CN110541028A

CN110541028A - Method for detecting FUS gene mutation and TARDBP gene mutation

Info

Publication number: CN110541028A
Application number: CN201910795288.9A
Authority: CN
Inventors: 王丰; 许雪青; 符胜煜; 李发科; 谢小红; 雷佳凡; 郭波; 陈献
Original assignee: SHENZHEN BAOAN WOMEN AND CHILDREN HEALTHCARE HOSPITAL
Current assignee: SHENZHEN BAOAN WOMEN AND CHILDREN HEALTHCARE HOSPITAL
Priority date: 2019-08-27
Filing date: 2019-08-27
Publication date: 2019-12-06

Abstract

the invention discloses a method for detecting FUS gene mutation and TARDBP gene mutation. The invention establishes an analysis method based on PCR-HRM (high-resolution melting curve). The method can rapidly identify all known mutations and novel mutations in the amplification region, and provides an important technical means for discovery, genetic consultation, mechanism research and the like of pathogenic genes of rare diseases such as ALS and the like. The method has the advantages of high detection efficiency, high accuracy and specificity, low cost and simple operation.

Description

method for detecting FUS gene mutation and TARDBP gene mutation

Technical Field

the invention relates to the field of molecular biology and biotechnology, in particular to a method for detecting FUS gene mutation and TARDBP gene mutation.

Background

amyotrophic Lateral Sclerosis (ALS) is a progressive disease characterized by motor neuron degeneration of the cortex, brainstem, and spinal cord anterior. The clinical manifestations of the patient usually include paralysis of the upper motor neurons and paralysis of the lower motor neurons. ALS usually involves neurons in one location (head/neck/chest/waist) followed by gradual expansion to other areas. Typical manifestations include limb onset and bulbar onset, with less onset of respiratory failure. Often the clinical presentation progresses gradually over time with no remission period. Eventually the patient becomes disabled and dies. At present, no radical treatment method is available. Treatment is mainly supportive and palliative.

The aim is to improve the quality of life of the patient.

ALS is reported in the united states to have an incidence (new annual cases) of 2/10-4/10 and a prevalence of 4/10-6/10 ten thousand. There is no definite epidemiological data in China. ALS has two types of sporadic sex, namely familial sex and sporadic sex, and is common to men and women, and the ratio of men to women is about 1.5:1 to 2: 1. The disease starts after middle age, most patients with 50-70 years of age have the average age of onset below 55 years of age and 40 years of age, and the onset of 20-30 years of age accounts for about 5%. Familial ALS accounts for 5% -10% of the cases, and the incidence of the cases is equal among autosomal dominant sexes, and the average age of the cases is 49 years earlier.

the etiology of ALS is unknown, and the following factors may be involved in pathogenesis. Genetic factors play a role, mostly in familial ALS accounting for approximately 5-10%. Environmental factors such as toxic substances, autoimmunity, viral invasion, neurotrophic or growth hormone deficiency, etc. cause motor neuron death. The research on the susceptibility gene of ALS diseases has important value in developing genetic counseling, explaining the pathogenesis of ALS diseases, determining the disease diagnosis and exploring the treatment method.

the ALS diagnostic criteria suggested in chinese guidelines for the diagnosis and treatment of amyotrophic lateral sclerosis are as follows. Basic conditions for ALS diagnosis: (1) progressive disease development: the progressive development of clinical symptoms or signs in a region, or from one region to another, is confirmed by medical history, physical examination, or electrophysiological examination. (2) Clinical, neuroelectrophysiological or pathological examination confirmed evidence of lower motor neuron involvement. (3) Clinical examination confirmed evidence of upper motor neuron involvement. (4) Other diseases were excluded. ALS diagnosis is graded according to clinical presentation or neuroelectrophysiological examination as: clinically confirmed ALS, clinically proposed ALS and clinically probable ALS.

ALS-related gene mutation conditions: mutations in genes such as C9orf72, SOD1, TARDBP and FUS can cause familial ALS and induce sporadic ALS. Mutations in the C9orf72 gene account for 30% to 40% of familial ALS in the us and europe. Worldwide, SOD1 gene mutations result in 15% to 20% of familial ALS. The TARDBP and FUS gene mutations each account for about 5% of cases. Other genes associated with familial ALS account for a very small proportion. It is estimated that 60% of patients with familial ALS have the identified gene mutation. The remaining patients have unknown etiology.

The Protein coded by TARDBP (TAR DNA Binding Protein) gene is called TDP-43(TAR DNA-Binding Protein-43), is a transcription inhibitor, can be combined with DNA or RNA, and plays an important role in the RNA metabolic process. TDP-43 was identified in 2006 as the major disease protein for ALS and Frontotemporal Lobar Degeneration (FTLD).

FUS is the abbreviation of FUS RNA Binding Protein, and the multifunctional Protein coded by the gene is an important component of heterogeneous nuclear ribonucleoprotein (hnRNP) compound. The hnRNP complex is involved in the splicing of mRNA precursors and the transport of processed mRNA into the cytoplasm. FUS proteins belong to the FET family of RNA binding proteins and are involved in cellular processes including regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. FUS can bind single-and double-stranded DNA and promote ATP-independent annealing processes of complementary single-stranded DNA and D-loop formation processes in supercoiled double-stranded DNA. Defects in the FUS gene are associated with ALS.

The pathogenic mutation sites in FUS and TRADBP genes are located at the tail ends of the proteins, and form the mutation hot spot regions of the two genes. The ClinVar database contains 10 pathogenic mutations of the FUS gene: G206S; R216C; R495X; G507D; H517Q; R518K; R521C; R521G; R521H; R524W. Meanwhile, the ClinVar database includes 16 pathogenic mutations of TARDBP gene: D169G; C83T > C; 697G > a; G290A; G294V; G294A; G295S; G298S; A315T; Q331K; M337V; Q343R; G348C; a 382T; G384R; W385G.

Currently, there are four major types of gene mutation detection techniques, one is based on quantitative PCR and fluorescence resonance energy transfer methods, such as Taqman probe method, Molecular beacon (Molecular beacon) and FRET (HybProbe). The second category is based on PCR combined with column analysis or electrophoretic analysis of the product, such as SSCP (single strand conformation polymorphism), DHPLC (denaturing high performance liquid chromatography), etc. The third category of methods is based on sequencing, Pyrosequencing technologies. The fourth type of method is a nucleic acid hybridization chip-based technique. The disadvantages of the above methods are high cost, expensive apparatus, time and labor consuming or complicated operation.

disclosure of Invention

in view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a method for detecting FUS gene mutation and TARDBP gene mutation, which has the advantages of low cost, simple operation, etc. when used for detecting FUS gene mutation and TARDBP gene mutation.

the technical scheme of the invention is as follows:

A method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis, which comprises the following steps:

S1, extracting genome DNA;

s2, carrying out PCR-HRM amplification reaction by using the kit and genome DNA as a template; wherein the kit comprises a primer for detecting FUS gene mutation and a primer for detecting TARDBP gene mutation;

In the primers for detecting FUS gene mutation, an upstream primer is shown as SEQ ID NO.1, and a downstream primer is shown as SEQ ID NO. 2; or the upstream primer is shown as SEQ ID NO.3, and the downstream primer is shown as SEQ ID NO. 4; or the upstream primer is shown as SEQ ID NO.5, and the downstream primer is shown as SEQ ID NO. 6;

In the primers for detecting TARDBP gene mutation, an upstream primer is shown as SEQ ID NO.7, and a downstream primer is shown as SEQ ID NO. 8; or the upstream primer is shown as SEQ ID NO.9, and the downstream primer is shown as SEQ ID NO. 10; or the upstream primer is shown as SEQ ID NO.11, and the downstream primer is shown as SEQ ID NO. 12; or the upstream primer is shown as SEQ ID NO.13, and the downstream primer is shown as SEQ ID NO. 14; or the upstream primer is shown as SEQ ID NO.15, and the downstream primer is shown as SEQ ID NO. 16; or the upstream primer is shown as SEQ ID NO.17, and the downstream primer is shown as SEQ ID NO. 18;

S3, performing sequencing reaction by adopting the PCR amplification product;

And S4, analyzing the sequencing result, and determining whether the FUS gene mutation and the TARDBP gene mutation exist.

The method for detecting the mutation of the FUS gene and the TARDBP gene of the amyotrophic lateral sclerosis comprises the following steps of:

A preheating stage;

And (3) an amplification cycle stage: denaturation, delightering and extension;

And (5) storing.

The method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis comprises the following steps: hot start at 95 ℃ for 5 min.

The method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis is characterized in that the amplification cycle stages are as follows: denaturation at 95 ℃ for 20sec, annealing at 60 ℃ for 20sec and extension at 72 ℃ for 20 sec.

The method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis, wherein the amplification cycle phase is performed for 50 cycles in total.

The method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis, wherein the PCR-HRM amplification reaction further comprises: HRM analysis was performed on the stored PCR amplification products.

The method for detecting mutations of FUS gene and TARDBP gene of amyotrophic lateral sclerosis, wherein the HRM analysis has melting curve conditions as follows: heat denaturation at 95 ℃ for 15sec followed by a flame release of 55 ℃ for 15sec, followed by a temperature ramp up to 95 ℃ at a rate of +0.2 ℃/s.

Has the advantages that: the invention establishes an analysis method based on PCR-HRM (high-resolution melting curve). The method can rapidly identify all known mutations and novel mutations in the amplification region, and provides an important technical means for discovery, genetic consultation, mechanism research and the like of pathogenic genes of rare diseases such as ALS and the like. The method has the advantages of high detection efficiency, high accuracy and specificity, low cost and simple operation.

Drawings

FIGS. 1a and 1b are graphs showing the sequencing results of proband 1 in family 1 carrying FUS mutation site (c.1562G > A.R521H) in example 1 of the present invention.

FIG. 1c is a genetic map of pedigree 1 in example 1 of the present invention.

FIGS. 2a and 2b are graphs showing the sequencing results of proband 2 in the family 2 carrying the FUS mutation site (c.1541+1G > A) detected in example 1 of the present invention.

FIG. 3 is a diagram showing the results of analysis of evolutionary conservation of FUS mutation sites (c.1541+1G > A) in example 1 of the present invention.

FIG. 4 is an electrophoretogram of proband 2 detected in pedigree 2 carrying FUS mutation site (c.1541+1G > A) in example 1 of the present invention.

FIG. 5 is a genetic map for detecting pedigree 2 carrying FUS mutation site (c.1541+1G > A) in example 1 of the present invention.

Fig. 6a and 6b are graphs showing the sequencing results of proband 3 for detecting the TARDBP gene mutation (site c. 731A > G) in example 2 of the present invention.

FIG. 7 is a graph showing the results of analysis of the evolutionary conservation of the TARDBP gene mutation (site c. 731A > G) in example 2 of the present invention.

Detailed Description

The present invention provides a method for detecting FUS gene mutation and TARDBP gene mutation, which is further described in detail below in order to make the objects, technical schemes and effects of the present invention clearer and clearer. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

the invention provides a method for detecting mutations of an FUS gene and a TARDBP gene of amyotrophic lateral sclerosis, which comprises the following steps:

s1, extracting genome DNA;

in the primers for detecting FUS gene mutation, the upstream primer is shown as SEQ ID NO.1, the downstream primer is shown as SEQ ID NO.2, and mutation sites such as H517Q, R518K, R521C, R521G, R521H and R524W in a 160bp amplification fragment range can be detected; or the upstream primer is shown as SEQ ID NO.3, the downstream primer is shown as SEQ ID NO.4, and the mutation sites such as G206S, R216C and the like in the 149bp amplification fragment range can be detected; or the upstream primer is shown as SEQ ID NO.5, the downstream primer is shown as SEQ ID NO.6, and mutation sites such as R495X, G507D and the like in the 160bp amplification fragment range can be detected;

in the primers for detecting TARDBP gene mutation, an upstream primer is shown as SEQ ID NO.7, a downstream primer is shown as SEQ ID NO.8, and mutation sites such as D169G in the range of 82bp amplified fragments can be detected; or the upstream primer is shown as SEQ ID NO.9, the downstream primer is shown as SEQ ID NO.10, and mutation sites such as G290A, G294V, G294A, G295S, G298S and the like in the range of 156bp amplified fragments can be detected; or the upstream primer is shown as SEQ ID NO.11, the downstream primer is shown as SEQ ID NO.12, and mutation sites such as A315T, Q331K, M337V, Q343R, G348C and the like in the 160bp amplification fragment range can be detected; or the upstream primer is shown as SEQ ID NO.13, the downstream primer is shown as SEQ ID NO.14, and mutation sites such as A382T, G384R, W385G and the like in the 157bp amplification fragment range can be detected; or the upstream primer is shown as SEQ ID NO.15, the downstream primer is shown as SEQ ID NO.16, and mutation sites such as c.a.83T > C and the like in the range of 130bp amplified fragments can be detected; or the upstream primer is shown as SEQ ID NO.17, the downstream primer is shown as SEQ ID NO.18, and mutation sites such as c. multidot.697G > A and the like in the range of 152bp amplification fragments can be detected;

The primer designed by the invention can simultaneously detect 10 pathogenic mutations (G206S, R216C, R495X, G507D, H517Q, R518K, R521C, R521G, R521H and R524W) and new mutations of the FUS gene recorded by the ClinVar database.

The primer designed by the invention can simultaneously detect 16 pathogenic mutations (D169G; C. multidot. 83T > C; C. multidot. 697G > A; G290A; G294V; G294A; G295S; G298S; A315T; Q331K; M337V; Q343R; G348C; A382T; G384R; W385G) and new mutations of the TARDBP gene recorded in the ClinVar database.

S3, performing sequencing reaction by adopting the PCR amplification product;

And (3) performing amplification by adopting a PCR-HRM method. HRM (high-resolution scaling, high-resolution melting curve technique) is a low-cost, high-throughput, fast, and site-independent detection method. HRM analysis is a recently developed genetic analysis method for rapid, high-throughput post-PCR analysis of gene mutations. During high resolution melting analysis, melting curves are generated using dyes that fluoresce in the presence of double stranded dna (dsdna) and specialized instrumentation designed to monitor fluorescence during heating. As the temperature increases, fluorescence decreases, resulting in a characteristic melting curve. The change and shape of the melting curve, obtained as a fluorescence difference map, was used to distinguish between mutations and controls.

further, the PCR-HRM amplification reaction comprises the following steps:

a preheating stage;

and (3) an amplification cycle stage: denaturation, delightering and extension;

And (5) storing.

The preheating stage is hot start, i.e. preheating is performed first.

Wherein the amplification cycle stage is that the denaturation, the annealing and the extension cycle are performed for a plurality of times. And finally, storing the obtained PCR amplification product.

further, the preheating stage is as follows: hot start at 95 ℃ for 5 min.

Further, the amplification cycle stages are: denaturation at 95 ℃ for 20sec, annealing at 60 ℃ for 20sec and extension at 72 ℃ for 20 sec.

Further, the amplification cycle phase is performed for 50 cycles in total.

The PCR-HRM amplification reaction further comprises: HRM analysis was performed on the stored PCR amplification products. Namely, whether the PCR amplification product is abnormal or not is analyzed.

Further, melting curve conditions for HRM analysis: heat denaturation at 95 ℃ for 15sec followed by a flame release of 55 ℃ for 15sec, followed by a temperature ramp up to 95 ℃ at a rate of +0.2 ℃/s.

In the step S3, performing a sequencing reaction using the PCR amplification product;

the PCR amplification products judged to be abnormal by HRM analysis were sequenced by direct DNA sequencing (PRISM377, ABI) to check in subsequent steps to determine whether there was a mutation.

The detection method can sensitively screen and quickly detect ALS related mutation sites in the FUS gene and the TARDBP gene.

The primers of the present invention are shown in Table 1.

TABLE 1

The kit comprises a primer for detecting FUS gene mutation and a primer for detecting TARDBP gene mutation, and also comprises the following components: PCR buffer solution, dNTP, Eva Green and taq polymerase.

Further, the PCR buffer solution is 1 × PCR buffer, and specifically may be Tris-Cl buffer solution.

further, the dNTP was 0.2 mM.

Further, the Eva Green is a Biotium fluorescent dye.

Further, the taq polymerase is 1U.

Further, the kit may further comprise: template DNA.

Example 1: mutation detection experiment of mutation hotspot region of ALS pathogenic gene FUS (NM-004960.3)

Establishment of the method

The mutational hot spot region of ALS pathogenic gene FUS (NM-004960.3) was obtained, including all 10 pathogenic mutations of ALS on ClinVar (G206S; R216C; R495X; G507D; H517Q; R518K; R521C; R521G; R521H; R524W) and possible new mutations. And designing PCR-HRM primers to cover the mutation hot spot region, wherein the sequences of the primers and the lengths of the amplified fragments are shown in Table 1(SEQ ID 1-6).

detection of FUS Gene mutation

S1, extracting genome DNA from peripheral blood leucocyte by adopting a general method or a kit;

S2, carrying out PCR-HRM amplification reaction by using the kit and genome DNA as a template;

the amplification reaction System adopts Eco Real-Time PCR System (Illumina), and the reaction System is 10 μ L and comprises: template DNA (20ng), 1 XPCR buffer, dNTP (0.2mM), Eva Green (Biotium), Taq polymerase (1U) and upstream and downstream primers (0.25. mu.M each).

The PCR-HRM amplification reaction conditions were as follows:

Preheating: hot starting at 95 ℃ for 5 min;

And (3) an amplification cycle stage: denaturation at 95 ℃ for 20sec, annealing at 60 ℃ for 20sec and elongation at 72 ℃ for 20sec, and 50 cycles of denaturation, annealing and elongation are carried out;

And (5) storing.

Further comprising the steps of: HRM analysis was performed on the stored PCR amplification products. Namely, whether the PCR amplification product is abnormal or not is analyzed. Melting curve conditions: heat denaturation at 95 ℃ for 15sec followed by a flame release of 55 ℃ for 15sec, followed by a temperature ramp up to 95 ℃ at a rate of +0.2 ℃/s.

S3, performing sequencing reaction by adopting the PCR amplification product;

Wherein, the PCR amplification product with HRM abnormality is checked and judged whether the PCR amplification product has mutation by a direct DNA sequencing method (PRISM377, ABI).

And S4, analyzing the sequencing result and determining whether the gene mutation exists.

The authoritative database on which sequencing results analysis depends is as follows: known mutations were identified with reference to the ALS online genetic database (http:// alsod. iop. kcl. ac. uk /) and the NCBI database (http:// www.ncbi.nlm.nih.gov) and the ExAC database (http:// ExAC. branched. nucleic. org.). To determine whether the mutation is a new mutation, reference was made to the HGMD database (http:// www.hgmd.cf.ac.uk/ac) and the dbSNP database (http:// www.ncbi.nlm.nih.gov/snp). For the analysis of mutations at the 3' UTR site and mutations at the novel alternative cleavage sites, reference was made to the UCSC genome browser (http:// genome. UCSC. edu.), the TargetScan database (http:// www.targetscan.org/vert _71/), and the human alternative cleavage site search database (http:// www.umd.be/HSF3 /).

The invention adopts a targeted sequencing technology to detect all pathogenic mutations of ALS in a mutation hotspot region of an ALS pathogenic gene FUS (NM-004960.3). These mutations include: 10 pathogenic mutations of FUS gene (G206S; R216C; R495X; G507D; H517Q; R518K; R521C; R521G; R521H; R524W) recorded in ClinVar database and new mutation in the amplified region. And comparing the targeted sequencing data to the PCR-HRM detection data.

A series of known and newly discovered mutations were rapidly screened from 146 mutant hot spot regions containing FUS genes in peripheral blood cells of patients with familial ALS and sporadic ALS. Two mutation sites were found on the FUS gene: c.1562G > A p.R521H and c.1541+1G > A. The first mutation (c.1562g > a p.r521h) is a known mutation. The second mutation (c.1541+1G > A) is a novel alternative splicing mutation on the FUS gene that has not been reported. The c.1541+1G > A mutation is the mutation of the first base G nucleotide in the 14 th intron downstream (3' end) of the 1541 th site of the FUS gene coding sequence into A nucleotide, namely, the mutation is from normal ggtaagactt to gataagactt.

For FUS gene mutation (c.1562g > a p.r 521h):

Clinical data are as follows: FUS gene heterozygous mutations were found in one pedigree (c.1562g > a.r 521h). Proband 1(III3), male, age 41, began to develop progressive right upper limb weakness. After 12 months, the sensation of weakness progressed to the other limb. After 13 months, dysarthria and dysphagia, but unconsciousness, occurred. Patients died 3 years after symptoms appeared. Cologe (III1) of proband 1 has the same mutation as proband 1, and the clinical manifestations are similar, and the time from onset to death is also close. Another brother of proband 1(III 2), proband 1 nephew (IV3), and two children of proband (IV6, IV7) also have the same mutations as proband 1, but are now phenotypically normal.

Results 1: as a result of PCR-HRM detection and DNA sequencing, as shown in FIGS. 1a and 1b, the HRM melting curve indicates that the proband has abnormal waveform, and Sanger sequencing finds that c.1562G > A (p.R521H) variation exists in the cases. FIG. 1c is a family diagram of this example.

For FUS gene mutations (c.1541+1G > A):

clinical data are as follows: in case of 2, male, 51 years old, the patient begins to have weakness in the neck and dysphagia. After 5 months, progressive weakness and unconsciousness disorder of the right lower limb appear. This syndrome 2 appeared and died 13 months after the onset of symptoms. The daughter of proband 2 began to develop right lower limb weakness at the age of 20 years, then progressed rapidly to limb weakness, with symptoms dying from respiratory failure after 12 months. The sister of proband 2 has the same genetic variation as proband 1 and similar clinical phenotype, and the survival period after the symptom appears is only 8 months.

Results 2: the results of PCR-HRM detection and DNA sequencing are shown in FIGS. 2a and 2b, in which FIG. 2a is a normalized melting curve and FIG. 2b is a comparative case-control plot.

The PCR-HRM detection shows that the proband 2 melting curve of the example has abnormal waveform, and the direct DNA sequencing shows that proband 2 is c.1541+1G > A heterozygous mutation.

Results 3: the results of the evolutionary conservation analysis of the selective cleavage sites are shown in FIG. 3.

The selective cleavage site c.1541+1G is evolutionarily conserved across a variety of species.

results 4: results of the selective cleavage site minigene assay.

Analysis of the selective splicing site minigene test shows that the DNA of the proband 1 genome causes selective splicing deletion of No.14 exon in an in vitro transcription experiment due to the existence of mutation. As shown in FIG. 4, the electropherograms suggest that the pro-and pro-transcriptional products are shorter than normal. Therefore, it is suggested that the c.1541+1G > a mutation may cause selective splicing of the FUS gene, such that exon 14 is deleted, thereby affecting the function of FUS protein.

In this case, proband 2 daughter, proband 2 sister all exhibited similar symptoms and shared the same FUS mutation site (c.1541+1G > a), suggesting that this site is most likely the causative site of ALS, as shown in fig. 5.

Example 2: mutation detection experiment of mutational hot spot region of ALS pathogenic gene TARDBP (NM-007375.3)

Establishment of the method

Mutation hotspot regions of the ALS causative gene TARDBP (NM _007375.3) were obtained, including all 16 causative mutations of ALS on ClinVar (D169G; C. times.83T > C. times.697G > a; G290A; G294V; G294A; G295S; G298S; a 315T; Q331K; M337V; Q343R; G348C; a 382T; G384R; W385G) and possible new mutations. PCR-HRM primers were designed to cover the mutation hot spot region, and the primer sequences and the amplified fragment lengths are shown in Table 1(SEQ ID 7-18).

Detection of mutation in TARDBP Gene

The PCR-HRM amplification reaction conditions were as follows:

Preheating: hot starting at 95 ℃ for 5 min;

And (5) storing.

S3, performing sequencing reaction by adopting the PCR amplification product;

the invention adopts a targeted sequencing technology to detect all ALS related mutations of a mutation hot spot region of an ALS pathogenic gene TARDBP (NM-007375.3) on ClinVar. These mutations include: 16 pathogenic mutations of TARDBP gene included in ClinVar database (D169G; c.83T > C; c.697G > A; G290A; G294V; G294A; G295S; G298S; A315T; Q331K; M337V; Q343R; G348C; A382T; G384R; W385G) and new mutations in the amplified region. And comparing the targeted sequencing data to the PCR-HRM detection data.

A series of known and newly discovered mutations were rapidly screened from the mutational hot spot region of 146 patients with familial ALS and sporadic ALS, including the TARDBP gene in peripheral blood cells. Three known mutations (c.881g > T p.g294v, c.1043g > T p.g348v, c.1147a > G p.i383v) and one new 3' UTR mutation (c.731A > G) were found in the TARDBP gene. c. 731A > G mutation means that the A nucleotide at position 731 of TARDBP gene is changed into G nucleotide, specifically, atcaacgctatgaacgcaaggct is changed into atcaacgctgtgaacgcaaggct.

For TARDBP gene mutations:

Clinical data are as follows: in one example, 1 new mutation in the TARDBP gene was detected as a 3' UTR mutation in peripheral blood leukocytes from patients with significant amyotrophic lateral sclerosis manifestations (c.731A > G).

results 1: as a result of PCR-HRM detection and DNA sequencing, FIGS. 6a and 6b show the normalized melting curve in FIG. 6a and the case-control comparison in FIG. 6 b.

The PCR-HRM detection shows that the proband 2 melting curve of the example has abnormal waveform, and the direct DNA sequencing shows that the proband is proved to be TARDBP gene 3' UTR mutation (c.731A > G) homozygous mutation.

Results 2: the results of the evolutionary conservation analysis of the alternative cleavage sites are shown in FIG. 7.

The 3' UTR (c.731A) of the TARDBP gene is evolutionarily conserved in various species.

The clinical data of patients whose TARDBP gene has been detected at other mutation sites are as follows:

The c.881g > t.g294v mutation of the TARDBP gene is located in exon 6 of the gene and is present in two unrelated male sporadic ALS patients. One of the patients started to develop dysarthria at age 61 and had weakness in the right upper limb. Five months after symptoms appeared, the left upper limb was weakened and occasionally dysphagia occurred. Death occurred six months after symptoms appeared. Another patient also presented with dysarthria primarily at age 53. Neither of the two sporadic ALS patients carrying the G294V mutation had cognitive dysfunction.

The c.1043g > T p.g348v mutation of the TARDBP gene was present in a juvenile onset male ALS patient with no family history of ALS. The patient started mild fasciculation in the right upper limb by age 24. Three years later, fasciculation progresses to the left upper limb and gradually. Both fasciculations and muscular atrophy were observed in the patient's extremities. MRI results showed a decrease in FA ratio of the left-middle corticospinal tract, indicating white matter degeneration.

the c.1147a > G p.i383v mutation of the TARDBP gene was found in a female patient 45 years old. The patient is mainly characterized by progressive weakness of the upper limb, and the electromyography result shows that the anterior part of the spinal cord of the lower cervical vertebra is damaged. Death resulted from respiratory failure three years after onset.

The invention establishes an analysis method based on PCR-HRM (high-resolution melting curve). The method can rapidly identify all known mutations and novel mutations in the amplification region, and provides an important technical means for discovery, genetic consultation, mechanism research and the like of pathogenic genes of rare diseases such as ALS and the like.

It is to be understood that the invention is not limited to the examples described above, but that modifications and variations may be effected thereto by those of ordinary skill in the art in light of the foregoing description, and that all such modifications and variations are intended to be within the scope of the invention as defined by the appended claims.

sequence listing

<110> Shenzhen, Shen Shenan, Bao' an district, women and baby health care hospital

<120> a method for detecting FUS gene mutation and TARDBP gene mutation

<130> do not

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggtaaca ctgggtacag gac 23

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggcttggaga ggctggtaac 20

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggttatggca atcaagacca ga 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctgggttcat agccaccact 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gctatgatcg aggcggcta 19

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tggcctctgt tcaactgctc 20

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggaatatga aacacaagtg aaag 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaattaggaa gtttgcagtc acac 24

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccgaacctaa gcacaatagc a 21

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcatcccacc acccatatta ct 22

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aatatgggtg gtgggatgaa c 21

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgttgccttg gttttggtta tt 22

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aataaccaaa accaaggcaa cat 23

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttgagccaaa gcctccatta 20

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggttgtggt tggttggtat ag 22

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ctgctgaata tactccacac tgaac 25

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gccataggaa tactgtctac atgct 25

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccatatcaca gccttgcgtt 20

Claims

1. A method for detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis, which comprises the following steps:

S1, extracting genome DNA;

S3, performing sequencing reaction by adopting the PCR amplification product;

2. the method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 1, wherein the PCR-HRM amplification reaction comprises the steps of:

A preheating stage;

and (3) an amplification cycle stage: denaturation, fire reduction and extension

And (5) storing.

3. The method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 2, wherein the warm-up phase is: hot start at 95 ℃ for 5 min.

4. The method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 2, wherein the amplification cycle is: denaturation at 95 ℃ for 20sec, annealing at 60 ℃ for 20sec and extension at 72 ℃ for 20 sec.

5. The method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 4, wherein the amplification cycle phase is performed for a total of 50 cycles.

6. the method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 2, wherein the PCR-HRM amplification reaction further comprises: HRM analysis was performed on the stored PCR amplification products.

7. The method of detecting mutations in the FUS gene and the TARDBP gene of amyotrophic lateral sclerosis according to claim 6, wherein the HRM analysis has a melting curve condition that is: heat denaturation at 95 ℃ for 15sec followed by a flame release of 55 ℃ for 15sec, followed by a temperature ramp up to 95 ℃ at a rate of +0.2 ℃/s.