CN113637776A

CN113637776A - Primer group special for Diego blood group gene sequencing, kit and method

Info

Publication number: CN113637776A
Application number: CN202111116590.0A
Authority: CN
Inventors: 高宏军; 陈玉平; 王亚恒; 陈芳芳
Original assignee: Jiangsu Zojiwat Biomedical Co ltd
Current assignee: Jiangsu Zojiwat Biomedical Co ltd
Priority date: 2021-09-23
Filing date: 2021-09-23
Publication date: 2021-11-12

Abstract

The invention discloses a kit and a method special for Diego blood type gene sequencing, which optimize and select a key segment of an allele containing a mutation site, and add a matched amplification reagent and a purification program to realize sanger method sequencing of a target allele. The primer group special for Diego blood group gene sequencing provided by the invention can solve the problems of antigen identification of Diego blood group, judgment of difficult blood group, discovery of new mutation sites, gene polymorphism detection and the like.

Description

Primer group special for Diego blood group gene sequencing, kit and method

Technical Field

The invention relates to the technical field of gene diagnosis products, in particular to a primer group, a kit and a method special for Diego blood group gene sequencing.

Background

The gene of the Diego blood group system is SLC4a1, and the encoded protein is part of the anion exchanger family, expressed in the plasma membrane of erythrocytes, and is involved in the transport of carbon dioxide from tissues to the lungs as a chloride/bicarbonate exchanger. The SLC4A1 gene is located on chromosome 17q21.31 and contains 20 exons.

The Diego blood group system currently finds 23 antigens and has important clinical significance. Blood group incompatibility can cause hemolytic transfusion reactions and neonatal hemolytic disease, and even endanger the life of the patient. Each antigen corresponds to a particular allele and can be determined by detecting the site of the mutation. In the prior art, a target sequence of a Diego blood group gene is obtained by a Sanger method or high-throughput sequencing method, and then is compared with a standard sequence. The sanger method sequencing needs to select a target sequence and design a sequencing primer, the sequencing result segment is different from person to person, and the quality and the accuracy of the sequence to be tested are also different according to the object to be tested and the primer. High throughput sequencing can obtain longer target sequences, but is time consuming, labor intensive, and costly, and only requires special samples.

There are many alternatives for the Digeo blood group genotyping methods currently available, such as PCR-SSP, fluorescent PCR, etc. However, these methods can only be designed for specific sites with distinctiveness when designing primers, so that only specific sites in product detection can be typed, and some special or new mutation sites are difficult to be defined.

Disclosure of Invention

The invention aims to solve the technical problem that the Diego blood group gene is difficult to determine due to the occurrence of gene mutation in the prior art, and provides a primer group special for Diego blood group gene sequencing, a kit and a method.

In order to solve the technical problems, the invention provides the following technical scheme:

the primer group special for Diego blood group gene sequencing comprises a primer pair P1 for 14 exon amplification, a primer pair P2 for 16 exon amplification and a primer pair P3 for 19 exon amplification;

wherein the sequence of the primer pair P1 for amplifying the 14 exons is as follows:

P1F：ATCTTCCAGGACCACCCACT；

P1R：GAACTTGCGCAGCATCATGG。

the sequence of the primer pair P2 for amplifying the 16 exons is as follows:

P2F：AAACTCTCGGTGCCTGATGG；

P2R：ATGGGAAACTCGGAACGCAA。

sequence of primer pair P3 for exon 19 amplification:

P3F：GCATGCACTTATTCACGGGC；

P3R：GGCACAGTGAGGATGAGGAC。

the primer sets can be applied to preparation of products specially used for sequencing the Diego blood group genes, and the exons 14, 16 and 19 of the SLC4A1 gene are selected to be divided into three sections for PCR amplification, wherein the three sections are mainly directed at mutation sites of the Diego blood group genes; on the other hand, the target range and the sequence length of amplification are reduced, and the efficiency and the accuracy of amplification are improved; the primer group can effectively avoid the mutation sites discovered so far. Compared with other primer groups for Diego blood type gene sequencing, the primer group has high amplification efficiency and high matching accuracy, and can reduce the detection cost.

A kit for sequencing human Diego blood group genes comprises the primer pair P1 for exon 14 amplification, the primer pair P2 for exon 16 amplification and the primer pair P3 for exon 19 amplification, a PCR amplification premix, gel diluent and other auxiliary reagents.

Preferably, the concentration of the primer pair P1 for exon 14 amplification, the primer pair P2 for exon 16 amplification and the primer pair P3 for exon 19 amplification is 10 to 100 pM.

Components necessary for the detection but not included in the kit:

1.5ml centrifuge tube (for preparing PCR reaction solution and DNA extraction);

0.2ml PCR tube or 8-tube PCR tube or 96-hole PCR plate;

stoppered tips (1ml, 200. mu.l and 10. mu.l);

DNA extraction kit or self-prepared DNA extraction reagent;

agarose gel.

A method for sequencing a human Diego blood group gene, comprising the steps of:

s1, respectively amplifying 14 exons, 16 exons and 19 exons of the SLC4A1 gene by using a primer pair P1 for amplifying the 14 exons, a primer pair P2 for amplifying the 16 exons and a primer pair P3 for amplifying the 19 exons; PCR amplification procedure: can be optimized according to the used enzyme, the denaturation condition is set according to the type of the used PCR instrument and the type of the reaction tube, and the denaturation is carried out for 5-30 sec at 94-98 ℃. Usually, the temperature is set to 20 to 30sec at 94 ℃ and 5 to 10sec at 98 ℃.

S2, purifying the amplified fragment by using gel;

s3, carrying out Sanger method sequencing by using three pairs of primers, and merging forward and reverse results.

The invention has the following beneficial effects:

the invention provides a kit and a method special for Diego blood group gene sequencing, which are used for optimally selecting key fragments of alleles containing mutation sites, and adding a matched amplification reagent and a purification program to realize sanger method sequencing of target alleles. The kit takes genome DNA extracted from human blood as a detection sample, is used for qualitatively detecting multiple mutations of exons 14, 16 and 19 of SLC4A1 genes, judges whether the sample has mutation or not by comparing the difference between the sequence of the detection sample and a Genebank reference sequence (NG-007498.1), provides basic data for determining the genotype and phenotype of the Diego blood type, and further assists clinical diagnosis. The primer group special for Diego blood group gene sequencing provided by the invention can solve the problems of antigen identification of Diego blood group, judgment of difficult blood group, discovery of new mutation sites, gene polymorphism detection and the like.

Detailed Description

The following description of the preferred embodiments of the present invention is provided for the purpose of illustration and description, and is in no way intended to limit the invention.

Examples

DNA extraction: in general, 2ml of an EDTA anticoagulated blood sample was taken, DNA was automatically extracted by the magnetic bead method, and OD (260/280) was measured to be 1.9.

And (3) PCR amplification:

1. preparing a PCR working solution: adding 500 mul of water and 10 mul of Taq enzyme into a PCR buffer tube, mixing uniformly and centrifuging.

2. Preparing a PCR working solution and a sample DNA mixed solution: PCR reactions were performed by adding 1. mu.l of forward and reverse sequencing primers (10pmoles) to the reaction tube, 40mLPCR buffer and 4 mLDNA.

PCR amplification procedure:

step (ii) of	Temperature and time	Circulation of
			1	96℃ 6min	1cycle
2	96℃ 15sec，68℃ 60sec	30cycles
			3	96℃ 20sec，65℃ 50sec，72℃ 45sec	10cycles
4	72℃ 2min	1cycle
			5	Storing at 4 deg.C

Or PCR amplification program:

step (ii) of	Temperature and time	Circulation of
			1	98℃ 7min	1cycle
2	98℃ 10sec，55℃ 30sec，72℃ 45sec	30cycles
			3	72℃ 2min	1cycle
4	Storing at 4 deg.C

The denaturation conditions are set according to the type of PCR instrument and the type of reaction tube, and are set to 20-30 sec at 94 ℃ and 5-10 sec at 98 ℃.

The tm of the three pairs of specific primer sequences is 60 ℃, the product length of P1 is 147bp, the product length of P2 is 92bp, and the product length of P3 is 109 bp.

And (3) gel electrophoresis purification: and (3) carrying out PCR gel electrophoresis purification on the amplification product, and selecting the amplified target fragment of about 400 bp. The gel purification step greatly improves the purity of the amplification product, and is beneficial to obtaining accurate results by the Sanger method sequencing.

Sequencing on a computer, and sequencing by sections by using three pairs of sequencing primers and an ABI 3500XL sequencer.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Ji Wan Tai biomedical Co., Ltd, Jiangsu

<120> primer group special for Diego blood group gene sequencing, kit and method

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atcttccagg accacccact 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaacttgcgc agcatcatgg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaactctcgg tgcctgatgg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgggaaact cggaacgcaa 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcatgcactt attcacgggc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggcacagtga ggatgaggac 20

Claims

1. The primer group special for Diego blood group gene sequencing is characterized by comprising a primer pair P1 for 14 exon amplification, a primer pair P2 for 16 exon amplification and a primer pair P3 for 19 exon amplification;

wherein the sequence of the primer pair P1 for amplifying the 14 exons is shown as SEQ ID No. 1-2;

the sequence of the primer pair P2 for amplifying the 16 exons is shown as SEQ ID No. 3-4;

the sequence of the primer pair P3 for exon 19 amplification is shown in SEQ ID Nos. 5-6.

2. Use of the primer set of claim 1 for the preparation of a preparation dedicated for sequencing a Diego blood group gene.

3. A kit for sequencing human Diego blood group genes, which comprises the primer pair P1 for exon 14 amplification, the primer pair P2 for exon 16 amplification and the primer pair P3 for exon 19 amplification of claim 1, a PCR amplification premix, a gel and a gel diluent.

4. The kit according to claim 3, wherein the concentration of the primer pair P1 for exon 14 amplification, the primer pair P2 for exon 16 amplification and the primer pair P3 for exon 19 amplification is 10 to 100 pM.

5. A method for sequencing a human Diego blood group gene, which is characterized by comprising the following steps:

s1, respectively amplifying 14 exons, 16 exons and 19 exons of the SLC4A1 gene by using a primer pair P1 for amplifying the 14 exons, a primer pair P2 for amplifying the 16 exons and a primer pair P3 for amplifying the 19 exons;

s2, purifying the amplified fragment by using gel;

6. The method of claim 5, wherein the PCR amplification procedure for amplification of exons 14, 16 and 19 of SLC4A1 gene in S1 is performed at 94-98 deg.C for 5-30 sec.

7. The method of claim 6, wherein the PCR amplification procedure for amplification of exons 14, 16 and 19 of SLC4A1 gene in S1 is as follows:

196 ℃ 6min 1 cycle

296 deg.C 15sec, 68 deg.C 60sec 30 cycle

10 cycles at 396 ℃ 20sec, 65 ℃ 50sec, 72 ℃ 45sec

2min 1 cycle at 472 deg.C

Storing at 54 ℃.

8. The method of claim 6, wherein the PCR amplification procedure for amplification of exons 14, 16 and 19 of SLC4A1 gene in S1 is as follows:

198 deg.C 7min 1 cycle

298 ℃ 10sec, 55 ℃ 30sec, 72 ℃ 40sec 30 cycle

2min 1 cycle at 372 deg.C

Storing at 44 ℃.

9. The method of claim 5, wherein in S2, the amplified product is purified by PCR gel electrophoresis, and the amplified target fragment is selected to be 400bp + -20 bp.