CN107312859B

CN107312859B - Application of AQP5 gene in preparation of products for detecting congenital cataract

Info

Publication number: CN107312859B
Application number: CN201710616300.6A
Authority: CN
Inventors: 陈鹏; 陈豪; 郝晓丹
Original assignee: Qingdao University
Current assignee: Qingdao University
Priority date: 2017-07-26
Filing date: 2017-07-26
Publication date: 2020-07-03
Anticipated expiration: 2037-07-26
Also published as: CN107312859A

Abstract

The invention aims to provide application of an AQP5 gene in preparation of a product for detecting congenital cataract diagnosis, and provides new application of the AQP5 gene, so that an effective way for carrying out congenital cataract disease gene diagnosis, prenatal gene screening and genetic counseling is provided, and application effects show that the SNP site and detection primer of the gene provided by the invention can be effectively used for rapid detection of the AQP5 gene mutation site of clinical patients and fetal villi or amniotic fluid.

Description

Application of AQP5 gene in preparation of products for detecting congenital cataract

Technical Field

The invention belongs to the technical field of gene diagnosis products, and particularly relates to application of aquaporin 5(AQP5) in preparation of a gene diagnosis product for detecting congenital cataract.

Background

Congenital cataract (congenital cataract) is a common eye disease causing low vision and blindness of children, the incidence rate is about 0.01% -0.06%, the cataract can cause blindness or amblyopia of infants, 22% -30% of blindness children are caused by the cataract, and the congenital cataract is a group of serious blindness-causing diseases which seriously affect the vision development of the children and becomes the second cause of the blindness of the children. Congenital cataract can occur independently, and can also be used as a concomitant symptom of eye or general syndrome, both eyes are often involved, and anterior segment dysplasia, such as iris defect, Peters abnormity, ectopia pupillae and nystagmus, is often accompanied, and the multiple deformities cause most patients to lose vision, which is one of important reasons for congenital blindness. The disease is lack of effective treatment means at present, so that the life quality of patients is seriously influenced, and the social and the family are subjected to heavy economic and mental burden.

So far, more than 200 genes and sites are found to be related to the congenital cataract, and the identification of the genes/sites of the congenital cataract has important significance for revealing the pathogenesis of the congenital cataract and researching the prevention and treatment measures thereof. The protein coded by the gene related to the congenital cataract relates to lens protein, transcription factor, connexin, transmembrane transporter and the like. The results of genetic studies at home and abroad show that the disease is caused by genetic factors to a large extent. The congenital cataract has remarkable genetic heterogeneity, and a plurality of candidate pathogenic genes exist, which becomes the bottleneck of the research on the pathogenesis of the congenital cataract and the diagnosis and treatment research on the etiology. The current situation promotes to further discover and understand new pathogenic genes of the disease, and provides a basis for subsequent gene diagnosis, prenatal diagnosis and gene therapy.

The congenital cataract is early, the disease condition gradually progresses, the frequent occurrence of both eyes has serious influence on vision, and the early treatment is very important, but the delayed discovery and treatment phenomenon of the infant congenital cataract is very serious in China, the postoperative complications are many and are easy to relapse, the operation cost is high, and the heavy economic and mental burden is brought to families and society of patients. The gene mutation detection system related to the congenital cataract is established, is applied to clinical work and prenatal and postnatal care, is beneficial to genetic diagnosis and corresponding gene therapy of the hereditary congenital cataract, is beneficial to detection of mutant gene carriers, is beneficial to reducing the incidence of diseases through prenatal examination, and is beneficial to effectively controlling the occurrence of the diseases.

Disclosure of Invention

The invention aims to provide application of AQP5 gene in preparing a diagnostic product for detecting congenital cataract, thereby making up the defects of the prior art.

The inventor conducts the sequencing of AQP5 gene on all members of a 5-generation autosomal dominant inherited congenital cataract family, finds out that the pathogenic gene AQP5 of the family has genetic pathogenic mutation, and further contributes to the invention.

The invention firstly provides a new application of AQP5 gene, which is an application in preparing a diagnostic product for detecting congenital cataract;

the above diagnostic product is preferably a primer or a probe for detecting congenital cataract.

The primer information of the primer pair is as follows:

AQP5-1F:CTATATAGCGCGCCCCAG SEQ ID NO:1、

AQP5-1R:GCAGGAAGGGAGCACATATC SEQ ID NO:2、

AQP5-2F:AAAAGCCCTACTCCCCGAG SEQ ID NO:3、

AQP5-2R:TATTTGCCTTGAGTGCCTGC SEQ ID NO:4、

AQP5-3F:ATTCTGTGGGAGTGGACCAG SEQ ID NO:5、

AQP5-3R:CCAGGTCTGGTGAGCTCTG SEQ ID NO:6、

AQP5-4F:GGCATGTGGTCTTCAAGGTC SEQ ID NO:7、

AQP5-4R:CCAAGAGGACCGGTTGTG SEQ ID NO:8；

the invention also provides a kit for detecting the congenital cataract, which comprises two or more of the primer pairs.

The invention also provides a SNP locus related to the congenital cataract disease, which is the 152 th base from the initiation codon of the AQP5 gene.

Wherein the primer information for detecting the SNP sites is as follows:

AQP5-1F:CTATATAGCGCGCCCCAG SEQ ID NO:1

AQP5-1R:GCAGGAAGGGAGCACATATC SEQ ID NO:2。

the invention provides a new application of AQP5 gene, thereby providing an effective way for carrying out congenital cataract disease gene diagnosis, prenatal gene screening and genetic counseling, and the application effect shows that the SNP locus and the detection primer of the gene provided by the invention can be effectively used for rapid detection of AQP5 gene mutation locus in clinical patients and fetal villi or amniotic fluid.

Drawings

FIG. 1: AQP5 profile of patients in the family of congenital cataracts of example 1, a: a reference sequence; b: a proband sequence. The 152 th base T from the initiation codon of AQP5 gene of 9 patients in the family is mutated into C.

Detailed Description

The applicant found the mutation site of AQP5 gene in an congenital cataract family and confirmed that the mutation of the gene is the causative gene of the disease, thereby leading to the present invention.

The AQP5 gene is located on chromosome 12q13.12 and can be transcribed into mRNA of about 1840bp (NCBI accession NM-001651), which is directly translated into a 265 amino acid protein.

The present invention will be described in detail with reference to examples.

Example 1: screening mutation site of AQP5 gene from congenital cataract family

1. Extracting peripheral blood genome DNA:

on the basis of meeting the national relevant policy regulations and agreeing with the sampling object, extracting 2-5ml of peripheral venous blood of family members, and putting the peripheral venous blood into an EDTA anticoagulant tube to be frozen at-80 ℃ for later use; after the frozen EDTA anticoagulation blood is melted at room temperature, 500 mu L of the EDTA anticoagulation blood is put into a centrifuge tube, equal volume of TE (pH8.0) is added into the centrifuge tube, the mixture is mixed evenly, the mixture is centrifuged for 10 minutes at 10000rpm at 4 ℃, and the supernatant is discarded.

Add 180. mu.L TE, 20. mu.L LSDS (10%), 8. mu.L proteinase K (L0mg/ml), mix well and place in a 37 ℃ water bath overnight. The sample was removed from the water bath and the sample was pelleted by instantaneous centrifugation. An equal volume of Tris-saturated phenol (about 300. mu.L) was added to the reaction tube, mixed well, centrifuged at 10000rpm for 10 minutes at room temperature, and the supernatant (about 300. mu.L) was pipetted into a new centrifuge tube. Phenol extraction was repeated once and the supernatant was aspirated into a new centrifuge tube.

Adding equal volume of Tris saturated phenol and chloroform mixed solution (150 μ L of phenol and chloroform respectively), mixing, centrifuging at room temperature of 10000rpm for 10 minutes, and transferring the supernatant to a new centrifuge tube.

Adding equal volume of Tris saturated phenol, chloroform and isoamyl alcohol mixed solution (100 μ L of each of phenol, chloroform and isoamyl alcohol), mixing, centrifuging at room temperature of 10000rpm for 10 minutes, and transferring the supernatant to a new centrifuge tube.

Add L/10 volume of 3mol/L, pH5.2 sodium acetate (about 30. mu.L), 2 volumes of pre-cooled 100% ethanol, mix gently to see white flocculent precipitate. The DNA was precipitated at the bottom of the tube by centrifugation at 10000rpm for 10 minutes at room temperature, and the supernatant was discarded.

To the DNA precipitation adding 70% ethanol, rinsing, room temperature 7000rpm centrifugation for 5 minutes, abandoning the supernatant, placed in room temperature to volatilize the ethanol, finally adding 50 u L TE (pH8.0), 4 degrees overnight dissolved DNA.

And (3) performing agarose gel electrophoresis on the extracted DNA, and performing color comparison at 260nm and 280nm by using an ultraviolet spectrophotometer to detect the purity and the concentration of the DNA.

2. Direct sequencing method for searching AQP5 gene mutation of patient in family

PCR amplification of the fragment of interest: reaction conditions and reaction system:

(1) and (3) PCR reaction conditions: 3min at 94 ℃; 94 ℃ 40sec, 52 ℃ 40se, 72 ℃ 60sec, 30-35 cycles; 10min at 72 ℃.

(2) Reaction system: (TAKARA LA Taq polymerase)

The reaction system is used for carrying out the amplification reaction of the genomic DNA template of each family member and the AQP5 primer.

Sequencing a PCR product: the PCR products were sequenced by conventional Sanger sequencing using the primer pair AQP5-1F: CTATATAGCGCGCCCCAG, AQP5-1R: GCAGGAAGGGAGCACATATC, in which the base T at position 152 from the start codon of the AQP5 gene of nine patients in the family was mutated to C (FIG. 1). Multiple sequencing results indicated that the mutation site was not introduced due to amplification or sequencing errors. The mutation is a nascent mutation. This mutation is not present in the following four databases: single nucleotide polymorphism databases (ftp:// ftp. ncbi. nih. gov/snp/database /), thousand human genome project (ftp:// ftp-trace. ncbi. nih. gov/1000 genes/ftp /), Hapmap8 database (http:// Hapmap. ncbi. nlm. nih. gov /), and Yanhuang database (http:// yh. genomics. org. cn /), indicate that the mutation is very rare, and that the mutation results in the mutation of the amino acid 51 of the AQP5 protein from leucine to proline. The point mutation prediction program SIFT (cloning and intulerant From Tolerant) is used for predicting that the mutation causes the damage of AQP5 protein function of "damaging" level; the point mutation prediction program PolyPhon (the Polymorphism Phonetice) is used for predicting and finding that the mutation causes the damage of the function 'POSSIBLY DAMAGING' grade of AQP5 protein; thereby causing the occurrence of congenital cataract in the family. The site was screened for mutations in 200 samples of genomic DNA from peripheral blood of normal local population, and no mutations were found.

Through the above analysis, it was demonstrated that the AQP5 gene can be used to detect whether a patient is at risk for an congenital cataract. Determining the risk of the disease of the subject by comparing each exon fragment of AQP5 gene of the subject with the normal corresponding fragment.

Designing a primer pair for amplifying each exon according to the genome sequence of AQP5, wherein the sequence information of the positive primer and the negative primer is as follows:

AQP5-1F:CTATATAGCGCGCCCCAG

AQP5-1R:GCAGGAAGGGAGCACATATC

AQP5-2F:AAAAGCCCTACTCCCCGAG

AQP5-2R:TATTTGCCTTGAGTGCCTGC

AQP5-3F:ATTCTGTGGGAGTGGACCAG

AQP5-3R:CCAGGTCTGGTGAGCTCTG

AQP5-4F:GGCATGTGGTCTTCAAGGTC

AQP5-4R:CCAAGAGGACCGGTTGTG

the detection of AQP5 gene was performed by using each pair of primers described above.

In addition, one of the diagnosed congenital cataract sporadic patients is collected in Shandong, the peripheral blood genome DNA of the congenital cataract sporadic patients is extracted, the DNA template of the patients, AQP5-1F and AQP5-1R primers are used for carrying out PCR amplification, the PCR products are sequenced by using a conventional Sanger sequencing method, and the AQP5 gene of the patients has SNP mutation found in the invention, namely, the base T mutation at the 152 th position from the initiation codon of the AQP5 gene is C. Through the above analysis, it was demonstrated that the AQP5 gene can be used to detect whether a patient is at risk for an congenital cataract. Determining the risk of the disease of the subject by comparing the amplified fragment of AQP5 gene of the subject with the corresponding normal fragment.

SEQUENCE LISTING

<110> Qingdao university

Application of <120> AQP5 gene in preparation of products for detecting congenital cataract

<130>

<160>8

<170>PatentIn version 3.5

<210>1

<211>18

<212>DNA

<213>1

<400>1

ctatatagcg cgccccag 18

<210>2

<211>20

<212>DNA

<213>2

<400>2

gcaggaaggg agcacatatc 20

<210>3

<211>19

<212>DNA

<213>3

<400>3

aaaagcccta ctccccgag 19

<210>4

<211>20

<212>DNA

<213>4

<400>4

tatttgcctt gagtgcctgc 20

<210>5

<211>20

<212>DNA

<213>5

<400>5

attctgtggg agtggaccag 20

<210>6

<211>19

<212>DNA

<213>6

<400>6

ccaggtctgg tgagctctg 19

<210>7

<211>20

<212>DNA

<213>7

<400>7

ggcatgtggt cttcaaggtc 20

<210>8

<211>18

<212>DNA

<213>8

<400>8

ccaagaggac cggttgtg 18

Claims

1. The application of the reagent for detecting the SNP locus of the AQP5 gene in preparing a diagnostic product for detecting the congenital cataract is characterized in that the SNP locus is characterized in that the 152 th base of the AQP5 gene with NCBI accession number of NM-001651 is mutated from T to C, and the mutation causes the mutation of the 51 st amino acid of the AQP5 protein from leucine to proline.

2. The use of claim 1, wherein the reagent is a primer, and the sequence information of the primer is as follows:

AQP5-1F: CTATATAGCGCGCCCCAG SEQ ID NO:1、

AQP5-1R: GCAGGAAGGGAGCACATATC SEQ ID NO:2 。