 1 to 5, characterized in that the kit is used in at least one of the following 1) -3), in particular comprising the following aspects;
1) Identifying the cold resistance of grape varieties;
2) Screening grape varieties with strong cold resistance or eliminating grape varieties with weak cold resistance;
3) And (3) culturing grape varieties with strong cold resistance through genetic improvement.
7. A method for identifying a cold resistance trait of grape, comprising the steps of:
1) Extracting genomic DNA of grape leaves to be detected;
2) Taking genomic DNA of the grape to be detected as a template, adopting two primer combinations, and utilizing an outer primer F and an inner primer R; the inner primer F and the outer primer R are respectively subjected to PCR amplification;
3) Sequencing the amplified product, and judging the cold resistance of the grape according to the sequencing comparison result: the type of the 148 th base of the amplified product is C, and the cold resistance is stronger than that of the type of the 148 th base of the amplified product is T.
8. A method for identifying a cold resistance trait of grape, comprising the steps of:
1) Extracting genomic DNA of grape leaves to be detected;
2) Taking genomic DNA of the grape to be detected as a template, and adopting two primer combinations to respectively carry out PCR amplification; the two primer combinations are an outer primer F and an inner primer R, and an inner primer F and an outer primer R;
3) The PCR products of the two were mixed well, and SNP was typed using 1% agarose gel electrophoresis detection products.
4) The SNP molecular marker as set forth in claim 1, wherein the C/C homozygous grape material can amplify 162bp specific band by analyzing the typing result. The T/T homozygous grape material can amplify 360bp specific band. The C/T heterozygous grape material can amplify two band types of 162bp and 360 bp. The T/T genotype is strong in cold resistance, the C/C genotype is weak in cold resistance, and the C/T genotype is intermediate type.
9. The method for breeding the grape variety with high cold resistance is characterized by comprising the following steps of: genotyping the SNP molecular marker of claim 1; crossing two C/T genotypes or the C/C genotype and CT genotype grape, and screening the filial generation of the C/C genotype.
10. The use of claim 7 or 8 for identifying the cold resistance of grape, wherein the genomic DNA of the grape to be detected is used as a template, two primer combinations are used, and an outer primer F and an inner primer R are used; the inner primer F and the outer primer R were each subjected to PCR amplification, wherein 10ul of the reaction system used for the PCR amplification reaction was designated as: 1000ng/uL genomic DNA1uL,2 xTaq Master Mix 5uL,PCR Primer Mix 1uL, deionized water supplemented with 10uL; the PCR amplification reaction has the amplification procedures that; 95 ℃ for 5min;95 ℃ for 30s; 30s at 60 ℃; 30s at 72 ℃ for 30 cycles; 72 ℃ for 10min;4 ℃ is infinity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211695652.2A CN116024373A (en) | 2022-12-28 | 2022-12-28 | SNP molecular marker related to grape cold resistance and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211695652.2A CN116024373A (en) | 2022-12-28 | 2022-12-28 | SNP molecular marker related to grape cold resistance and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116024373A true CN116024373A (en) | 2023-04-28 |
Family
ID=86077451
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211695652.2A Pending CN116024373A (en) | 2022-12-28 | 2022-12-28 | SNP molecular marker related to grape cold resistance and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116024373A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017062618A1 (en) * | 2015-10-06 | 2017-04-13 | Iowa State University Research Foundation, Inc. | Plants with improved agronomic characteristics |
| CN108103238A (en) * | 2018-03-02 | 2018-06-01 | 沈阳农业大学 | V. amurensis SNP marker and the application in genetic map construction, the positioning of white rot resistance |
| CN113444827A (en) * | 2021-06-25 | 2021-09-28 | 山东大丰园农业有限公司 | Grape variety specific molecular marker and screening method and application thereof |
-
2022
- 2022-12-28 CN CN202211695652.2A patent/CN116024373A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017062618A1 (en) * | 2015-10-06 | 2017-04-13 | Iowa State University Research Foundation, Inc. | Plants with improved agronomic characteristics |
| CN108103238A (en) * | 2018-03-02 | 2018-06-01 | 沈阳农业大学 | V. amurensis SNP marker and the application in genetic map construction, the positioning of white rot resistance |
| CN113444827A (en) * | 2021-06-25 | 2021-09-28 | 山东大丰园农业有限公司 | Grape variety specific molecular marker and screening method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| KAI SU等: "High-density genetic linkage map construction and cane cold hardiness QTL mapping for Vitis based on restriction site-associated DNA sequencing", BMC GENOMICS, vol. 21, 22 June 2020 (2020-06-22), pages 419 * |
| 邢卉阳: "基于高密度遗传图谱构建的葡萄抗寒性QTL定位及候选基因筛选研究", 中国优秀硕士学位论文全文数据库 农业科技辑, 15 February 2020 (2020-02-15), pages 048 - 205 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755481B (en) | SSR molecular marker VI for identifying progeny plants of Gala apples and application thereof | |
| CN103555717B (en) | Functional molecular markers of related genes of sweetness and sourness characters of muskmelon and application of markers | |
| CN113151561A (en) | Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof | |
| CN109338002B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| CN109880932B (en) | SSR primer pair for identifying cotton 1279 in hybrid cotton variety, product thereof and identification method | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN116024373A (en) | SNP molecular marker related to grape cold resistance and application thereof | |
| CN114032330B (en) | SNP molecular marker for rapidly identifying apple anthracnose | |
| CN110724755B (en) | CAPS marker primer group linked with watermelon internode length and application thereof | |
| CN116814841B (en) | Primer group for identifying rice black brown glume gene HK4, and method and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof | |
| CN111996276B (en) | SNP molecular marker for identifying cold resistance of Hanfu apple hybrid progeny and application thereof | |
| CN115873972B (en) | KASP molecular marker related to oat plant height and application thereof | |
| CN113736908B (en) | SNP locus combination for detecting tomato leaf mold resistance and application thereof | |
| US20230042006A1 (en) | Kits and methods for pedigree division and paternity testing of domestic pigs | |
| CN117448480A (en) | Molecular marker for detecting pear cold quantity required property and application thereof | |
| CN116590462A (en) | Development and application of novel gene locus of rice dwarf | |
| CN115992289A (en) | Development of KASP (KASP-related fragment thereof) marker related to corn stem rot resistance gene and application thereof | |
| CN115094157A (en) | KASP marker development and application of low temperature resistant gene COLD1 of rice seedling stage | |
| CN117737294A (en) | Molecular marker and method for rapidly identifying purity of tomato winter rhyme hybrid seeds | |
| CN117683938A (en) | KASP molecular marker closely linked with tomato fruit width and application thereof | |
| CN118086549A (en) | SNP (Single nucleotide polymorphism) marker for screening oil tea fruit quantity, screening method, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |