CN113403388A

CN113403388A - Primer, kit and analysis method for ADTKD gene mutation detection

Info

Publication number: CN113403388A
Application number: CN202110824715.9A
Authority: CN
Inventors: 赵明珠; 李红梅; 蒋更如; 林芙君
Original assignee: Shanghai Jiaotong University; XinHua Hospital Affiliated To Shanghai JiaoTong University School of Medicine
Current assignee: Shanghai Jiaotong University; XinHua Hospital Affiliated To Shanghai JiaoTong University School of Medicine
Priority date: 2021-07-21
Filing date: 2021-07-21
Publication date: 2021-09-17

Abstract

The invention relates to a primer, a kit and an analysis method for ADTKD gene mutation detection. The technical scheme of the invention comprises the following steps: PCR primer design, replaced magnetic beads, enzyme, applicable system design and the like. The invention realizes the gene mutation detection of different samples, different types of the genes and the like through the optimized screening of a series of reagents. The method targets gene segments of five genes, the sequencing length is between 1.6kbp and 3kbp, short fragments of about 300bp of the genes are not needed, a target full-length sequence is directly obtained, and the detection accuracy of mutation and indel is higher through cyclic consensus sequence analysis. Particularly for MUC1 gene, the method overcomes the defect that WES can not accurately splice and compare the repeated region of the gene, can obtain accurate cyclic consistent sequence, visually identify the number of the repeated region and the mutation site, and solves the problem that WES can not detect the mutation of the gene.

Description

Primer, kit and analysis method for ADTKD gene mutation detection

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to a primer, a kit and an analysis method for ADTKD gene mutation detection.

Background

Autosomal Dominant Tubulointerstitial Kidney Disease (ADTKD) is a group of interstitial kidney diseases with genetic predisposition and familial aggregative properties. Such renal patients eventually enter end-stage renal disease (ESRD for short), which imposes a heavy burden on individuals, families and society.

In 2015, global kidney disease prognosis improvement tissue (KDIGO for short) has achieved consensus on renaming, clinical manifestations, kidney pathology, diagnosis and treatment of autosomal dominant tubulointerstitial kidney disease. 5 ADTKD virulence genes (UMOD, MUC1, HNF1B, REN, SEC61A1) have been found and correspond to their genotyping. The type-B ultrasonic diagnosis of ADTKD patients shows no typical characteristics, so that great trouble is brought to clinical diagnosis. Detection of gene mutations is the only method for the definitive diagnosis of ADTKD and its subtypes.

At present, the family history, histopathological features and gene mutation detection of a suspected patient are taken as the basis for ADTKD diagnosis and confirmation. The basis of the diagnosis: (1) patients have clinical manifestations of typical interstitial renal lesions, while providing a family history of well-defined autosomal dominant patterns (renal disease history in at least two generations of orthotics); (2) damage, diabetes, etc. The basis for confirmation of diagnosis: (1) family history involving at least 1 family member is consistent with the clinical manifestations and histopathological features of ADTKD; (2) the patient has been found to have a mutation in one of the five genes, or at least 1 family member, by gene sequencing.

There are five main reasons for genetic testing of ADTKD-suspected patients: (1) patients suspected of being ADTKD need to be diagnosed; (2) members of the family with normal renal function have a willingness to donate the kidney; (3) healthy persons at risk for ADTKD; (4) the adult receives genetic diagnosis before embryo implantation and is good for birth and good for care; (5) the principle of ADTKD early intervention and disease treatment caused by different gene mutations are different, and the early intervention of children with HNFIB and REN mutations is recommended to improve the prognosis, and children with kidney disease experts should be consulted for treatment. Whereas UMOD and MUCI mutation carriers were dominated by regular clinical follow-up, and no early intervention was recommended. If ADTKD patients have suffered renal function impairment, treatment is carried out according to the treatment guidelines for chronic renal disease. Allopurinol or febuxostat can reduce hyperuricemia caused by UMOD mutation and relieve gout symptoms. Patients entering ESRD may be considered for alternative treatment such as hemodialysis, peritoneal dialysis or kidney transplantation.

It is currently believed that the occurrence of ADTKD is mainly associated with 5 genetic mutations, UMOD, MUC1, HNF1B, REN and SEC61a1, respectively. Wherein, the prevalence rate of ADTKD-UMOD is 37.1%, which is the most common subtype of ADTKD; the prevalence of ADTKD-MUC1, 21%, is the second most common subtype of ADTKD; the remaining 3 gene mutation types are rare.

The UMOD gene maps to human chromosome 16p12, consists of 11 exons, and encodes uromodulin. It consists of 640 amino acids, is rich in (48) cysteine residues, and cysteine is very important in maintaining the normal three-dimensional structure and function of protein. It encodes urine regulatory protein, specifically expresses in loop ascending branch thick segment (TAL for short) epithelial cell, can enhance barrier function of TAL epithelial cell, increases expression of renal medullary potassium channel, and activates Na + -K + -2 Cl-transporter. After the UMOD gene is mutated, the function of a TAL epithelial cell Na + -K + -2 Cl-transporter is inhibited, and the reabsorption of uric acid by a proximal convoluted tubule is increased, which is probably a mechanism of combining hyperuricemia of partial UMOD mutation patients. In addition, it has been shown that structurally or functionally abnormal uromodulin produced by mutations in UMOD accumulates in the endoplasmic reticulum of cells, causing damage to renal tubular epithelial cells, releasing various inflammatory mediators, inducing immune responses and causing inflammatory cell infiltration. Recent studies found that UMOD mutations in renal tissue in patients with TAL epithelial cell apical uromodulin expression decreased on cilia suggesting that UMOD mutations may be associated with ciliary dysfunction. Cilia located in the apical membrane of the tubular epithelial cells are currently known to be involved in a number of important intracellular signal transduction pathways, and ciliary dysfunction is one of the major pathogenesis of Autosomal Dominant Polycystic Kidney Disease (ADPKD). It can therefore also be seen that there may be a close relationship between ADTKD and ADPKD in pathogenesis.

The MUC1 gene maps to human chromosome 1q22 and contains 7 exons, and the 2 nd exon contains a plurality of tandem repeats (VNTRs for short). The encoded product MUC1 mucin is typical type I transmembrane mucin and consists of a polypeptide skeleton and glycosyl side chains connected by O-glycosidic bonds. The MUC1 gene can be expressed in various tissues under normal conditions, is widely distributed in a far-end renal tubule in the kidney and has an important function of maintaining the renal tubular cavity. The VNTRs domain of MUC1, if a cytosine deoxynucleotide is inserted into it, results in a frameshift of the gene, a new peptide chain is generated that cannot fold into a protein with normal function and accumulates in the tubular epithelial cells, eventually leading to tubular dysfunction and necrosis. In many studies, the MUC1 gene No. 2 exon tandem repeat region is frequently mutated into 4 types of gene mutations, namely 28dupA, 26_27insG, 23delinsAT and 27dupC, wherein 27dupC (90 percent of proportion) is used as a main mutation type, so that ADTKD is caused.

The HNF1B gene is located in human chromosome 17q12, contains 9 exons, and codes for hepatocyte nuclear factor 1 beta (HNF 1 beta). HNF1 beta is a member of a transcription factor superfamily containing homologous structural domains, plays an important role in tissue-specific regulation and control of gene expression in various organs such as pancreas, kidney, intestinal tract, liver, reproductive tract and the like, and is also involved in embryonic development of the organs. The HNF1B gene heterozygous mutation can cause abnormality of pancreas, kidney, reproductive tract, liver, intestinal tract and the like, the clinical expression of the mutation can be isolated or multi-system affected, and the severity of the clinical phenotype of affected patients in the same family is greatly different. The HNF1B mutation is one of the main pathogenesis of congenital renal morphological abnormality, the genetic mutation causes renal damage to have greatly different severity, severe cystic nephropathy can be generated in severe cases, and renal function can be kept normal for a long time in light cases. The childhood-type HNF1B mutant kidney damage was very significant, while islet damage was mild to no longer involved. The hybrid HNF1B mutation is closely related to the juvenile renal cyst and diabetes syndrome.

The REN gene, which maps to human chromosome 1q32, contains 10 exons and encodes prorenin, which is further hydrolyzed to form renin. Renin itself, as a protease, can break down angiotensinogen to form angiotensin i, playing its important physiological role. It is unclear how mutant REN induces tubulointerstitial fibrosis, while apoptosis is induced by accumulation of abnormal renin encoded by its mutant gene among cells.

The SEC61A1 gene is located in human chromosome 3q21, contains 12 exons, and encodes a protein belonging to SECY/SEC 61-alpha family, which plays a key role in the insertion of secretory polypeptides and membrane polypeptides into the endoplasmic reticulum. This protein was found to be closely associated with membrane-bound ribosomes, with mutations in SEC61a1 resulting in an autosomal dominant hereditary syndrome, and defects in protein transport across the endoplasmic reticulum membrane being the pathogenic mechanism for the formation of ADTKDs.

At present, the sequencing technology (WES for short) of human exons in the second generation gene sequencing is an important mode for ADTKD clinical diagnosis. However, the method can only solve the mutation detection of four genes of UMOD, HNF1B, REN and SEC61A1, and cannot solve the mutation detection of MUC1 gene.

CN112760371A discloses a primer, a kit and an analysis method for detecting MUC1 gene mutation, and the problem of mutation detection of MUC1 gene is solved by three generations of single molecule sequencing. However, the mutation of MUC1 in five pathogenic genes is detected separately, and the detection of UMOD, HNF1B, REN and SEC61A1 is not involved, so that the clinical diagnosis of patients is carried out with longer waiting time and more medical cost.

US20210169827a1 relates to compositions and methods for the diagnosis and treatment or prevention of proteinopathies, in particular renal disease associated with MUC1 (ADTKD-MUC1 or MKD), retinitis pigmentosa (e.g. due to rhodopsin mutations), autosomal dominant tubulo-interstitial nephropathy caused by Umod mutations (ADTKD-Umod), which patent discloses also only the detection of Umod, MUC1 among five causative genes, and does not relate to the simultaneous detection of the genes HNF1B, REN, SEC61a 1.

Therefore, a gene diagnosis and genotyping method for detecting all mutations of the ADTKD-related gene at once is currently lacking.

Disclosure of Invention

The invention aims to solve the problem of obtaining possible exon mutation regions of five genes (UMOD, MUC1, HNF1B, REN and SEC61A1) and sequencing the possible mutation regions by adopting a single-molecule real-time sequencing technology.

The technical scheme of the invention comprises the following steps: PCR primer design, replaced magnetic beads, enzyme and an applicable system, and the detection cost is reduced. Analytical problems addressed include: and (3) establishing an analysis method by utilizing data generated by a single-molecule real-time sequencing technology, correcting and mutational analyzing a sequencing result, and providing accurate ADTKD gene diagnosis and genotyping judgment.

In order to solve the problems in the prior art, improve the applicability of an experimental method and an analysis method and reduce the detection cost, the invention realizes the gene mutation detection of different samples, different types of the genes and the like by optimizing and screening a series of reagents. The invention aims to provide a gene diagnosis and genotyping method for ADTKD, which comprises a PCR primer, a library construction kit, a machine sequencing tag connector sequence on a 16-sample mixed sample and a long-fragment sequencing mutation analysis method.

The kit for diagnosing and genotyping the gene of the ADTKD comprises a PCR primer, polymerase, a reaction system and establishment of reaction conditions, and also comprises the establishment of a purified magnetic bead, a library establishing joint, a library establishing enzyme and a reaction system.

The establishment of the PCR system comprises primer design, label design, polymerase, a reaction system and reaction conditions. 14 pairs of primer designs covering all the mutation sites affecting the encoded protein currently reported in the literature in the UMOD, MUC1, HNF1B, REN, SEC61a1 genes, including 125 reported mutations of UMOD, 4 reported mutations of MUC1, 77 reported mutations of HNF1B, 4 reported mutations of REN, 2 reported mutations of SEC61a1, totaling 212. Meanwhile, the method can also be used for detecting novel mutation types which are not reported in the regions and influence the protein coding. 16 pairs of labels are designed, and the ADTKD gene mutation detection can be simultaneously carried out on 16 samples.

The purpose of the invention can be realized by the following technical scheme:

the invention firstly provides primers for detecting the ADTKD gene mutation, which comprise 14 pairs of primers, wherein the 14 pairs of primers have the following sequences:

M1:ATGTTCTCAGCCCGGTCCTC

M2:CTGTGTGAGGGCAGAGGTTTTT

M3:AACTTGCATCATCTCCTTTGGC

M4:GACTAGACTGTTTTCAGCACCCC

M5:ATGAACGGTGGAGGCTTGAC

M6:CATGGCACAGGTAACACTTGGA

M7:CTCATTCCGTCTTCAGCGTTTA

M8:GCTTCTTAGTTTTCCCCCACC

M9:TACATGGTTTGGCTTCTCTGC

M10:CCACCACCTCTGCTCTACCA

M11:AGAGGCCAGTCAGGGACAAA

M12:GCACCTAGGGGATGCTAAGGT

M13:CTCAACACCTCCCAAGCACAG

M14:AAGGTGCATACACAGGCAAAGA

M15:TAGTCTCAACCCCCAAATCCTC

M16:CTCCCATAAGCCACTCTCTCCT

M17:CAGCTGCTGTTTCTCTTTCCAG

M18:AGGCCCAACCTTTGCTTACC

M19:TCCTGAAGATGGGAAGTCCTCT

M20:GTCTCTCGCTCTAAGCAGCAAAC

M21:AAGGTTAGGTGAAGTTTGGCTG

M22:AAGTTCCCCTGATTGTTTTGG

M23:CTGTGCCCACTTTATTTGTGTTAG

M24:TCTTATTTGTTGTGTTTACCCCAGA

M25:TGTGTACTGGAGATGTGGAAAAAGT

M26:AGGTAAGAGGACAATGGAGCAA

M27:GGAGAAAAGGAGACTTCGGCTACCCAG

M28:GCCGTTGTGCACCAGAGTAGAAGCTGA

in the 14 pairs of primers designed by the invention, M1-M6 and M23-M24 correspond to UMOD genes, M7-M10 correspond to SEC61A1 genes, M11-M12 correspond to REN genes, M13-M22, M25-26 correspond to HNF1B genes, and M27-M28 correspond to MUC1 genes.

The 14 pairs of primers designed by the invention cover all mutation sites which are reported in the current literature and affect the encoded protein in UMOD, MUC1, HNF1B, REN and SEC61A1 genes, and comprise 125 reported mutations of UMOD, 4 reported mutations of MUC1, 77 reported mutations of HNF1B, 4 reported mutations of REN and 2 reported mutations of SEC61A1, wherein the total number of the mutations is 212. Meanwhile, the 14 pairs of primers of the invention can also be used for detecting novel mutation types which are not reported at present in the regions and influence protein coding.

The invention also provides a kit for detecting the ADTKD gene mutation, which comprises: the primer for detecting the mutation of the ADTKD gene in the first aspect of the invention.

In some embodiments of the invention, the kit for detecting mutations in the ADTKD gene further comprises a sequencing tag adaptor on the sample, wherein the sequencing tag adaptor on the sample is selected from one or more of the following.

When in use, a plurality of label joints are required to be added for making a plurality of samples, and the invention provides 16 label joints, so that the detection of 16 samples can be simultaneously carried out at one time.

In some embodiments of the invention, the kit for detecting mutations in the ADTKD gene further comprises magnetic beads for purification, DNA repair enzyme, DNA end blunting enzyme, DNA ligase, DNA exonuclease;

the above-mentioned magnetic beads for purification, DNA repair enzyme, DNA end blunting enzyme, DNA ligase, DNA exonuclease and the like are commonly used raw materials in biotechnology and are commercially available.

In one embodiment of the present invention, the DNA polymerase is selected from the group consisting of Takara DNA polymerase;

the magnetic Beads for purification are selected from AMPure XP Beads of Beckman company.

The preparation method of the magnetic beads for purification comprises the following steps:

1) resuspend AMpure XP beads, take out 500ul, centrifuge at 16000rpm for 1min, place on magnetic frame, take out supernatant to new tube for preservation.

2) Adding 1ml of water on the magnetic beads, resuspending, centrifuging at 16000rpm for 1min, placing on a magnetic frame, taking out the supernatant, and discarding; repeating for 4-5 times.

3) 1ml of 10mM Tris-HCl (pH8.5) was added to the beads, mixed and resuspended, centrifuged at 16000rpm for 1min, placed on a magnetic frame and the supernatant removed and discarded.

4) The supernatant stored in the first step was added to beads and resuspended. This is the treated beads which can be stored at 4 ℃ until use.

The DNA Repair enzyme selects NEB Next FFPE DNA Repair Mix.

The DNA end-blunting enzyme selects NEB Next end repair enzyme mix.

The DNA ligase is selected from T4DNA ligase from Thermofisiher company, 5U/ul.

The DNA Exonuclease is selected from Exonuclease VII (NEB) and Exonuclease III (NEB).

In one embodiment of the present invention, the kit for detecting mutations in the ADTKD gene further comprises instructions for use, wherein the instructions for use comprise:

establishing a PCR reaction system:

genomic DNA template: 100ng

5×Reaction Buffer：5μl，

dNTP(2.5mM each)：2μl，

DNA Polymerase：0.5μl，

Primer F (10. mu.M primer, HPLC grade) 0.5. mu.l,

primer R (10. mu.M primer, HPLC grade) 0.5. mu.l,

complement ddH₂O to a total volume of 25. mu.l.

Wherein, the primer F and the primer R respectively refer to primers used for detecting four gene mutations of UMOD, HNF1B, REN and SEC61A1, and when the UMOD gene mutation is detected, the primer F and the primer R are selected from M1-M6 and M23-M24; when detecting HNF1B gene mutation, the primer F and the primer R are selected from M13-M22 and M25-26; when detecting the REN gene mutation, the primer F and the primer R are selected from M11-M12; when detecting SEC61A1 gene mutation, the primer F and the primer R are selected from M7-M10.

The above primers F and R used in an amount of 10. mu.M mean that 10. mu.M of each primer is required.

In one embodiment of the present invention, since there are 13 pairs of primers used for detecting four mutations of genes UMOD, HNF1B, REN, and SEC61A1, there are specifically 13 PCR reaction systems in actual use, but these different reaction systems are the same except that the primers are different.

In one embodiment of the present invention, since there are 13 PCR reaction systems, 13 PCR products are also mixed to obtain a mixed system.

And performing sample mixing optimization through the statistics of the numbers of reads corresponding to the final PCR in equal proportion in the first experiment, so as to realize the equal proportion (equal proportion refers to the consistency of the numbers of the reads generated by the data) sequencing data output of a plurality of target bands. The mixing ratio was as follows:

the 13 amplified regions above are the amplified regions corresponding to the 13 pairs of primers. Wherein, M1-M6, M23-M24 correspond to UMOD genes, M7-M10 correspond to SEC61A1 genes, M11-M12 correspond to REN genes, M13-M22 and M25-26 correspond to HNF1B genes.

establishing PCR reaction thermal cycle conditions:

98℃，5min；

98 ℃, 10s, 68 ℃, 2min and 30 sec; 30 cycles;

68℃，5min；

4℃，∞。

establishment of MUC1 gene PCR reaction system: the PCR reaction mixture system is as follows: each Reaction mixture system was 50. mu.l containing 200ng of genomic DNA template, 5 × Reaction Buffer 10. mu.l, dNTP (2.5mM each) 4. mu.l, DNA Polymerase 1. mu.l, primer F (10. mu.M primer, HPLC grade) 1. mu.l, primer R (10. mu.M primer, HPLC grade) 1. mu.l, and complement ddH₂O to a total volume of 50. mu.l. Wherein, the primer F and the primer R are selected from M27-28, M27-M28 corresponding to MUC1 gene.

When the MUC1 gene PCR reaction system is established, 8 tubes can be amplified simultaneously.

MUC1 gene PCR reaction thermal cycling conditions were established: the PCR thermal cycling conditions were: preheating a hot cover at 105 ℃, preserving heat at 98 ℃ for 5min, and then entering 30 cycles (adopting a two-step thermal cycle condition): denaturation temperature 98 ℃ for 10s (1 st to 30 th cycle), followed by annealing and extension temperature: 74 ℃ 4min (1 st to 5 th cycle)/72 ℃ 4min (6 th to 10 th cycle)/70 ℃ 4min (11 th to 15 th cycle)/68 ℃ 4min (16 th to 30 th cycle). The final extension temperature was maintained at 68 ℃ for 10min and subsequently at 4 ℃.

establishing a purification system: preparing 1.0% -1.2% agarose gel, and detecting whether the PCR product band is correct or not; purification using 0.8X magnetic beads; the concentration was checked using Qubit 4.0 and the product was ready for use.

In one embodiment of the invention, the method comprises the steps of establishing a library establishing system, and sequentially preparing a linker sequence, a connecting system, an enzyme digestion system, magnetic bead pretreatment and a purification system.

Preparation of a linking system: 6. mu.l of T4DNA ligase (Thermofisiher), 4. mu.l of 10X T4DNA ligase buffer (Thermofisiher), 1ul of prepared linker, PCR product, and ddH2O were prepared, and the total system volume was 40. mu.l; the reaction condition of the system is set at 22 ℃ and is more than or equal to 10h (the temperature of a hot cover is 25 ℃).

Preparation of an enzyme digestion system: preparing 0.5 mul of Exonuclease VII and 0.5 mul of Exonuclease III; the reaction conditions of the system are set at 37 ℃ for 1 h.

Pretreatment of magnetic beads: AMpure XP magnetic beads (Beckman) were treated with equal volumes of ddH₂Rinsing with O for 4-5 times, and storing with stock solution.

Suitable machine models are: in one embodiment of the invention, the process is carried out by the sequenl and sequenl 2/2e models. The mutation detection effect of the ADTKD pathogenic gene is consistent, and the difference among models does not exist.

The important difficulty of the invention lies in the establishment of a proper analysis method so as to provide clinically accurate ADTKD gene diagnosis and genotyping discrimination. And aiming at the generation-oriented gene sequencing data output mode and error type, the correction and analysis are carried out in a targeted manner.

The invention also provides a method for detecting the mutation of the ADTKD gene, wherein the four genes of UMOD, HNF1B, REN and SEC61A1 are analyzed in a consistent way, and the method comprises the following analysis steps:

step 1: data were corrected within a single molecule well, results were optimized and filtered. The preferred approach sets the minimum prediction accuracy to 90% so that raw data with less than 0.9 accuracy is filtered out.

Step 2: after filtering, splitting different data, and optimizing and filtering the result. And filtering out the original data with the splitting accuracy rate lower than 0.95.

And step 3: sequence alignment is performed with a reference genome.

And 4, step 4: and (3) carrying out DNA sequence variation site detection by using a convolutional neural network, and carrying out detection aiming at SNP and small InDel. DeepVariant is a new algorithm developed by Google company and aiming at detecting the whole genome sequencing variant site, and the algorithm is different from general statistical software and utilizes a convolutional neural network to identify the variant site. The effect is very ideal, and is more flexible than the existing algorithm. Deepvariant can be applied to data sequencing including second and third generations. Inputting a reference genome, the aligned sequences to be analyzed and the regions to be analyzed, and outputting a variation file comprising vcf, gvcf and the like. The overall process run time is about 5 minutes to 10 minutes.

And 5: genome annotation, using annovar software. Annotating the vcf file generated in step 4, with hg19 as the reference genome, 9 databases were selected, refGene, cytoband, etc. And after the annotation is finished, generating a csv file which contains mutation-related annotation information and the significance degree obtained by comparing the mutation-related annotation information with different databases.

The invention also provides a method for detecting the mutation of the ADTKD gene, wherein the method for analyzing the mutation of the MUC1 gene comprises the following steps:

Step 2: after filtering, splitting different data, and optimizing and filtering the result. Preferably, a minimum label split score of 55 is set, and raw data with a split accuracy of less than 0.75 is filtered out.

And step 3: and performing data clustering and statistical analysis based on multiple sequence alignment, and preferably selecting a clustering result. And performing multiple sequence comparison on the data retained after the splitting, and clustering similar data. The clustering result with high accuracy of more than 99.99 percent is preferred.

And 4, step 4: and (4) carrying out base position recalibration by using the original data to obtain the accuracy of each base position of the clustering result, and optimizing the result. The clustering result with high accuracy of more than 99.99 percent is preferred.

And 5: and (3) optimizing the clustering result of the base position re-correction by combining PCR experimental data so as to obtain accurate mutation judgment. Preferably, the PCR byproduct results are filtered for clustering results that match the length of the PCR product.

Compared with the second-generation exon capturing WES, the method targets gene segments of five genes, the sequencing length is between 1.6kbp and 3kbp, short fragments of about 300bp of the genes are not needed, a target full-length sequence is directly obtained, and the detection accuracy of mutation and indel is higher through cyclic consensus sequence analysis. Particularly for MUC1 gene, the method overcomes the defect that WES can not accurately splice and compare the repeated region of the gene, can obtain accurate cyclic consistent sequence, visually identify the number of the repeated region and the mutation site, and solves the problem that WES can not detect the mutation of the gene.

The invention has the beneficial effects that:

(1) the invention provides an experimental method and an analytical method for mutation detection of five pathogenic genes (UMOD, MUC1, HNF1B, REN and SEC61A1) of ADTKD. The WES method used in the past can only solve the mutation detection of four genes (UMOD, HNF1B, REN and SEC61A1) and the omission of the genetic mutation of the second most common subtype MUC1 of ADTKD often causes many clinical missed diagnoses. The invention not only provides one-time detection of five gene mutations based on the consensus of the ADTKD disease experts at present, and accurate genotyping and mutation site information, but also saves the detection cost of patients and reduces the detection waiting time of ADTKD suspected patients.

(2) The invention solves the problem of disease screening and diagnosis of ADTKD patients, and has very important significance for disease diagnosis of ADTKD patients and gene mutation screening and treatment intervention of family members. The kit has important significance for definite diagnosis and guide treatment of suspected ADTKD patients, preoperative evaluation of normal renal function family members with the intention of donating kidney, early screening of healthy people with ADTKD risk, genetic diagnosis and prenatal and postnatal care before adults receive embryo implantation.

(3) The invention comprises an effective PCR amplification system and an effective library construction system, the PCR system and the library construction system are matched for use, the experimental cost of five gene mutation detections is reduced, and the invention has wide applicable machine types, including the sequenl and the sequenl 2/2e machine types.

(4) The invention comprises an optimized detection system, the required whole blood dosage is about 200ul, the extractable blood cell DNA yield is about 4-10ug on average, and the detection of the mutation of five pathogenic genes of the ADTKD is sufficient. The whole blood consumption is less, the detection accuracy and the detection sensitivity are high.

(5) The invention provides an optimized correction and analysis method, can obtain accurate mutation interpretation of five pathogenic genes of the ADTKD, has the accuracy rate of 99.99 percent, solves the problem that the original data of the third generation single molecule real-time sequencing has low accuracy rate and inaccurate gene mutation discrimination, and provides a more reliable conclusion for clinic.

Drawings

FIGS. 1 to 5 are graphs showing the results of electrophoresis of 14 PCR products in example (sample 0, sample 1, sample 2, sample 3, sample 4, sample 5, and sample 6).

Detailed Description

The invention is described in detail below with reference to the figures and specific embodiments.

Example 1

The embodiment provides a gene diagnosis and genotyping method for ADTKD, which covers the regional mutation diagnosis of all mutation sites affecting encoded proteins reported in the current literature by five genes of UMOD, MUC1, HNF1B, REN and SEC61A1, and comprises 14 pairs of PCR amplification primers, a library construction kit, a 16-sample mixed sample computer sequencing tag adaptor sequence and a long fragment sequencing sequence mutation analysis method.

In this example, the DNA polymerase from Takara was selected as the DNA-amplifying enzyme;

The DNA Repair enzyme selects NEB Next FFPE DNA Repair Mix.

The DNA terminal blunting enzyme is used for selecting NEBNext end repair enzyme mix.

The DNA ligase is selected from T4DNA ligase from the company thermofisher, 5U/ul.

Wherein, the 14 pairs of PCR amplification primers M1-M28 are:

The invention provides a kit for detecting ADTKD gene mutation, which comprises the primers and an on-sample sequencing tag linker, wherein the on-sample sequencing tag linker is selected from one or more of the following.

Example 2

This example establishes an amplification system based on the gene diagnosis and genotyping kit for ADTKD provided in example 1.

Specifically, when the kit is used for detecting MUC1 gene mutation, the PCR reaction mixture system is as follows: each Reaction mixture system was 50. mu.l containing 200ng of genomic DNA template, 5 × Reaction Buffer 10. mu.l, dNTP (2.5mM each) 4. mu.l, DNA Polymerase 1. mu.l, primer F (10. mu.M primer, HPLC grade) 1. mu.l, primer R (10. mu.M primer, HPLC grade) 1. mu.l, and complement ddH₂O to a total volume of 50. mu.l. The primer F and the primer R are selected from M27-28, M27-M28 corresponding to MUC1 gene.

The PCR thermal cycling conditions were: preheating a hot cover at 105 ℃, preserving heat at 98 ℃ for 5min, and then entering 30 cycles (adopting a two-step thermal cycle condition): denaturation temperature 98 ℃ for 10s (1 st to 30 th cycle), followed by annealing and extension temperature: 74 ℃ 4min (1 st to 5 th cycle)/72 ℃ 4min (6 th to 10 th cycle)/70 ℃ 4min (11 th to 15 th cycle)/68 ℃ 4min (16 th to 30 th cycle). The final extension temperature was maintained at 68 ℃ for 10min and subsequently at 4 ℃.

Namely, the amplification reaction conditions were as follows:

98℃，5min；

98 ℃, 10s, 74 ℃ and 4 min; 5 cycles;

98 ℃, 10s, 72 ℃ for 4 min; 5 cycles;

98 ℃, 10s, 70 ℃ and 4 min; 5 cycles;

98 ℃, 10s, 68 ℃ for 4 min; 5 cycles;

68℃，10min；

4℃，∞。

specifically, when four gene mutations of UMOD, HNF1B, REN and SEC61A1 are detected in the kit, the PCR reaction system is as follows:

genomic DNA template: 100ng

5×Reaction Buffer：5μl，

dNTP(2.5mM each)：2μl，

DNA Polymerase：0.5μl，

Primer F (10. mu.M primer, HPLC grade) 0.5. mu.l,

primer R (10. mu.M primer, HPLC grade) 0.5. mu.l,

complement ddH₂O to a total volume of 25. mu.l.

Since there are 13 pairs of primers used for detecting four mutations of UMOD, HNF1B, REN, SEC61A1, there are 13 PCR reaction systems in practice, but these different reaction systems are the same except for the different primers, and one tube is amplified when used.

The PCR thermal cycling conditions were: preheating a hot cover at 105 ℃, preserving heat at 98 ℃ for 5min, and then entering 30 cycles (adopting a two-step thermal cycle condition): the denaturation temperature was held at 98 ℃ for 10s (1 st to 30 th cycles), followed by an annealing and elongation temperature of 68 ℃ for 2min 30 sec. The final extension temperature was maintained at 68 ℃ for 5min and subsequently at 4 ℃.

Namely, the amplification reaction conditions were as follows:

98℃，5min；

98 ℃, 10s, 68 ℃, 2min and 30 sec; 30 cycles;

68℃，5min；

4℃，∞。

the amplified products are detected by agarose gel electrophoresis of 1.0-1.2% to detect the fragment size of the amplified products.

Establishing a purification system: preparing 1.0% -1.2% agarose gel, and detecting whether the PCR product band is correct or not; purification was performed using 0.8X magnetic beads (magnetic beads for purification designed in example 4); the concentration was checked using Qubit 4.0 and the product was ready for use.

Example 3

Due to different amplification efficiencies of PCR reactions, the mixing ratio of PCR products needs to be optimized in order to obtain a result with consistent sequencing abundance. This example provides how to obtain a pooled volume of each PCR product.

This example provides a means for obtaining a pool of 13 PCR products with consistent sequencing abundance. And adjusting the influence of amplification efficiency, recovery efficiency in the library building process and the like by adjusting the proportion of 13 PCR product mixed samples. And (3) adjusting the sample mixing proportion by the proportion of the number of sequencing reads generated finally through equal-volume mixed sample loading, and realizing equal-proportion sequencing data output of a plurality of target bands.

The 13 amplified regions are amplified regions corresponding to 13 pairs of primers. Wherein, M1-M6, M23-M24 correspond to UMOD genes, M7-M10 correspond to SEC61A1 genes, M11-M12 correspond to REN genes, M13-M22 and M25-26 correspond to HNF1B genes.

The specific mixing pattern is shown in the following table:

after the mixture is mixed according to the proportion, the sequencing is carried out on a machine, the sequencing abundance of clinical samples is basically consistent, and the table below shows that:

name of targeting sequence	Sample 3-reads number	Sample 4-reads number	Sample 5-reads number
				Amplification region
1	6937	8354	9661
				Amplification region 2	6365	7896	7686
Amplification region 3	5869	5469	5732
				Amplification region 4	6093	7985	7617
Amplification region 5	7551	9937	8463
				Amplification region 6	6533	8958	8449
Amplification region 7	6057	7370	5280
				Amplification region 8	8141	8559	8062
Amplification region 9	4815	7111	6227
				Amplification region 10	7536	9326	8461
Amplification region 11	6535	8696	8095
				Amplification region 12	6175	8218	6861
Amplified region 13	5263	7159	5736

Example 4

Magnetic beads for purification, preparation of a linker sequence and design of an enzyme reaction system. In order to reduce the library construction cost, commercially available magnetic beads and enzymes are adopted to optimize a reaction system, and then the library construction is completed. In this example, the design of the magnetic bead for purification, the linker sequence, and the enzyme reaction system includes a preparation method of the magnetic bead for purification, a design and preparation method of the linker sequence, a repair enzyme reaction system, a ligase reaction system, an enzyme digestion reaction system, and a suitable reaction condition design.

Preparation of magnetic beads for purification:

2) Adding 1ml of water into the magnetic beads, resuspending, centrifuging at 16000rpm for 1min, placing on a magnetic frame, taking out the supernatant, and discarding; repeating for 4-5 times.

Preparation of linker sequence:

1) the adaptor sequence unique to the third generation sequencing was prepared by dissolving the primers to 170. mu.M in 10mM Tris-HCl (pH7.5), preparing 200mM Tris-HCl (pH7.5) and 2M NaCl, and mixing them 1:1 to prepare a mother solution.

2) 10 mul of the primer and 10 mul of the mother liquor are sucked, 80 mul of water is added to dilute the primer to 17 mul; 95 ℃ for 5 min. After the operation is finished, the mixture is quickly taken out and is kept stand at the room temperature of 20-25 ℃ for more than 12 hours; storing at-20 deg.C for use.

Repairing an enzyme reaction system:

1) 53.5ul of DNA sample, 6.5ul of FFPE DNA repair system (10X), 2ul of NEB Next FFPE DNA repair enzyme; 20 ℃ for 15 min.

2) 62ul of repaired DNA sample, 3.5ul of FFPE DNA end filling repair system (10X) and 5ul of NEBNext FFPE end filling enzyme; ddH₂O 29.5ul；20℃，30min。

3) And (5) purifying by using 0.8X magnetic beads.

A ligase reaction system:

1) 23ul of DNA sample after the end filling and repairing, 1ul of adaptor sequence (17uM), 2ul of 10X T4DNA ligase system and 6ul of T4DNA ligase (5U/ul); ligation was carried out overnight at 22 ℃.

2) Inactivating at 65 deg.C for 10 min.

Enzyme digestion reaction system:

1) 40ul of DNA sample after the joint connection, 0.5ul of DNA Exonuclease VII and 0.5ul of DNA Exonuclease III; 37 ℃ for 1 h.

2) And (5) purifying by using 0.8X magnetic beads.

Example 5

This example provides a method for determining the results of 5 gene mutation assays.

The interpretation of the MUC1 mutation detection results in this example was based on a self-developed data analysis method that was applied to data generated by three generations of single molecule real-time sequencing of long fragment PCR amplification products (PacBio SMRT data). According to the data characteristics, the correction and analysis system comprises a data correction module, a data splitting module, a cluster analysis module, a base position re-correction module and a mutation discrimination module. The method can obtain 99.99% mutation discrimination accuracy. And the result of the MUC1 mutation detection is read according to the experimental result.

The data correction module is implemented as follows: and carrying out in-hole subbranches correction on each effective data coordinate hole, and filtering out original data with the accuracy rate lower than 0.9. Through single-hole data correction, each coordinate hole obtains single data read with high accuracy, and holes with low data quality are discarded.

The specific implementation process of the data splitting module is as follows: and (3) setting the minimum data splitting score to be 55 by taking the primers and the sample labels as data splitting bases, and filtering out original data with the splitting accuracy rate lower than 0.75. Through the data splitting step, different sample data detected in the same batch are split at a higher accuracy rate, and data which cannot be subjected to the higher accuracy rate are abandoned.

The specific implementation process of the cluster analysis module is as follows: and performing multiple sequence comparison on the data remained after each sample is split, and performing data clustering and statistical analysis on different PCR products. The clustering result with high accuracy of more than 99.99 percent is preferred. The retained high quality data is fully clustered to retain dominant and non-dominant PCR amplification products. Then, the clustering result is subjected to statistical analysis, and the coverage rate and the read length are given.

The specific implementation process of the base position recalibration module is as follows: and obtaining the original data hole site corresponding to each clustering result through the hole site information. And (3) re-correcting each base position of the clustering result by using the original data of not less than 3000 subreads to obtain the accuracy rate of each base position of the clustering result, preferably the clustering result with the high accuracy rate of more than 99.99%. The strictly-executed clustering standard and the base position re-correction result can realize the detection and analysis of single base mutation with high accuracy. Occasionally, the poor quality of the base position can be accurately found.

The mutation judgment module is implemented in the following specific process: and (3) optimizing the clustering result of the base position re-correction by combining PCR experimental data so as to obtain accurate mutation judgment. Preferably, the PCR byproduct results are filtered for clustering results that match the length of the PCR product.

And optimizing the clustering result of the base position re-correction so as to obtain accurate mutation judgment. Preferably, the PCR byproduct results are filtered for clustering results that match the length of the PCR product. And (3) optimizing the clustering result of the base position re-correction by combining PCR experimental data so as to obtain accurate mutation judgment. Preferably, the PCR byproduct results are filtered for clustering results that match the length of the PCR product.

The interpretation of the other 4 mutation detection results described in this example is based on self-developed data analysis methods, comparing with human reference genome hg19, performing DNA sequence mutation site detection with convolutional neural networks, performing detection for SNP and small InDel, and performing genome annotation using Annovar software.

Example 6: clinical sample test results

In this example, 7 clinical suspected samples (sample 0, sample 1, sample 2, sample 3, sample 4, sample 5, and sample 6) were selected, and whole blood of clinical suspected pathology was collected and leukocyte DNA was extracted for the experiment.

In this example, 7 cases of clinical suspected sample DNA were selected for the experiment, specifically:

when the kit is used for detecting MUC1 gene mutation, the PCR reaction mixture system is as follows: each Reaction mixture system was 50. mu.l containing 200ng of genomic DNA template, 5 × Reaction Buffer 10. mu.l, dNTP (2.5mM each) 4. mu.l, DNA Polymerase 1. mu.l, primer1. mu.l of substance F (10. mu.M primer, HPLC grade), 1. mu.l of primer R (10. mu.M primer, HPLC grade), complement ddH₂O to a total volume of 50. mu.l. Simultaneously 8 tubes were amplified.

Namely, the amplification reaction conditions were as follows:

98℃，5min；

98 ℃, 10s, 74 ℃ and 4 min; 5 cycles;

98 ℃, 10s, 72 ℃ for 4 min; 5 cycles;

98 ℃, 10s, 70 ℃ and 4 min; 5 cycles;

98 ℃, 10s, 68 ℃ for 4 min; 5 cycles;

68℃，10min；

4℃，∞。

when four gene mutations including UMOD, HNF1B, REN and SEC61A1 are detected in the kit, a PCR reaction system is as follows: each Reaction mixture system was 25. mu.l containing 100ng of genomic DNA template, 5 × Reaction Buffer 5. mu.l, dNTP (2.5mM each) 2. mu.l, DNA Polymerase 0.5. mu.l, primer F (10. mu.M primer, HPLC grade) 0.5. mu.l, primer R (10. mu.M primer, HPLC grade) 0.5. mu.l, and complement ddH₂O to a total volume of 25. mu.l. Amplify 1 tube each.

Namely, the amplification reaction conditions were as follows:

98℃，5min；

98 ℃, 10s, 68 ℃, 2min and 30 sec; 30 cycles;

68℃，5min；

4℃，∞。

the amplified products are detected by agarose gel electrophoresis of 1.0-1.2% to detect the fragment size of the amplified products. As shown in fig. 1-5.

Purifying PCR products, mixing samples:

MUC1 PCR products and 13 PCR products for UMOD, HNF1B, REN and SEC61A1 four gene mutation detection are mixed according to a ratio of 3:1, purified by 0.8X magnetic beads and subjected to concentration measurement, and the results are shown in a table.

Then entering a library building process, sequentially carrying out a repair enzyme reaction, a ligase reaction and an exonuclease reaction, and carrying out concentration determination to obtain a library for later use:

repairing an enzyme reaction system:

3) The samples were purified using 0.8 Xmagnetic beads and their concentrations were determined and the results are shown in the table.

A ligase reaction system:

2) Inactivating at 65 deg.C for 10 min.

An exonuclease reaction system:

2) The samples were purified using 0.8 Xmagnetic beads and their concentrations were determined and the results are shown in the table. This is the resulting library.

Performing an on-machine experiment by using a PacBio SMRT standard system, and entering a data correction and analysis process after data is obtained: firstly, single-molecule hole correction is carried out on the data, and original data with accuracy rate lower than 0.9 is filtered out. And then, splitting different data, and filtering out original data with splitting accuracy lower than 0.75. And then carrying out data clustering, preferably on the clustering result with high accuracy of more than 99.99%. And finally, carrying out base bit recalibration by using the original data, and preferably selecting the clustering result with high accuracy of more than 99.99%.

MUC1 can accurately confirm the mutation site by performing artificial independent analysis on the clustering result. The other 13 PCR sequence sites were aligned with the human reference genome hg19, DNA sequence variation site detection was performed using convolutional neural networks, detection was performed for SNP and small InDel, and genome annotation was performed using Annovar software.

Meanwhile, the 7 suspected samples are subjected to second-generation exon capture sequencing and mutation detection analysis. MUC1 shows that the phenomenon that the sequence cannot be accurately identified due to incomplete annotation and high repetition of second-generation sequencing, and mutation results obtained by other 13 PCR targeting sequences are compared with the sequencing analysis result of PacBio SMRT, and the mutation detection results of the ADTKD related genes are highly uniform.

The specific mutation detection results are shown in the following table:

the embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.

Claims

1. The primer for detecting the ADTKD gene mutation is characterized by comprising 14 pairs of primers, wherein the 14 pairs of primers have the following sequences:

M1:ATGTTCTCAGCCCGGTCCTC

M2:CTGTGTGAGGGCAGAGGTTTTT

M3:AACTTGCATCATCTCCTTTGGC

M4:GACTAGACTGTTTTCAGCACCCC

M5:ATGAACGGTGGAGGCTTGAC

M6:CATGGCACAGGTAACACTTGGA

M7:CTCATTCCGTCTTCAGCGTTTA

M8:GCTTCTTAGTTTTCCCCCACC

M9:TACATGGTTTGGCTTCTCTGC

M10:CCACCACCTCTGCTCTACCA

M11:AGAGGCCAGTCAGGGACAAA

M12:GCACCTAGGGGATGCTAAGGT

M13:CTCAACACCTCCCAAGCACAG

M14:AAGGTGCATACACAGGCAAAGA

M15:TAGTCTCAACCCCCAAATCCTC

M16:CTCCCATAAGCCACTCTCTCCT

M17:CAGCTGCTGTTTCTCTTTCCAG

M18:AGGCCCAACCTTTGCTTACC

M19:TCCTGAAGATGGGAAGTCCTCT

M20:GTCTCTCGCTCTAAGCAGCAAAC

M21:AAGGTTAGGTGAAGTTTGGCTG

M22:AAGTTCCCCTGATTGTTTTGG

M23:CTGTGCCCACTTTATTTGTGTTAG

M24:TCTTATTTGTTGTGTTTACCCCAGA

M25:TGTGTACTGGAGATGTGGAAAAAGT

M26:AGGTAAGAGGACAATGGAGCAA

M27:GGAGAAAAGGAGACTTCGGCTACCCAG

M28:GCCGTTGTGCACCAGAGTAGAAGCTGA

the kit comprises a kit body, a kit body and a kit body, wherein M1-M6, M23-M24 are used for detecting UMOD gene mutation, M7-M10 is used for detecting SEC61A1 gene mutation, M11-M12 is used for detecting REN gene mutation, M13-M22, M25-26 is used for detecting HNF1B gene mutation, and M27-M28 is used for detecting MUC1 gene mutation.

2. A kit for detecting mutation in an ADTKD gene, which comprises the primer for detecting mutation in an ADTKD gene of claim 1.

3. The kit for detecting mutations in an ADTKD gene according to claim 2, further comprising an on-sample sequencing tag adaptor selected from one or more of the following:

4. the kit for ADTKD gene mutation detection according to claim 2, further comprising magnetic beads for purification, DNA repair enzyme, DNA end blunting enzyme, DNA ligase and DNA exonuclease.

5. The kit for ADTKD gene mutation detection according to claim 2, further comprising an instruction manual on which:

when four gene mutations of UMOD, HNF1B, REN and SEC61A1 are detected, the PCR reaction system is as follows:

genomic DNA template: 100ng

5×Reaction Buffer：5μl，

dNTP(2.5mM each)：2μl，

DNA Polymerase：0.5μl，

Primer F (10. mu.M primer, HPLC grade) 0.5. mu.l,

primer R (10. mu.M primer, HPLC grade) 0.5. mu.l,

complement ddH₂O to a total volume of 25 μ l;

wherein, the primer F and the primer R respectively refer to primers used for detecting four gene mutations of UMOD, HNF1B, REN and SEC61A1, and when the UMOD gene mutation is detected, the primer F and the primer R are selected from M1-M6 and M23-M24; when detecting HNF1B gene mutation, the primer F and the primer R are selected from M13-M22 and M25-26; when detecting the REN gene mutation, the primer F and the primer R are selected from M11-M12; when detecting SEC61A1 gene mutation, the primer F and the primer R are selected from M7-M10;

when four gene mutations of UMOD, HNF1B, REN and SEC61A1 are detected, the PCR reaction thermal cycling conditions are as follows:

98℃，5min；

98 ℃, 10s, 68 ℃, 2min and 30 sec; 30 cycles;

68℃，5min；

4℃，∞。

6. the kit for ADTKD gene mutation detection according to claim 2, further comprising an instruction manual on which:

when MUC1 gene mutation is detected, the PCR reaction system is as follows:

each Reaction mixture system was 50. mu.l containing 200ng of genomic DNA template, 5 × Reaction Buffer 10. mu.l, dNTP (2.5mM each) 4. mu.l, DNA Polymerase 1. mu.l, primer F (10. mu.M primer, HPLC grade) 1. mu.l, primer R (10. mu.M primer, HPLC grade) 1. mu.l, and complement ddH₂O to the total volume of 50 mu l, wherein the primer F and the primer R are selected from M27-28, M27-M28 corresponding to MUC1 gene;

when MUC1 gene mutation detection is carried out, PCR reaction thermal cycling conditions are as follows:

preheating a 105 ℃ hot cover, preserving heat at 98 ℃ for 5min, and then entering 30 cycles by adopting a two-step thermal cycle condition:

cycle 1 to 30: the denaturation temperature is 98 ℃, the temperature is kept for 10s,

then go to annealing and extension temperature:

maintaining the temperature at 74 ℃ for 4min for 1 st to 5 th cycles;

keeping the temperature at 72 ℃ for 4min for 6 th to 10 th cycles;

maintaining the temperature at 70 ℃ for 4min for 11 th to 15 th cycles;

maintaining the temperature at 68 ℃ for 4min for 16 th to 30 th cycles;

the final extension temperature was maintained at 68 ℃ for 10min and subsequently at 4 ℃.

7. The kit for ADTKD gene mutation detection according to claim 2, further comprising an instruction manual on which:

8. The kit for ADTKD gene mutation detection according to claim 2, further comprising an instruction manual on which:

the method comprises the steps of establishing a library establishing system, sequentially preparing a joint sequence, a connecting system, an enzyme digestion system, preprocessing magnetic beads and establishing a purification system;

preparation of a linking system: 6. mu.l of T4DNA ligase (Thermofisiher), 4. mu.l of 10X T4DNA ligase buffer (Thermofisiher), 1ul of prepared linker, PCR product, and ddH2O were prepared, and the total system volume was 40. mu.l; setting the reaction condition of the system at 22 ℃ for more than or equal to 10 h;

preparation of an enzyme digestion system: preparing 0.5 mul of Exonuclease VII and 0.5 mul of Exonuclease III; setting the reaction condition of the system at 37 ℃ for 1 h;

pretreatment of magnetic beads: AMpure XP magnetic beads (Beckman) were treated with equal volumes of ddH₂Rinsing for 4-5 times with O, and storing with stock solution;

9. The method for detecting the ADTKD gene mutation is characterized in that the analysis methods of four genes of UMOD, HNF1B, REN and SEC61A1 are consistent, and the method comprises the following analysis steps:

step 1: performing single-molecule hole correction on the data, selecting and filtering the result, and filtering out original data with the accuracy rate lower than 0.9;

step 2: splitting different data after filtering, selecting and filtering the result, and filtering out original data with the splitting accuracy rate lower than 0.95;

and step 3: performing sequence alignment with a reference genome;

and 4, step 4: carrying out DNA sequence variation site detection by using a convolutional neural network, and carrying out detection aiming at SNP and small InDel;

and 5: and (3) genome annotation, namely annotating the vcf file generated in the step 4 by using annovar software, selecting refGene and cytopad 9 databases by using hg19 as a reference genome, and generating a csv file after annotation is completed, wherein the csv file contains mutation-related annotation information and the significance degree obtained by comparing the mutation-related annotation information with different databases.

10. The method for detecting ADTKD gene mutation is characterized in that the MUC1 gene mutation analysis method comprises the following steps:

step 2: splitting different data after filtering, selecting and filtering the result, and filtering out original data with the splitting accuracy rate lower than 0.75;

and step 3: performing data clustering and statistical analysis based on multiple sequence comparison, and selecting a clustering result;

and 4, step 4: performing base position recalibration by using original data to obtain each base position accuracy of the clustering results, selecting the results, and selecting the clustering results with the accuracy of more than 99.99%;

and 5: and (3) selecting the clustering result of the base position re-correction by combining PCR experimental data so as to obtain accurate mutation judgment, obtain the clustering result according with the length of the PCR product, and filter the result of the PCR by-product.