CN108034709B - Application of GUCA1A gene in preparation of products for detecting cone cell malnutrition - Google Patents

Abstract

The invention aims to provide application of a GUCA1A gene in preparation of a diagnostic product for detecting cone cell dystrophy, and provides new application of the GUCA1A gene, so that an effective way for cone cell dystrophy disease gene diagnosis, prenatal gene screening and genetic counseling is provided, and application effects show that the SNP sites and detection primers of the gene provided by the invention can be effectively used for rapid detection of GUCA1A gene mutation sites of clinical patients and fetal villi or amniotic fluid.

Description

Application of GUCA1A gene in preparation of products for detecting cone cell malnutrition

Technical Field

The invention belongs to the technical field of gene diagnosis products, and particularly relates to application of a guanylate cyclase activator 1A gene (GUCA1A) in preparation of a gene diagnosis product for detecting cone cell dystrophy.

Background

Cone dystrophy is a class of inherited retinal diseases with clinical phenotypic and genetic heterogeneity that primarily damages cones, with varying degrees of rod damage. Cone damage occurs earlier, so the main symptoms are visual deterioration, acquired color vision abnormality, and night blindness when rod cells are damaged. It is also called central retinitis pigmentosa. The disease is mainly characterized by autosomal dominant inheritance, progressive development of the disease, remarkable heterogeneity of clinical phenotype, photophobia and cone dystrophy of patients in the same family.

At present, there is no exact and effective method for cone cell malnutrition, a cone cell dystrophy related gene mutation detection system is established, and the system is applied to clinical work and sound birth and sound care, is favorable for genetic cone cell dystrophy gene diagnosis and corresponding gene therapy, is favorable for detection of mutant gene carriers, is favorable for reducing the incidence of diseases through prenatal examination, and is effective in controlling the occurrence of the diseases.

Disclosure of Invention

The invention aims to provide application of a GUCA1A gene in preparing a diagnosis product for detecting cone cell malnutrition, thereby making up the defects of the prior art.

The applicant has sequenced GUCA1A gene from 4 generations of cone dystrophy family which is inherited in autosomal dominant manner, and found out that the pathogenic gene GUCA1A of the family has genetic pathogenic mutation, thereby facilitating the invention.

The invention firstly provides a new application of GUCA1A gene, which is an application in preparing diagnostic products for detecting cone cell malnutrition;

the detection is used for detecting an SNP locus related to cone dystrophy disease on a GUCA1A gene, the SNP locus is positioned in a fifth exon of a GUCA1A gene, the nucleotide change of the SNP locus is c.431A > G, and the amino acid change is p.D144G;

the above diagnostic product is preferably a primer or probe for detecting cone dystrophy, as an example.

The detection is to amplify a sample to be detected through a primer pair, and sequence to determine whether the SNP locus exists or not;

the primer information of the primer pair used is as follows:

the invention also provides a kit for detecting cone cell malnutrition, which comprises one or more than one primer pair.

Wherein the primer information for detecting the SNP sites is as follows:

GUCA1A-4-5F GCCTGAGGCTGGAGTGAG

GUCA1A-4-5R CCCAAGAGCAGTGAGGAGTAG

the invention provides a new application of GUCA1A gene, thereby providing an effective way for carrying out gene diagnosis of cone cell malnutrition disease, prenatal gene screening and genetic counseling, and the application effect shows that the SNP locus and the detection primer of the gene provided by the invention can be effectively used for rapid detection of GUCA1A gene mutation locus in clinical patients and fetal villi or amniotic fluid.

Drawings

FIG. 1: the in-cone dystrophy family patient GUCA1A sequencing diagram of example 1, where the first column: a reference sequence; the second column: proband sequence, wherein heterozygous mutation is found on GUCA1A gene of 5 patients in the family, the mutation is located in the fifth exon, nucleotide change c.431A > G, and amino acid change p.D144G is a new mutation site, which is not reported; third column: the father sequence of the proband has no mutation; fourth column: the parent sequence of the proband, the mutation condition, is identical to that of the proband.

Detailed Description

The applicant found a mutation site of GUCA1A gene in a cone dystrophy family and confirmed that the mutation of the gene is a causative gene of the disease, thus leading to the present invention.

The GUCA1A gene is transcribed into mRNA of about 1977bp (NCBI accession NM-000409.4) on chromosome 6p21.1, and is directly translated into a protein consisting of 201 amino acids.

The present invention will be described in detail with reference to examples.

Example 1: screening mutation sites of GUCA1A gene from cone cell malnutrition family

1. Extracting peripheral blood genome DNA:

on the basis of meeting the national relevant policy regulations and agreeing with the sampling object, extracting 2-5ml of peripheral venous blood of family members, and putting the peripheral venous blood into an EDTA anticoagulant tube to be frozen at-80 ℃ for later use; after the frozen EDTA anticoagulation blood is melted at room temperature, 500 mu L of the EDTA anticoagulation blood is put into a centrifuge tube, equal volume of TE (pH8.0) is added into the centrifuge tube, the mixture is mixed evenly, the mixture is centrifuged for 10 minutes at 10000rpm at 4 ℃, and the supernatant is discarded.

Add 180. mu.L TE, 20. mu.L LSDS (10%), 8. mu.L proteinase K (L0mg/ml), mix well and place in a 37 ℃ water bath overnight. The sample was removed from the water bath and the sample was pelleted by instantaneous centrifugation. An equal volume of Tris-saturated phenol (about 300. mu.L) was added to the reaction tube, mixed well, centrifuged at 10000rpm for 10 minutes at room temperature, and the supernatant (about 300. mu.L) was pipetted into a new centrifuge tube. Phenol extraction was repeated once and the supernatant was aspirated into a new centrifuge tube.

Adding equal volume of Tris saturated phenol and chloroform mixed solution (150 μ L of phenol and chloroform respectively), mixing, centrifuging at room temperature of 10000rpm for 10 minutes, and transferring the supernatant to a new centrifuge tube.

Adding equal volume of Tris saturated phenol, chloroform and isoamyl alcohol mixed solution (100 μ L of each of phenol, chloroform and isoamyl alcohol), mixing, centrifuging at room temperature of 10000rpm for 10 minutes, and transferring the supernatant to a new centrifuge tube.

Add L/10 volume of 3mol/L, pH5.2 sodium acetate (about 30. mu.L), 2 volumes of pre-cooled 100% ethanol, mix gently to see white flocculent precipitate. The DNA was precipitated at the bottom of the tube by centrifugation at 10000rpm for 10 minutes at room temperature, and the supernatant was discarded.

To the DNA precipitation adding 70% ethanol, rinsing, room temperature 7000rpm centrifugation for 5 minutes, abandoning the supernatant, placed in room temperature to volatilize the ethanol, finally adding 50 u L TE (pH8.0), 4 degrees overnight dissolved DNA.

And (3) performing agarose gel electrophoresis on the extracted DNA, and performing color comparison at 260nm and 280nm by using an ultraviolet spectrophotometer to detect the purity and the concentration of the DNA.

2. Direct sequencing method for searching GUCA1A gene mutation of patients in the family

PCR amplification of the fragment of interest: reaction conditions and reaction system:

(1) and (3) PCR reaction conditions: 3min at 94 ℃; 94 ℃ 40sec, 53 ℃ 40se, 72 ℃ 60sec, 30-35 cycles; 10min at 72 ℃.

(2) Reaction system: (TAKARA LA Taq polymerase)

The reaction system is used for carrying out the amplification reaction of the genomic DNA template of each family member and the GUCA1A primer.

Sequencing a PCR product: the PCR products were sequenced using conventional Sanger sequencing methods, in which primer pairs were used

GUCA1A-4-5F GCCTGAGGCTGGAGTGAG

GUCA1A-4-5R CCCAAGAGCAGTGAGGAGTAG, in which the fifth exon of GUCA1A gene of 5 patients was mutated, nucleotide change c.431A > G, amino acid change p.D144G. (FIG. 1). Multiple sequencing results indicated that the mutation site was not introduced due to amplification or sequencing errors. The mutation is a nascent mutation. This mutation is not present in the following four databases: single nucleotide polymorphism databases (ftp:// ftp. ncbi. nih. gov/snp/database /), thousand human genome project (ftp:// ftp-trace. ncbi. nih. gov/1000 genes/ftp /), Hapmap8 database (http:// Hapmap. ncbi. nlm. nih. gov /), and Yanhuang database (http:// yh. genomics. org. cn /), indicate that the mutation is very rare, and that the mutation is predicted to result in mutation of the 144 th amino acid of GUCA1A from aspartic acid to glycine, thereby causing cone dystrophy in patients. The site was screened for mutations in 200 samples of genomic DNA from peripheral blood of normal local population, and no mutations were found.

Through the above analysis, it was demonstrated that the GUCA1A gene can be used to detect whether a patient is at potential risk for cone dystrophy. The risk of the disease of the subject to be tested is determined by comparing each exon fragment of the GUCA1A gene of the subject with the normal corresponding fragment.

Designing a primer pair for amplifying each exon according to the genome sequence of GUCA1A, wherein the sequence information of the positive primer and the negative primer is as follows:

the detection of the GUCA1A gene was performed by using each pair of primers described above.

In addition, one of the clearly diagnosed cone cell malnutrition patients is collected in Shandong, the peripheral blood genome DNA of the cone cell malnutrition patient is extracted, the DNA template of the cone cell malnutrition patient is used for carrying out PCR amplification with GUCA1A-4-5F and GUCA1A-4-5R primers, the PCR product is sequenced by using a conventional Sanger sequencing method, and the GUCA1A gene of the cone cell dystrophy patient has SNP mutation discovered in the invention, namely in the fifth exon, nucleotide change c.431A > G and amino acid change p.D144G. Through the above analysis, it was demonstrated that the GUCA1A gene can be used to detect whether a patient is at potential risk for cone dystrophy. And (3) determining the disease risk of the person to be detected by comparing the amplified fragment of the GUCA1A gene of the person to be detected with a normal corresponding fragment.

Sequence listing

<110> Qingdao university

Application of <120> GUCA1A gene in preparation of products for detecting cone cell malnutrition

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cagggcctgt ccatctcag 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agctggtcag gcttccagag 20

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcctgaggct ggagtgag 18

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccaagagca gtgaggagta g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctacccctg agataggata agg 23

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttagtgacct tccacccctg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgctctggac tgcagaaatg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aacaggcacc accataccac 20

Claims (4)

1. The application of the reagent for detecting the SNP locus of the GUCA1A gene in preparing a diagnostic product for detecting the cone cell malnutrition; the SNP site is located in the fifth exon of GUCA1A gene with NCBI accession number NM-000409.4, the nucleotide change is c.431A > G, and the amino acid change is p.D144G.

2. The use of claim 1, wherein said detection is carried out by amplifying the sample to be detected with a primer pair, and sequencing the amplified product to determine the presence of said SNP site.

3. The use of claim 2, wherein the sequence information of said primer pair is as follows:

GUCA1A-6F：CCTACCCCTGAGATAGGATAAGG、

GUCA1A-6R：TTAGTGACCTTCCACCCCTG。

4. a test preparation for detecting cone dystrophy, said preparation being used for detecting a SNP site on GUCA1A gene associated with cone dystrophy disease, said SNP site being located in the fifth exon of GUCA1A gene having NCBI accession No. NM-000409.4, whose nucleotide is changed to c.431A > G, whose amino acid is changed to p.D144G,

the detection of the SNP sites on the GUCA1A gene related to the cone cell malnutrition disease is completed by primer amplification and sequencing; wherein the primer sequence information is as follows:

GUCA1A-6F：CCTACCCCTGAGATAGGATAAGG、

GUCA1A-6R：TTAGTGACCTTCCACCCCTG。

Images