CN107312859A - Application of the AQP5 genes in detection congenital cataract product is prepared - Google Patents

Abstract

It is an object of the invention to provide a kind of application of AQP5 genes in detection congenital cataract diagnostic product is prepared, the invention provides the new purposes of AQP5 genes, so as to which there is provided a kind of effective approach for carrying out the diagnosis of congenital cataract disease gene, prenatal gene examination and genetic counselling, application effect shows that the SNP site and detection primer of gene provided by the present invention can be effectively used for clinical patients and fetus fine hair or amniotic fluid carries out the quick detection of AQP5 gene mutation sites.

Description

Application of the AQP5 genes in detection congenital cataract product is prepared

Technical field

The invention belongs to gene diagnosis product technique field, and in particular to a kind of aquaporin 5 (AQP5) is preparing inspection The application surveyed in congenital cataract gene diagnosis product.

Background of invention

Congenital cataract (congenital cataract) is to cause low vision children and blind common illness in eye, morbidity Rate is about 0.01%-0.06%, and cataract can cause infant to blind or amblyopia, and it is in white to have 22%~30% in blindness children Caused by barrier, it is one group of serious blinding disease, has a strong impact on the visual acuity of children, it has also become the second of children's blindness is former Cause.Congenital cataract can independently occur, and also can often involve eyes, normal companion as eye or the concomitant symptom of whole body syndrome Anterior ocular segment depauperation, such as iridocoloboma, Peters exception, corectopia and nystagmus are sent out, these Poly-monstrosities often make Most patients loss of sight, is one of major reason of congenital blinding.The disease still lacks effective treatment means at present, because This drastically influence the quality of life of patient, and heavy economy and mental burden is brought to society and family.

So far, it has been found that more than 200 gene and site are related to congenital cataract, congenital cataract base The identification in cause/site is to disclosing the pathogenesis of congenital cataract disease and to study its prophylactico-therapeutic measures significant.With The albumen of the related gene code of congenital cataract is related to crystallin, transcription factor, connection albumen and transmembrane transport Albumen etc..Genetics research result both domestic and external shows that the disease is largely because caused by inherent cause.It is congenital white Cataract or glaucoma has significant genetic heterogeneity, there are multiple candidate disease causing genes, and this has become the morbidity machine of congenital cataract The research of system and the bottleneck of etiotropic diagnosis and Therapy study.This present situation promotes further to go to find and understand the disease New Disease-causing gene, basis is provided for follow-up gene diagnosis, pre-natal diagnosis and gene therapy.

Congenital cataract morbidity is more early, and the state of an illness is gradually in progress, normal eyes morbidity, early treatment serious to eyesight influence It is most important, but the delay discovery of infant congenital cataract and treatment phenomenon are extremely serious in China, and postoperative complications are more And easily recur, surgery cost is expensive in addition, heavy economy and mental burden is brought to patient home and society.Set up first The related detection in Gene Mutation system of its cataract, and applied to clinical position and prenatal and postnatal care, contribute to heredity first The gene diagnosis of its cataract and corresponding gene therapy, contribute to the detection of mutator carrier, contribute to by production The preceding incidence for checking reduction disease, helps to efficiently control the generation of this disease.

The content of the invention

It is an object of the invention to provide a kind of application of AQP5 genes in detection congenital cataract diagnostic product is prepared, So as to make up the deficiencies in the prior art.

Applicant from 5 generations in autosomal dominant inheritance Congenital Cataract Pedigree in, to the family all into Member has carried out the sequencing of AQP5 genes, the Disease-causing gene AQP5 of the family is have found in the presence of the pathogenic mutation in heredity, so as to promote Into the present invention.

Present invention firstly provides the new purposes of AQP5 genes, prepared for detecting in congenital cataract diagnostic product Application；

Above-mentioned diagnostic product, is the primer or probe for detecting congenital cataract as the preferred of embodiment.

Above-mentioned primer pair, its primer information is as follows：

AQP5-1F:CTATATAGCGCGCCCCAG SEQ ID NO:1、

AQP5-1R:GCAGGAAGGGAGCACATATC SEQ ID NO:2、

AQP5-2F:AAAAGCCCTACTCCCCGAG SEQ ID NO:3、

AQP5-2R:TATTTGCCTTGAGTGCCTGC SEQ ID NO:4、

AQP5-3F:ATTCTGTGGGAGTGGACCAG SEQ ID NO:5、

AQP5-3R:CCAGGTCTGGTGAGCTCTG SEQ ID NO:6、

AQP5-4F:GGCATGTGGTCTTCAAGGTC SEQ ID NO:7、

AQP5-4R:CCAAGAGGACCGGTTGTG SEQ ID NO:8；

The present invention also provides a kind of kit for being used to detect congenital cataract, includes two in above-mentioned primer pair Plant or several.

The present invention also provides a kind of SNP site related to congenital cataract disease, is AQP5 gene start codons Play the base of the 152nd.

Wherein it is used to detect that the primer information of above-mentioned SNP site is as follows：

AQP5-1F:CTATATAGCGCGCCCCAG SEQ ID NO:1

AQP5-1R:GCAGGAAGGGAGCACATATC SEQ ID NO:2。

The invention provides the new purposes of AQP5 genes, so that there is provided a kind of effective progress congenital cataract disease The approach of ospc gene diagnosis, prenatal gene examination and genetic counselling, application effect shows the SNP positions of gene provided by the present invention Point and detection primer can be effectively used for clinical patients and fetus fine hair or amniotic fluid carries out the quick of AQP5 gene mutation sites Detection.

Brief description of the drawings

Fig. 1：Patient AQP5 sequencer maps, A in the Congenital Cataract Pedigree of embodiment 1：Reference sequences；B：Propositus's sequence Row.The base T of 9 patient AQP5 gene start codons the 152nd sports C in the family.

Embodiment

Applicant has found the mutational site of AQP5 genes in a Congenital Cataract Pedigree, and confirms the prominent of the gene Change is the sick Disease-causing gene, so as to facilitate the present invention.

AQP5 genes are located at chromosome 12q13 .12, the transcribed mRNA into about 1840bp, and (NCBI accession number is NM_ 001651), directly translation forms the protein of 265 amino acid compositions.

The present invention is described in detail with reference to embodiment.

Embodiment 1：The mutational site of AQP5 genes is screened from Congenital Cataract Pedigree

1st, peripheral blood genomic DNA is extracted：

Meet national relevant policies regulation, and on the basis of sampling object is agreed to, extract family member's peripheral vein Blood 2-5ml, is put into EDTA anticoagulant tubes, -80 DEG C freeze it is standby；The EDTA anticoagulations frozen take 500 μ L to put after room temperature thawing In centrifuge tube, isometric TE (pH8.0) is added, is mixed, 4 DEG C, 10000rpm is centrifuged 10 minutes, abandons supernatant.

Add 180 μ L TE, 20 μ LSDS (10%), 8 μ L Proteinase Ks (l0mg/ml) to mix, be placed in 37 DEG C of water-baths and stay overnight. Sample, brief centrifugation precipitation sample are taken out from water-bath.Isometric Tris- saturated phenols (about 300 μ L) are added in reaction tube, Fully mix, 10000rpm is centrifuged 10 minutes at room temperature, and Aspirate supernatant (about 300 μ L) is into a new centrifuge tube.Phenol is repeated to take out Carry once, Aspirate supernatant is into a new centrifuge tube.

Add isometric Tris saturated phenols:Chloroform mixed liquor (each 150 μ L of phenol, chloroform), mix, room temperature 10000rpm from The heart 10 minutes, transfer supernatant to a new centrifuge tube.

Add isometric Tris saturated phenols:Chloroform:Isoamyl alcohol mixed liquor (each 100 μ L of phenol, chloroform, isoamyl alcohol), is mixed, Room temperature 10000rpm is centrifuged 10 minutes, transfer supernatant to a new centrifuge tube.

L/10 volumes 3mol/L, pH5.2 sodium acetate (about 30 μ L) is added, 2 times of ethanol of volume precooling 100% are gently mixed, Visible white flocculent deposit.Room temperature 10000rpm is centrifuged 10 minutes, DNA is deposited in ttom of pipe, is abandoned supernatant.

70% ethanol is added to DNA precipitations, once, room temperature 7000rpm is centrifuged 5 minutes, is abandoned supernatant, is placed in room temperature for rinsing The remaining ethanol of volatilization, is eventually adding 50 μ L TE (pH8.0), and 4 DEG C are stayed overnight dissolving DNA.

To the DNA row agarose gel electrophoresis of extraction, and application ultraviolet specrophotometer is in 260nm and 280nm colorimetrics, detection DNA purity and concentration.

2nd, direct sequencing finds the mutation of patient AQP5 genes in the family

PCR expands purpose fragment：Reaction condition and reaction system：

(1) PCR reaction conditions：94℃3min；94 DEG C of 40sec, 52 DEG C of 40se, 72 DEG C of 60sec, 30-35cycles；72℃ 10min。

(2) reaction system：(TAKARA LA Taq polymerase)

The amplification for carrying out the genomic DNA template and the AQP5 primers of every family member respectively using the reaction system is anti- Should.

PCR primer is sequenced：Above-mentioned PCR primer is sequenced using conventional Sanger PCR sequencing PCRs, wherein using primer pair AQP5-1F:CTATATAGCGCGCCCCAG,AQP5-1R:GCAGGAAGGGAGCACATATC, nine patients in the family The base T that AQP5 gene start codons play the 152nd sports C (Fig. 1).Multiple sequencing result shows the mutational site not It is because amplification or sequencing mistake are introduced.This sports a fresh mutation.The mutation is not present in four following databases In：SNP database (ftp://ftp.ncbi.nih.gov/snp/database/), thousand human genome plans (ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/), Hapmap8 databases (http:// ), and Yan Di and Huang Di, two legendary rulers of remote antiquity's database (http hapmap.ncbi.nlm.nih.gov/://yh.genomics.org.cn/), show the mutation Very rare, the mutation result in the amino acids of AQP5 albumen the 51st and sport proline by leucine.Point of application mutation forecasting Program SIFT (Sorting Intolerant From Tolerant) predictions find that the mutation result in AQP5 protein functions The damage of " damaging " level；Point of application mutation forecasting program PolyPhen (The Polymorphism Phenotype) is predicted It was found that, the mutation result in the " damage of POSSIBLY DAMAGING " levels of AQP5 protein functions；Suffer from so as to cause in the family The generation of person's congenital cataract.And carry out the site in the peripheral blood genomic DNA sample of 200 normal local crowds Mutation Screening, the mutation is not found.

Pass through above-mentioned analysis, it was demonstrated that whether AQP5 genes can suffer from congenital cataract for detection patient with potential Danger.By the way that each extron fragment of the AQP5 genes of tester is compared in normal homologous segment, person to be detected is determined Risk.

The primer pair for expanding its each extron is designed according to AQP5 genome sequence, the sequence information of its positive anti-primer is such as Under：

AQP5-1F:CTATATAGCGCGCCCCAG

AQP5-1R:GCAGGAAGGGAGCACATATC

AQP5-2F:AAAAGCCCTACTCCCCGAG

AQP5-2R:TATTTGCCTTGAGTGCCTGC

AQP5-3F:ATTCTGTGGGAGTGGACCAG

AQP5-3R:CCAGGTCTGGTGAGCTCTG

AQP5-4F:GGCATGTGGTCTTCAAGGTC

AQP5-4R:CCAAGAGGACCGGTTGTG

The above-mentioned every pair of primers of application carries out the detection of AQP5 genes respectively.

The another clear and definite congenital cataract of diagnosis of being collected in Shandong District distributes patient one, extracts its peripheral blood genome DNA, enters performing PCR amplification, using conventional Sanger PCR sequencing PCRs using DNA profiling and AQP5-1F the and AQP5-1R primers of the patient Above-mentioned PCR primer is sequenced, the AQP5 genes of the patient are deposited the SNP mutation found in the present invention, i.e. AQP5 genes and risen The base T that beginning codon plays the 152nd sports C.Pass through above-mentioned analysis, it was demonstrated that AQP5 genes can for detection patient be It is no that there is the potential danger for suffering from congenital cataract.By by the amplified fragments of the AQP5 genes of tester in normal counterpiece Section compares, and determines the risk of person to be detected.

SEQUENCE LISTING

<110>University Of Qingdao

<120>Application of the AQP5 genes in detection congenital cataract product is prepared

<130>

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 18

<212> DNA

<213> 1

<400> 1

ctatatagcg cgccccag 18

<210> 2

<211> 20

<212> DNA

<213> 2

<400> 2

gcaggaaggg agcacatatc 20

<210> 3

<211> 19

<212> DNA

<213> 3

<400> 3

aaaagcccta ctccccgag 19

<210> 4

<211> 20

<212> DNA

<213> 4

<400> 4

tatttgcctt gagtgcctgc 20

<210> 5

<211> 20

<212> DNA

<213> 5

<400> 5

attctgtggg agtggaccag 20

<210> 6

<211> 19

<212> DNA

<213> 6

<400> 6

ccaggtctgg tgagctctg 19

<210> 7

<211> 20

<212> DNA

<213> 7

<400> 7

ggcatgtggt cttcaaggtc 20

<210> 8

<211> 18

<212> DNA

<213> 8

<400> 8

ccaagaggac cggttgtg 18

Claims (10)

1. a kind of application process of AQP5 genes, it is characterised in that described application process is being prepared for detecting congenital Application in Diagnosis of Cataract product.

2. application process as claimed in claim 1, it is characterised in that the detection congenital cataract in described method is logical Cross the SNP site of detection AQP5 genes to carry out, described SNP site, be that AQP5 gene start codons play the 152nd Base.

3. it is with drawing application process as claimed in claim 2, it is characterised in that the SNP site of described detection AQP5 genes Thing amplification of nucleic acid fragment, then carry out sequencing and determine whether there is SNP site.

4. application process as claimed in claim 3, it is characterised in that the sequence information of the primer used in described method is such as Under：

5. a kind of SNP site, it is characterised in that described SNP site is the alkali that AQP5 gene start codons play the 152nd Base.

6. the method for the SNP site described in test right requirement 5, it is characterised in that described method is by primer pair amplifies Sample to be detected, sequencing determines whether there is SNP site.

7. method as claimed in claim 6, it is characterised in that described primer pair is SEQ ID NO:1、SEQ ID NO:2 Or SEQ ID NO:3、SEQ ID NO:4；Or SEQ ID NO:5、SEQ ID NO:6；Or SEQ ID NO:7、SEQ ID NO: 8。

8. a kind of diagnostic product for being used to detect congenital cataract, it is characterised in that described product is to be used to detect to be checked Object is with the presence or absence of the SNP site described in claim 5.

9. diagnostic product as claimed in claim 8, it is characterised in that described product includes for detecting in claim The primer pair of SNP site described in 5, described primer pair is a pair or several right in following primer pair；

10. the primer pair of the SNP site described in test right requirement 5, described primer pair be a pair in following primer pair or It is several right；