CN105274225B - It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease - Google Patents
It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease Download PDFInfo
- Publication number
- CN105274225B CN105274225B CN201510690126.0A CN201510690126A CN105274225B CN 105274225 B CN105274225 B CN 105274225B CN 201510690126 A CN201510690126 A CN 201510690126A CN 105274225 B CN105274225 B CN 105274225B
- Authority
- CN
- China
- Prior art keywords
- chst6
- gene
- patch shape
- corneal dystrophy
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The object of the present invention is to provide the SNP sites planted for detecting patch shape corneal dystrophy disease, are the gene coding region CHST6 250-272 bit base by initiation codon.The present invention provides the new purposes of CHST6 gene, to provide a kind of effective approach for carrying out the diagnosis of patch shape corneal dystrophy disease gene, prenatal gene screening and genetic counselling, application effect shows the SNP site of gene provided by the present invention and detection primer can be effectively used for clinical patients and fetus villus or amniotic fluid carries out the quick detection of CHST6 gene mutation site.
Description
Technical field
The invention belongs to gene diagnosis product technique fields, and in particular to one kind is for detecting patch shape corneal dystrophy
The SNP site of disease.
Background of invention
Groenouw's macular corneal dystrophy (macular corneal dystrophy, MCD) is a kind of autosomal recessive inheritance
Disease, it is clinically more rare characterized by bilateral corneal stroma progressive mist-like bleary and central cornea are thinning, but fall ill compared with
Seriously, early stage significantly affects eyesight.Patient more symmetrically falls ill usually before 10 years old with regard to eyes, visual impairment, about at 20 years old
When the state of an illness it is obvious, have photophobia, shed tears and the symptom of visual impairment, keratopathy initial stage show as Central corneal shallow foundation matter
The tiny cloud of layer is muddy, and some is translucent ring-type.These later tiny muddinesses are gradually fused to multiform, irregular ash
White sample, extends with disease progression to cornea periphery and cornea depth hypothallus develops.When the region of the opacity of the cornea is to extended surface shape
It is in nodositas at protrusion anterior corneal surface, causes cornea irregular astigmatism, and when muddy region is developed to elastic layer, under slit-lamp
It can be seen that there is a large amount of endothelium wart after cornea.Different from other corneal dystrophies, patch shape corneal dystrophy is in the course of disease
It is developed to advanced stage, may occur in which that cornea is thinning.
When visual impairment is obvious, influence work and life when, can andante layer or Penetrating Keratoplasty treated, but
The postoperative possibility that all there is recurrence.Keratan sulfate (keratan sulfate, KS) in patients serum is checked according to ELISA method
The height of antigen concentration and immunohistochemistry inspection to cornea tissue, are divided into three types for groenouw's macular corneal dystrophy, I type patient's
There is no the immune response of KS in serum and cornea, there is no the immune response of KS in the serum of I A type patient, but there are KS in cornea
Immune response, and all there is the immune response of KS in II patients serum and cornea.
The morbidity of patch shape corneal dystrophy is more early, and the state of an illness is gradually in progress, normal eyes morbidity, serious to eyesight influence, often
Merge that corneal epithelium is rotten to the corn and irritating symptom in addition to corneal graft there is no better treatment method at present, and performs the operation and supply
Body is deficient, and postoperative complications are more and are easy recurrence, and surgery cost is expensive in addition, brings heavy warp to patient home and society
Ji and mental burden.The relevant detection in Gene Mutation system of patch shape corneal dystrophy is established, and is applied to clinical position
And prenatal and postnatal care, facilitate the gene diagnosis and corresponding gene therapy of heredity patch shape corneal dystrophy, helps to dash forward
The detection for becoming gene carrier facilitates the incidence for reducing disease by antenatal exaination, helps to efficiently control this disease
The generation of disease.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the SNP site of patch shape corneal dystrophy disease, to make up
The deficiencies in the prior art.
In patch shape corneal dystrophy family of the applicant from 5 generations in autosomal recessive inheritance, to the family
Whole members have carried out the sequencing of CHST6 gene, have found the family Disease-causing gene CHST6 exist genetically cause a disease it is prominent
Become, to facilitate the present invention.
The present invention provides a kind of SNP site relevant to patch shape corneal dystrophy disease, is the gene coding region CHST6
Domain 250-272 bit base by initiation codon.
It is wherein as follows for detecting the primer information of above-mentioned SNP site:
The present invention provides the new purposes of CHST6 gene, to provide a kind of effective progress patch shape cornea battalion
The approach of bad disease gene diagnosis, prenatal gene screening and genetic counselling is supported, application effect shows base provided by the present invention
The SNP site and detection primer of cause can be effectively used for clinical patients and fetus villus or amniotic fluid carries out CHST6 gene mutation
The quick detection in site.
Detailed description of the invention
Fig. 1: patient's CHST6 sequencer map in the patch shape corneal dystrophy family of embodiment 1, wherein A: reference sequences；
B: patient.Three gene coding region patient CHST6 463-464 bit bases by initiation codon have occurred pure in the family
Mutation is closed, base CG is lacked.
Fig. 2: patient's CHST6 sequencer map in the patch shape corneal dystrophy family of embodiment 2, wherein A: reference sequences；
B: normal person.Three gene coding region patient CHST6 250-272 bit bases by initiation codon have occurred in the family
Homozygous mutation, base AGCGCCGCAACGCTGCACATGGC are lacked.
Specific embodiment
Applicant has found the mutational site of CHST6 gene in a patch shape corneal dystrophy family, and confirming should
The mutation of gene is the Disease-causing gene of the disease, to facilitate the present invention.
CHST6 gene is located at Chromosome 16q 22, and (NCBI accession number is NM_ to the transcribed mRNA at about 1188bp
021615.4), directly translation forms the protein that 395 amino acid forms.
The present invention is described in detail below with reference to embodiment.
Embodiment 1: the mutational site of CHST6 gene is screened from patch shape corneal dystrophy family
1, peripheral blood genomic DNA is extracted:
Meeting national relevant policies regulation, and on the basis of sampling object agreement, is extracting outside first family member
All venous blood 2-5ml, are put into EDTA anticoagulant tube, -80 DEG C freeze it is spare；The EDTA anticoagulation frozen takes after room temperature thawing
500 μ L are put in centrifuge tube, are added isometric TE (pH8.0), mix, 4 DEG C, and 10000rpm is centrifuged 10 minutes, abandon supernatant.
180 μ L TE, 20 μ LSDS (10%), 8 μ L Proteinase Ks (l0mg/ml) are added to mix, is placed in 37 DEG C of water-baths and stays overnight.
Sample is taken out from water-bath, brief centrifugation precipitates sample.It is added in reaction tube isometric Tris- saturated phenol (about 300 μ L),
It mixes well, 10000rpm is centrifuged 10 minutes at room temperature, and Aspirate supernatant (about 300 μ L) is into a new centrifuge tube.Phenol is repeated to take out
It mentions once, Aspirate supernatant is into a new centrifuge tube.
Isometric Tris saturated phenol: chloroform mixed liquor (each 150 μ L of phenol, chloroform) is added, mix, room temperature 10000rpm from
The heart 10 minutes, transfer supernatant to a new centrifuge tube.
Isometric Tris saturated phenol: chloroform: isoamyl alcohol mixed liquor (each 100 μ L of phenol, chloroform, isoamyl alcohol) is added, mixes,
Room temperature 10000rpm is centrifuged 10 minutes, transfer supernatant to a new centrifuge tube.
It being added l/10 volume 3mol/L, pH5.2 sodium acetate (about 30 μ L), 100% ethyl alcohol is pre-chilled in 2 times of volumes, it is gently mixed,
Visible white flocculent deposit.Room temperature 10000rpm is centrifuged 10 minutes, and DNA is made to be deposited in tube bottom, abandons supernatant.
It is precipitated to DNA and 70% ethyl alcohol is added, rinsing is primary, and room temperature 7000rpm is centrifuged 5 minutes, abandons supernatant, is placed in room temperature
Volatilize remaining ethyl alcohol, is eventually adding 50 μ L TE (pH8.0), 4 DEG C of overnight dissolving DNAs.
To the DNA row agarose gel electrophoresis of extraction, and application ultraviolet specrophotometer is in 260nm and 280nm colorimetric, detection
DNA purity and concentration.
2, direct sequencing finds the mutation of patient CHST6 gene in the family
PCR amplification target fragment: reaction condition and reaction system:
(1) PCR reaction condition: 94 DEG C of 3min；94 DEG C of 40sec, 57 DEG C of 40se, 72 DEG C of 60sec, 30-35cycles；72℃
10min。
(2) reaction system: (TAKARA LA Taq polymerase)
Carry out the genomic DNA template of every family member and the amplification of the CHST6 primer respectively using the reaction system
Reaction.
PCR product sequencing: being sequenced above-mentioned PCR product using routine Sanger PCR sequencing PCR, wherein applying primer pair
CHST6-F:CCACAAACTCCTTGGTCAAT,CHST6-R:TGTCTTAAGGCCACATTTCC,CHST6-2F:
GACGTGTTTGATGCCTATCTGCCTTG, CHST6-2R:TCCGTGGGTGATGTTATGGAT, eight patients in the family
Homozygous mutation has occurred in the gene coding region CHST6 463-464 bit base by initiation codon, and base CG is lacked
(Fig. 1).Multiple sequencing result shows that the mutational site is not because amplification or sequencing mistake are introduced.This sports a new life
Mutation.The mutation is not present in four following databases: single nucleotide polymorphism database (ftp: //
Ftp.ncbi.nih.gov/snp/database/), human genome project (ftp: //ftp-trace.ncbi.nih.gov/
1000genomes/ftp/), Hapmap8 database (http://hapmap.ncbi.nlm.nih.gov/) and Yan Di and Huang Di, two legendary rulers of remote antiquity's database
(http://yh.genomics.org.cn/) shows that the mutation is very rare, which results in CHST6 length protein and cut
It is short, so as to cause the generation of patient's patch shape corneal dystrophy.And in the peripheral blood genome of 200 normal local crowds
The Mutation Screening that the site is carried out in DNA sample, does not find the mutation.
Pass through above-mentioned analysis, it was demonstrated that CHST6 gene, which can be used to detect patient whether to have, potential suffers from patch shape cornea
Underfed danger.Compared by each exon segment of the CHST6 gene for the person of will test in normal homologous segment, is determined
The risk of person to be detected.
The primer pair for expanding its each exon, the sequence information of positive anti-primer are designed according to the genome sequence of CHST6
It is as follows:
CHST6-F:CCACAAACTCCTTGGTCAAT
CHST6-R:TGTCTTAAGGCCACATTTCC
CHST6-1F:GCCCCTAACCGCTGCGCTCTC
CHST6-1R:GGCTTGCACACGGCCTCGCT
CHST6-2F:GACGTGTTTGATGCCTATCTGCCTTG
CHST6-2R:TCCGTGGGTGATGTTATGGAT
The above-mentioned every pair of primers of application carries out the detection of CHST6 gene respectively.
Embodiment 2: the mutational site of CHST6 gene is screened from patch shape corneal dystrophy family
Collect patch shape corneal dystrophy family: it is bright to collect diagnosis in Shandong eye institute and Qingdao ophthalmologic hospital
The family of true patch shape corneal dystrophy.
Extract peripheral blood genomic DNA:
The peripheric venous blood 2-5ml for extracting all members in patch shape corneal dystrophy family respectively, it is anti-to be put into EDTA
In solidifying pipe, -80 DEG C freeze it is spare；The EDTA anticoagulation frozen takes 500 μ L to be put in centrifuge tube, application implementation after room temperature thawing
The conventional phenol chloroform method narrated in example 1 extracts genomic DNA from member's peripheral blood each in family.
PCR amplification target fragment: reaction condition and reaction system:
(1) PCR reaction condition: 94 DEG C of 3min；94 DEG C of 40sec, 57 DEG C of 40se, 72 DEG C of 60sec, 30-35cycles；72℃
10min。
(2) reaction system: (TAKARA LA Taq polymerase)
Carry out the genomic DNA template of every family member 4 pairs with CHST6 gene respectively respectively using the reaction system
The amplified reaction of primer.
PCR product sequencing: application routine Sanger PCR sequencing PCR to the genomic DNA template of three members of the family respectively with
The amplified production of 4 pairs of primers of CHST6 gene is sequenced, wherein with primer pair CHST6-F:
CCACAAACTCCTTGGTCAAT,CHST6-R:TGTCTTAAGGCCACATTTCC,CHST6-1F:
GCCCCTAACCGCTGCGCTCTC, CHST6-1R:GGCTTGCACACGGCCTCGCT detect CHST6 gene in patients
Homozygous mutation: homozygous mutation has occurred in the gene coding region CHST6 250-272 bit base by initiation codon, alkali
Missing (Fig. 2) occurs for base AGCGCCGCAACGCTGCACATGGC, which is not present in four following databases: monokaryon
Nucleotide polymorphism database (ftp: //ftp.ncbi.nih.gov/snp/database/), human genome project (ftp: //
Ftp-trace.ncbi.nih.gov/1000genomes/ftp/), Hapmap8 database (http: //
Hapmap.ncbi.nlm.nih.gov/) and Yan Di and Huang Di, two legendary rulers of remote antiquity's database (http://yh.genomics.org.cn/), show the mutation
Very rare, which results in the truncation of CHST6 length protein, so as to cause the hair of patient's patch shape corneal dystrophy
It is raw.And the Mutation Screening in the site is carried out in the peripheral blood genomic DNA sample of 200 normal local crowds, this is not found
Mutation.
Above-mentioned testing result shows that the mutational site of CHST6 gene can be used in detecting patch shape corneal dystrophy.
Claims (2)
1. a kind of SNP site relevant to patch shape corneal dystrophy disease is in preparation for detecting patch shape corneal nutrition not
Application in the product of good disease；The SNP site is the gene coding region CHST6 250-272 by initiation codon
Homozygous mutation has occurred in the base of position, and base AGCGCCGCAACGCTGCACATGGC is lacked.
2. application as described in claim 1, which is characterized in that the product is the primer pair for PCR amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510690126.0A CN105274225B (en) | 2015-10-22 | 2015-10-22 | It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510690126.0A CN105274225B (en) | 2015-10-22 | 2015-10-22 | It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105274225A CN105274225A (en) | 2016-01-27 |
| CN105274225B true CN105274225B (en) | 2019-01-18 |
Family
ID=55144052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510690126.0A Active CN105274225B (en) | 2015-10-22 | 2015-10-22 | It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105274225B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022614A (en) * | 2017-04-21 | 2017-08-08 | 唐旌生物科技（上海）有限公司 | A kind of method and kit for detecting gene mutation |
| CN110714066A (en) * | 2019-10-22 | 2020-01-21 | 福州福瑞医学检验实验室有限公司 | DNA library for detecting and diagnosing corneal dystrophy disease-causing gene and application thereof |
| CN114693622B (en) * | 2022-03-22 | 2023-04-07 | 电子科技大学 | Plaque erosion automatic detection system based on artificial intelligence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009100159A2 (en) * | 2008-02-04 | 2009-08-13 | Bipar Sciences, Inc. | Methods of diagnosing and treating parp-mediated diseases |
-
2015
- 2015-10-22 CN CN201510690126.0A patent/CN105274225B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009100159A2 (en) * | 2008-02-04 | 2009-08-13 | Bipar Sciences, Inc. | Methods of diagnosing and treating parp-mediated diseases |
Non-Patent Citations (4)
| Title |
|---|
| Novel mutations in the carbohydrate sulfotransferase gene (CHST6) in American patients with macular corneal dystrophy;Aldave AJ et al.;《American Journal of Ophthalmology》;20040331;第137卷(第3期);465-473 |
| Novel mutations in the CHST6 gene causing mcorneal dystrophyacular;Abbruzzese C et al.;《Clinical Genetics》;20040129;第65卷(第2期);120-125 |
| Sequencing of the CHST6 gene in Czech macular corneal dystrophy patients supports the evidence of a founder mutation;Liskova,P et al.;《British Journal of Ophthalmology》;20071025;第92卷(第2期);265-267 |
| 斑状角膜营养不良CHST6基因突变及组织病理学研究;李璇;《大连医科大学硕士论文》;20111231;摘要 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105274225A (en) | 2016-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Estrada-Cuzcano et al. | IQCB1 mutations in patients with leber congenital amaurosis | |
| Maubaret et al. | Autosomal dominant retinitis pigmentosa with intrafamilial variability and incomplete penetrance in two families carrying mutations in PRPF8 | |
| Tuo et al. | The HtrA1 promoter polymorphism, smoking, and age-related macular degeneration in multiple case-control samples | |
| CN105274225B (en) | It is a kind of for detecting the SNP site of patch shape corneal dystrophy disease | |
| Chen et al. | Identification of PGF as a new gene for neovascular age-related macular degeneration in a Chinese population | |
| Reinstein et al. | A founder mutation in ADAMTSL4 causes early-onset bilateral ectopia lentis among Jews of Bukharian origin | |
| CN107312859A (en) | Application of the AQP5 genes in detection congenital cataract product is prepared | |
| CN106282197B (en) | A kind of pathogenic mutation and its detection reagent of hereditary retinitis pigme ntosa disease | |
| CN105256059B (en) | TUBA3D gene is preparing the application in keratoconus diagnostic product | |
| CN106282383B (en) | Application of the KRT12 gene in detection keratoconus | |
| CN102732607B (en) | Kit for detecting high myopia | |
| CN105274236B (en) | The application of ABCA3 genes | |
| CN105803078B (en) | CRYBA4 gene is detecting the application in congenital CCMC | |
| CN107190071A (en) | A kind of SNP marker for being used to detect RhD variation phenotypes | |
| CN105256029B (en) | CHST6 genes are preparing the application in detecting patch shape corneal dystrophy product | |
| CN105624167B (en) | A kind of pathogenic mutation and its detection reagent of heredity centrality halo shape retinopathy | |
| CN103820548B (en) | Application of MYO18A gene in preparation of diagnostic product for treating congenital microphthalmia | |
| Abouzeid et al. | A new locus for congenital cataract, microcornea, microphthalmia, and atypical iris coloboma maps to chromosome 2 | |
| CN108866067B (en) | Pathogenic mutation of Leber congenital amaurosis and detection reagent thereof | |
| CN104357551B (en) | TMCO3 gene detects the application in Fuchs Fuch's dystrophy goods in preparation | |
| CN106434933A (en) | Application of CRYBB2 gene in preparation of product for detecting congenital cataract | |
| CN106755446B (en) | A kind of SNP site relevant to congenital CCMC | |
| CN106521020B (en) | A kind of SNP site of CRYBB1 gene | |
| CN107267639A (en) | Application of the FBN1 genes in detection congenital simple ectopia lentis product is prepared | |
| CN105603114A (en) | Application of LIM2 gene in detecting congenital CCMC (cataract-microcornea syndrome) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |