CN113322331A - Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper - Google Patents
Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper Download PDFInfo
- Publication number
- CN113322331A CN113322331A CN202110595081.4A CN202110595081A CN113322331A CN 113322331 A CN113322331 A CN 113322331A CN 202110595081 A CN202110595081 A CN 202110595081A CN 113322331 A CN113322331 A CN 113322331A
- Authority
- CN
- China
- Prior art keywords
- genotype
- brown planthopper
- genotypes
- brown
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses a relationship between polymorphism site genotypes of a brown planthopper cytochrome P450CYP4C61 gene and a nicotinic acetylcholine receptor alpha-7-like gene and the pest causing property of the brown planthopper, and provides a method for evaluating the potential applicability of an insect-resistant rice variety based on the specific pest causing genotype of the brown planthopper. The genetic variation locus combination discovered by the invention can divide any brown planthopper field population into 3 genotypes related to the pest causing property, has extremely wide representativeness and applicability, tests the pest resistance of target rice varieties by using homozygous progeny of the brown planthopper populations of the three genotypes, and can objectively reflect the effectiveness of potential rice pest resistance varieties in field application in future.
Description
Technical Field
The invention belongs to the technical field of rice insect-resistant phenotype identification. More particularly, relates to a method for evaluating the potential applicability of insect-resistant rice varieties based on specific harmful genotypes of brown planthopper.
Background
Brown planthopper is one of main pests harmful to rice, and the outbreak of brown planthopper can cause a large amount of yield reduction in rice fields, thereby seriously threatening the grain safety. The breeding and popularization of the insect-resistant rice variety are considered to be one of important means for controlling the brown planthopper to be harmful and ensuring the grain safety, and have the advantages of economy, environmental protection, sustainability and the like.
At present, in the identification process of the insect-resistant phenotype of rice, the genetic background of pests is not required. For example, chinese patent CN 112083128A discloses a phenotype identification method for high yield and insect resistance of rice, which obtains high yield and insect resistance of rice by collecting hyperspectral images of rice after being infected by pests and processed, analyzing the hyperspectral images, and calculating according to a formula without any requirement on the pests. Chinese patent CN 111264320A discloses a method for accurately identifying the resistance of brown planthopper in the adult stage of rice, wherein artificial inoculation is required in the identification process, but no special requirement is provided for the inoculated pests. Most of brown planthopper populations selected by the methods are laboratory long-term fed populations, and the brown planthopper populations often have larger difference from actual genetic backgrounds of field populations. After the bred varieties are applied in the field, the varieties are quickly adapted by field populations, even the varieties have no corresponding resistance phenotype to the field populations at all, and the real resistance level of the bred varieties to the field brown planthopper populations cannot be truly reflected, so that the final use effect is not as expected. If the field population is simply used for the test of the insect resistance of the rice, a reliable and ideal result is often difficult to obtain under the condition that the genetic background related to the pest causing performance of the field population is not clear. Therefore, in order to more accurately evaluate the insect resistance of rice varieties, the genetic background related to the pest causing performance of the brown planthopper population in the field needs to be clarified.
Disclosure of Invention
The invention aims to overcome the defects and shortcomings of the prior art and provide a method for evaluating the potential applicability of insect-resistant rice varieties based on specific harmful genotypes of brown planthoppers.
The first purpose of the invention is to provide the application of the combination of the polymorphic sites 88-254-352-542 of the brown planthopper cytochrome P450CYP4C61 gene and the polymorphic site 576-580 of the alpha-7-like gene of the nicotinic acetylcholine receptor in the preparation of a brown planthopper pest causing genotype identification kit, the identification of the brown planthopper pest causing level and the evaluation of the potential applicability of insect-resistant rice varieties.
The second purpose of the invention is to provide a kit for identifying the pest causing genotype of brown planthopper.
The third purpose of the invention is to provide a method for identifying the pest causing genotype of brown planthopper.
The fourth purpose of the invention is to provide a method for evaluating the potential applicability of the insect-resistant rice variety based on the specific harmful genotype of the brown planthopper.
The above purpose of the invention is realized by the following technical scheme:
the invention firstly provides the relation between the combination of polymorphic sites 88-254-352-542 of brown planthopper cytochrome P450CYP4C61 gene shown in SEQ ID NO.5 and the polymorphic site 576-580 of nicotinic acetylcholine receptor alpha-7-like (nAChR-alpha-7-like) gene shown in SEQ ID NO.6 and the harmful genotype of brown planthopper, as shown in the table:
wherein Genotype1 is a non-deleterious Genotype, and Genotype2 and Genotype3 are deleterious genotypes.
By detecting the genotypes of the polymorphic sites 261588-261754-261852-262042 (i.e. 88 th, 254 th, 352 nd and 542 th bases of the cytochrome P450CYP4C61 gene of the brown planthopper and the polymorphic sites 251576-251251580 (i.e. 576 th and 580 th bases of the sequence of the SEQ ID NO. 6) of the alpha-7 like (nAChR-alpha-7-like) gene of the nicotinic acetylcholine receptor, whether the detected brown planthopper is a harmful genotype can be judged according to the table. Therefore, the invention provides application of protecting the application of the polymorphism sites 251576-251580 of the alpha-7-like gene of the nicotinic acetylcholine receptor of the brown planthopper and the polymorphism sites 261588-261754-261852-262042 of the cytochrome P450CYP4C61 gene in identifying the pest causing genotype of the brown planthopper, preparing a pest causing genotype identification kit of the brown planthopper and/or evaluating the potential applicability of insect-resistant rice varieties.
The invention provides an identification kit for a brown planthopper destructive genotype, which comprises reagents for detecting the genotypes of polymorphic sites 261588-261754-261852-262042 (namely, 88 th, 254 th, 352 nd and 542 th bases of a SEQ ID NO.5 sequence) and a polymorphic site 251576-251580 of a nicotine acetylcholine receptor alpha-7-like gene of a brown planthopper cytochrome P450CYP4C61 gene.
The invention also provides a method for identifying the harmful genotype of brown planthopper, which comprises the following steps:
s1, extracting genome DNA of brown planthopper;
s2, respectively carrying out PCR amplification on the alpha-7-like gene of the nicotine acetylcholine receptor of the brown planthopper and the cytochrome P450CYP4C61 gene fragment by taking the DNA obtained in the step S1 as a template;
and S3, after sequencing the amplification products, comparing the amplification products with the table.
Preferably, the PCR amplification primer sequences used in step S2 are shown in SEQ ID NO. 1-4, see example 1.
Preferably, the PCR amplification reaction system used in step S2 is 20 ng/. mu.L template DNA 1. mu.L, 10. mu.M forward primer 2. mu.L, 10. mu.M reverse primer 2. mu.L, 2 XHiFi Mix 25. mu.L, ddH2O20. mu.L, 50. mu.L in total, see example 1.
Preferably, the PCR amplification procedure of step S2 is pre-denaturation at 95 ℃ for 2 min; 30 cycles of denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40 s; finally, a further extension at 72 ℃ for 5min is carried out, see example 1.
The invention further introduces brown planthopper populations with different pest-resistance related genotypes to perform a rice pest-resistance phenotype identification test, thereby obtaining more real and reliable phenotype data and effectively evaluating the effectiveness level of the rice pest-resistance phenotype.
The invention also provides a method for evaluating the potential applicability of the insect-resistant rice variety based on the specific injurious genotype of the brown planthopper, which comprises the following steps:
s1, taking field population of brown planthopper captured in the field as F0 generation, and placing the brown planthopper on pest-sensitive rice variety for propagation for one generation to obtain F1;
s2, after F1 grows to be an adult, pairing female adults and male adults pairwise, transferring the adult females and the male adults to pest-sensitive rice in the middle tillering stage for independent feeding, and taking out parent adults and respectively extracting genome DNA (deoxyribonucleic acid) in a single-head mode after the female and male adults are mated and lay eggs for 7 days;
s3, respectively carrying out PCR amplification on the brown planthopper cytochrome P450CYP4C61 gene and the nicotine acetylcholine receptor alpha-7-like gene by using the DNA obtained in the step S2 as a template;
s4, sequencing the obtained PCR product to obtain genotypes of corresponding SNPs on a CYP4C61 gene and a nAChR-alpha-7-like gene of the brown planthopper individual;
s5, comparing the obtained genotypes with the tables to respectively obtain filial generations of a non-deleterious Genotype1, a deleterious Genotype2 and a Genotype3, wherein if the matched parental genotypes are the same genotypes and each locus is not a heterozygous Genotype, the filial generations can be kept as specific homozygous Genotype filial generations;
s6, respectively using homozygous progeny of the three genotypes to perform insect resistance tests on the target rice variety, and if the target rice variety has resistance to brown planthoppers of the three genotypes and the resistance level has no obvious difference among homozygous progeny of different genotypes, considering that the target variety has stable and excellent insect resistance; if the target rice variety has resistance to the brown planthoppers of three genotypes, but the resistance level to the brown planthoppers of the lethal genotypes Genotype2 and Genotype3 is obviously lower than the resistance level to the brown planthoppers of the non-lethal Genotype1, the target rice variety is considered to have insect resistance but has the risk of insect resistance failure at present; if the target rice variety has resistance to brown planthoppers of the non-lethal Genotype1 but does not have resistance to one or both of the brown planthoppers of the lethal Genotype2 and Genotype3, the target rice variety is considered to have no insect resistance applicable in the field.
Preferably, the insect-susceptible rice variety is TN1, see example 2.
The invention also provides application of the kit and the method in evaluation of potential applicability of insect-resistant rice varieties by the brown planthopper.
The invention has the following beneficial effects:
the invention discloses a relation between the genotype of the polymorphic site 251576-251580 of the alpha-7-like gene of the nicotinic acetylcholine receptor of brown planthopper and the polymorphic site 261588-261754-261852-262042 of the cytochrome P450CYP4C61 gene and the pest causing genotype of the brown planthopper. On the basis, homozygous offspring of non-lethal Genotype1 and lethal Genotype genotypes 2 and 3 are obtained by screening brown planthoppers captured in the field, and a pest resistance test is carried out on a target rice variety, so that the potential applicability of the pest-resistant rice variety is evaluated. Compared with the conventional evaluation method, the method overcomes the defect that the actual genetic background of the field population of the brown planthopper is not considered when the conventional evaluation method is used for determining the phenotype of the rice insect-resistant variety, and the result is more accurate and reliable. The genetic variation locus combination discovered by the invention can divide any brown planthopper field population into 3 kinds of genotype related to harmfulness, and has extremely wide representativeness and applicability. The homozygous progeny of the brown planthopper populations of the three genotypes are used for testing the insect resistance of the target rice variety, so that the effectiveness of the potential rice insect-resistant variety in field application in future can be objectively reflected.
Drawings
FIG. 1 is a technical route chart of the method for evaluating the potential applicability of insect-resistant rice varieties based on the specific deleterious genotypes of brown planthopper in the invention.
FIG. 2 shows the level of resistance of different rice varieties to Nilaparvata lugens as determined by the honeydew method.
Detailed Description
The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Example 1 analysis of the deleterious genotypes of the field populations of Nilaparvata lugens in different regions
In order to verify that the genetic variation locus combination discovered by the invention can distinguish any brown planthopper field population into 3 kinds of genotype related to harmfulness, and has extremely wide representativeness and applicability. In 2017, the inventor randomly samples the field population of brown planthoppers in Guangdong Shaoguan, Guizhou Zunyi and Zhejiang navian, and classifies the harmful genotypes of the collected brown planthoppers through the steps of DNA extraction, PCR amplification, sequencing and the like.
1. Brown planthopper genome DNA extraction
The invention uses Genomic DNAisolation Kit of OMEGA company to extract genome DNA, and comprises the following steps:
(1) grinding insect in liquid nitrogen, adding 500 μ L Buffer GTC/2-Me;
(2) violently vortexing for 15s, standing at room temperature for 2-3min, and prolonging the maximum time to 5 min;
(3) centrifuging for 5min at 13000 rpm;
(4) transferring the supernatant to
In DNA Column, 13000 turns and centrifuges for 1 min;
(5) subjecting the mixture obtained in step 4 to
Sleeving a DNA Column in a 2mL collecting pipe, adding 500 mu L Buffer HB into the Column, centrifuging for 1min at 13000 rpm, and removing the filtrate;
(6) adding 700. mu.L of DNA Wash buffer into the column, centrifuging for 1min at 13000 rpm, and discarding the filtrate;
(7) sleeving the column back to the collecting pipe, centrifuging at 12000 rpm for 2min, and drying the column;
(8) the column was transferred to a new 1.5mL centrifuge tube, 50-100. mu.L of Elution Buffer was added, and the mixture was left at room temperature for 2min, and centrifuged at 13000 rpm for 1 min.
2. PCR amplification of Nilaparvata lugens nAChR-alpha-7-like gene and CYP4C61 gene
The genome DNA of the brown planthopper is used as a template, and the following primers are used for carrying out PCR amplification on a fragment containing corresponding SNP.
The primers are designed by respectively taking a nicotinic acetylcholine receptor alpha-7-like (nAChR-alpha-7-like) gene (KN152279.1) and a cytochrome P450CYP4C61 gene (KN152684.1) of the brown planthopper as target genes.
Wherein the sequence of an amplification primer of the nAChR-alpha-7-like gene is as follows:
N-F：CATTATTCATACAGATTTGATGGAGAG(SEQ ID NO.1)；
N-R：CACTAGGTGTCAAATCTACAAACC(SEQ ID NO.2)。
the sequence of the amplification primer of the CYP4C61 gene is as follows:
P-F：TCGAAGGTGAGTTGTTTGTTTTGT(SEQ ID NO.3)
P-R：AGCCCTAAAGAGAAAAGAGACAATGT(SEQ ID NO.4)
PCR amplification was performed using the HiFiHotStartStremix PCR Kit reagent from KAPA, adding the reagents shown in the following table to a 0.2mL PCR centrifuge tube:
PCR reaction procedure: heating the cover, and performing pre-denaturation at 95 ℃ for 2 min; 30 cycles of denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40 s; finally, the extension is carried out for 5min at 72 ℃.
3. Brown planthopper individual genotyping
The PCR products are sent to a sequencing company for direct sequencing, and the sequence is analyzed according to a sequencing peak diagram.
Analyzing the combination of the target SNP loci, including 261588, 261754, 261852 and 262042 four loci (corresponding to 88 th, 254 th, 352 th and 542 th bases in the sequence of SEQ ID NO. 5) of the CYP4C61 gene. And 251576 and 251580 sites of the nAChR-alpha-7-like gene (corresponding to 576 th base and 580 th base in the sequence of SEQ ID NO.6, respectively). The relation between the combination of the polymorphic loci 88-254-352-542 of the cytochrome P450CYP4C61 gene and the polymorphic loci 576-580 of the nAChR-alpha-7-like gene of the brown planthopper and the injurious Genotype of the brown planthopper is shown in Table 1, if the combination of the target SNP loci meets the combination characteristics of Genotype1 in Table 1, the individual Genotype of the brown planthopper is the non-injurious Genotype Genotype 1; if the combination of the target SNP loci meets the combination characteristics of Genotype2 in the table 1, the individual Genotype of the brown planthopper is a harmful Genotype 2; if the combination of the target SNP loci meets the combination characteristics of Genotype3 in the table 1, the individual Genotype of the brown planthopper is the deleterious Genotype 3.
TABLE 1 relationship of polymorphic sites to the deleterious genotypes of Nilaparvata lugens
The analysis results of the pest causing genotypes of the field populations of the brown planthoppers in different regions are shown in the table 2, 263 samples in total can be distinguished into one of 3 pest causing related genotypes by the genetic variation locus combination discovered by the invention, and the results show that the genetic variation locus combination discovered by the invention can distinguish any field population of the brown planthoppers into the 3 pest causing related genotypes, so that the brown planthopper field populations have extremely wide representativeness and applicability.
TABLE 2 analysis of the pest-causing genotypes of brown planthopper field populations in different regions
| Genotype1 | Genotype2 | Genotype3 | Total number of | |
| Guangdong Shaoshaoguan | 19 | 46 | 21 | 86 |
| Guizhou Zunyi | 27 | 54 | 9 | 90 |
| Zhoushan of Zhejiang province | 26 | 52 | 9 | 87 |
Example 2 method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper
A method for evaluating potential applicability of insect-resistant rice varieties based on specific injurious genotypes of brown planthoppers is disclosed, and a technical route chart is shown in figure 1.
1. Treating brown planthopper field population;
respectively capturing the brown planthopper field population P-SG in Guangdong Shaokuan fields, and respectively placing the brown planthopper field population P-SG on an insect-susceptible rice variety TN1 for propagation for one generation.
After the worm grows into an adult, pairing the female adult with the male adult in pairs, transferring the adult to TN1 rice in the middle tillering stage for independent feeding, ensuring the female and male worms to mate and lay eggs for 7 days, and then taking away the parent adult for subsequent genome DNA extraction.
2. Extracting single brown planthopper genome DNA;
3. carrying out PCR amplification on the Nilaparvata lugens nAChR-alpha-7-like gene and the CYP4C61 gene;
4. carrying out individual genotyping on brown planthoppers;
2-4 specific experimental procedures were performed with reference to example 1.
5. Obtaining of brown planthopper homozygous genotype filial generation
If the matched parent genotypes are the same genotypes and each locus is not a heterozygous Genotype, the offspring insects can be kept as the specific homozygous Genotype offspring, and the homozygous offspring of the genotyp 1, the genotyp 2 and the genotyp 3 of the brown planthopper field population are obtained according to the specific homozygous Genotype offspring.
6. Determination of resistance level of different rice varieties to three genotype homozygous progeny
The resistance levels of rice varieties IR36 and RathuHeenati (R.H.) to homozygous progeny of different genotypes of brown planthopper are determined by honeydew method by taking an insect-susceptible variety TN1 rice as a control.
The honeydew method detection comprises the following specific operation steps: transferring a single rice seedling plant of a rice variety 30 days after sowing into a plastic cup (15cm multiplied by 10cm), removing tillers, leaving a main stem, inoculating the brown planthopper adult hunger for 3 hours into the small wax film bags by using a suction pipe, connecting 1 female insect in each small wax film bag, wrapping the small wax film bags on each treated rice plant, and repeating 5 times each treatment. The wax film pouch was weighed with an electronic balance prior to inoculation. And taking off the small wax film bag after 24 hours, and weighing again, wherein the difference of the two masses is the honeydew secretion amount of the brown planthopper respectively. The resistance of the rice variety to the brown planthopper individual can be determined according to the honeydew secretion amount of the brown planthopper after eating the specific rice variety.
The evaluation results are shown in fig. 2, the individuals with brown planthopper have the highest honeydew secretion amount after eating the control variety TN1, and the differences among different genotypes are not obvious, and the control variety TN1 is proved to have no resistance to the brown planthopper of three genotypes. The candidate pest-resistant variety IR36 has high resistance to brown planthopper of Genotype1, but is weak to brown planthopper of Genotype2, and thus it can be considered to have no applicability in the field. Candidate insect-resistant variety R.H. has higher resistance to all three genotypes of brown planthopper, so the candidate insect-resistant variety R.H. can be used as an effective insect-resistant variety, but the honeydew quantity of the brown planthopper of Genotype2 for eating the R.H. is obviously higher than that of the brown planthopper of Genotype1, which indicates that the R.H. variety has the risk of insect resistance failure in the future, and the result is consistent with the research result of Zhang et al (Zhang, Xiaohanxiang, Liyanfang, and the like; resistance identification of the resource of the brown rice planthopper resistant variety of the International Rice research institute and resistant strain screening [ J ]. Guangdong agriculture, 2011(21): 28-30.).
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<120> method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cattattcat acagatttga tggagag 27
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cactaggtgt caaatctaca aacc 24
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcgaaggtga gttgtttgtt ttgt 24
<210> 4
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agccctaaag agaaaagaga caatgt 26
<210> 5
<211> 845
<212> DNA
<213> Brown planthopper (Nilaparvata lugens)
<400> 5
atcgaaggtg agttgtttgt tttgttcaat cgttatatcg tattatctca ttgctacggt 60
tagttggtaa cagtactgtg taggacgcaa atgaaagaac tacgtctgaa caaaagatag 120
agtcaaatgc tgccggtttc tgtccaacta aaaattccag tcaaacttca cctataccgg 180
tgctgtagtt gtgttcagaa ctattcaatt tggaagaaaa atagcacaag gactacctta 240
taattttatc taccaatgta atagcattag tgtcatttgc attgtaaata aataaaaaat 300
agataaaata aaataacctt gaatgtttta tgtatcacac ataaatgatt cttttataat 360
ctaaatttgt gagtggaata tcaaagagct cgtctgtttt ttgttctttc aatatgattt 420
tgatgataaa taattttgca cttatgaata catgaatacc gtaactttat tattagagat 480
aatccatagt tactagtcag attcatttat aatagtcgta ataaataaac gatgactgca 540
agtgtattac tcatatttat tgaacattgt ctcttttctc tttagggcta cttttgaata 600
taaataaaca tataaatcta agtacccctt tcaaaattat aataaatttt aattttaaat 660
acggtatcta cttggattta tatgtttatc tattgaacat tatttgaagc catttaaaca 720
tgtataaggg agctgaatgt caagttgcta tagcatattt taatttgacc catttaaatt 780
ttgactcatg tttcaatttt tggaaaatta aacaatatca cgcttcaact tatgcatgat 840
accag 845
<210> 6
<211> 999
<212> DNA
<213> Brown planthopper (Nilaparvata lugens)
<400> 6
tatttttttt caagtaccta cagtatataa ttaatttatt ttctccatgt tgtccatatg 60
tgatacataa ttattataaa atgaatattg tttgctatgc gactactccc cgcacacgga 120
catgtcatcc aaattgggag cctatgatca tatttattaa ttttatgtaa atttcattgt 180
attttaaatg aatgaataaa tttaatttga tttgatttga atattttttt caaaaataaa 240
tttaaaaaat attaagatgt gtactctctc tacttgacat aatcagtagc gtattaccaa 300
acaagattat tgtttttttt ttcaaattct atgcaaatct tcctcattat tcatacagat 360
ttgatggaga gcctatatat cacacacatg gaaagaaaga gaggaatttc aattcggaga 420
ttcaatcgac gattgtacgg aatggagata taacatcagt gcacacaatc aggttaactg 480
cgaaatgcgt tgcagatttg aaagaatggc ccagagatag ggccacgtgt gaagctttca 540
ttggtgctca agctattcag aatatcaatt taacatctta ccatgacgag gtacgtaaga 600
taatatttat gaaatgttaa ttaaatagaa tagcatatat attgttgaaa atttatttcc 660
atttttttcg gattggattc tacgcgggtt tgtagatttg acacctagtg aaatcgaacc 720
cccaatttaa tgagtagaat ggagaaaatg atatttggaa agaatatttt attaacttta 780
ttcgtttatc attgtgttct attactagtc gtaaaatatc attgtgggag acatttttat 840
tagacacggt aactgagtta tttttgtatt aataggatga aaattttgga aataaaaaga 900
aaagatttat tctccacaat tgaatcgcaa gcacaggaga caactgattg tgttcagtga 960
cttctgtagg agtaacctga atagattacc tgaatgctt 999
Claims (10)
- The application of the combination of the polymorphic sites 88-254-352-542 of the brown planthopper cytochrome P450CYP4C61 gene shown in SEQ ID NO.5 and the polymorphic site 576-580 of the nAChR-alpha-7-like gene shown in SEQ ID NO.6 in identifying the pest causing genotype of the brown planthopper, preparing a pest causing genotype identification kit or evaluating the potential applicability of pest-resistant rice varieties is characterized in that the relationship between the polymorphic site combination genotype and the pest causing genotype of the brown planthopper is shown in the following table:
wherein Genotype1 is a non-deleterious Genotype, and Genotype2 and Genotype3 are deleterious genotypes. - 2. A kit for identifying the harmful genotype of brown planthopper, which comprises a reagent for detecting the genotype of the polymorphic site according to claim 1.
- 3. A method for identifying the pest causing genotype of brown planthopper, which is characterized by comprising the following steps:s1, extracting genome DNA of brown planthopper;s2, respectively carrying out PCR amplification on the brown planthopper cytochrome P450CYP4C61 gene and the nicotine acetylcholine receptor alpha-7-like gene by using the DNA obtained in the step S1 as a template;s3, after sequencing of the amplification products, comparing the amplification products with the table of claim 1; if the combination of the target SNP loci meets the combination characteristics of Genotype1 in the table above, the individual Genotype of the brown planthopper is non-harmful Genotype 1; if the combination of the target SNP loci meets the combination characteristics of Genotype2 in the table above, the individual Genotype of the brown planthopper is a harmful Genotype 2; if the combination of the target SNP loci meets the combination characteristics of Genotype3 in the table above, the individual Genotype of the brown planthopper is the deleterious Genotype 3.
- 4. The method according to claim 3, wherein the PCR amplification primer sequence used in step S2 is shown in SEQ ID NO. 1-4.
- 5. The method of claim 4, wherein the PCR amplification reaction used in step S2The method comprises the following steps: 20 ng/. mu.L template DNA 1. mu.L, 10. mu.M forward primer 2. mu.L, 10. mu.M reverse primer 2. mu.L, 2 XHiFi Mix 25. mu.L, ddH2O20. mu.L, 50. mu.L in total.
- 6. The method of claim 4, wherein the PCR amplification procedure of step S2 is pre-denaturation at 95 ℃ for 2 min; 30 cycles of denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40 s; finally, the extension is carried out for 5min at 72 ℃.
- 7. Use of the kit of claim 2 or the method of any one of claims 3 to 6 for assessing potential applicability of an insect-resistant rice variety.
- 8. A method for evaluating the potential applicability of an insect-resistant rice variety based on a specific injurious genotype of brown planthopper is characterized by comprising the following steps:s1, taking field population of brown planthopper captured in the field as F0 generation, and placing the brown planthopper on pest-sensitive rice variety for propagation for one generation to obtain F1;s2, after F1 grows to be an adult, pairing female adults and male adults pairwise, transferring the adult females and the male adults onto pest-sensitive rice for independent feeding, and taking away parent adults and respectively extracting genome DNA (deoxyribonucleic acid) in a single-head mode after the female and male adults are mated and lay eggs for 7 days;s3, respectively carrying out PCR amplification on the alpha-7-like gene of the nicotine acetylcholine receptor of the brown planthopper and the cytochrome P450CYP4C61 gene fragment by taking the DNA obtained in the step S2 as a template;s4, sequencing the obtained PCR product to obtain genotypes of corresponding SNPs on a CYP4C61 gene and a nAChR-alpha-7-like gene of the brown planthopper individual;s5, comparing the obtained genotypes with the table of claim 1 to respectively obtain filial generations of a non-deleterious Genotype1, a deleterious Genotype2 and a Genotype3, wherein if the matched parental genotypes are the same Genotype and each locus is not a heterozygous Genotype, the filial generations can be kept as specific homozygous Genotype filial generations;s6, respectively using homozygous progeny of the three genotypes to perform insect resistance tests on the target rice variety, and if the target rice variety has resistance to brown planthoppers of the three genotypes and the resistance level has no obvious difference among homozygous progeny of different genotypes, considering that the target variety has stable and excellent insect resistance; if the target rice variety has resistance to the brown planthoppers of three genotypes, but the resistance level to the brown planthoppers of the lethal genotypes Genotype2 and Genotype3 is obviously lower than the resistance level to the brown planthoppers of the non-lethal Genotype1, the target rice variety is considered to have insect resistance but has the risk of insect resistance failure at present; if the target rice variety has resistance to brown planthoppers of the non-lethal Genotype1 but does not have resistance to one or both of the brown planthoppers of the lethal Genotype2 and Genotype3, the target rice variety is considered to have no insect resistance applicable in the field.
- 9. The method of claim 8, wherein the insect susceptible rice variety is TN 1.
- 10. The method according to claim 8, wherein the transgenic rice susceptible to the tillering stage in step S2 is separately reared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110595081.4A CN113322331B (en) | 2021-05-28 | 2021-05-28 | Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110595081.4A CN113322331B (en) | 2021-05-28 | 2021-05-28 | Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113322331A true CN113322331A (en) | 2021-08-31 |
| CN113322331B CN113322331B (en) | 2022-07-12 |
Family
ID=77422291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110595081.4A Active CN113322331B (en) | 2021-05-28 | 2021-05-28 | Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113322331B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896281A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Molecular mark method for rice variety anti-brownspot gene site |
| WO2016165243A1 (en) * | 2015-04-13 | 2016-10-20 | 武汉大学 | Rice gene bph6 resistant to brown planthopper and closely linked molecular marker thereof |
| CN108707674A (en) * | 2018-05-30 | 2018-10-26 | 中山大学 | The method that brown paddy plant hopper group confrontation worm rice varieties IR36 causes evil power level is predicted by single nucleotide polymorphism |
| WO2021099377A1 (en) * | 2019-11-19 | 2021-05-27 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
-
2021
- 2021-05-28 CN CN202110595081.4A patent/CN113322331B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896281A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Molecular mark method for rice variety anti-brownspot gene site |
| WO2016165243A1 (en) * | 2015-04-13 | 2016-10-20 | 武汉大学 | Rice gene bph6 resistant to brown planthopper and closely linked molecular marker thereof |
| CN108707674A (en) * | 2018-05-30 | 2018-10-26 | 中山大学 | The method that brown paddy plant hopper group confrontation worm rice varieties IR36 causes evil power level is predicted by single nucleotide polymorphism |
| WO2021099377A1 (en) * | 2019-11-19 | 2021-05-27 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
Non-Patent Citations (4)
| Title |
|---|
| LEI PENG等: "Functional Study of Cytochrome P450 Enzymes from the Brown Planthopper (Nilaparvata lugens Stal) to Analyze Its Adaptation to BPH-Resistant Rice", 《FRONTIERS IN PHYSIOLOGY》 * |
| 关秀杰等: "不同致害性褐飞虱种群的DNA多态性研究", 《昆虫学报》 * |
| 刘帅等: "异色瓢虫nAChRα6基因的敲除及其对杀虫剂敏感性的影响", 《植物保护学报》 * |
| 刘晓黎: "褐飞虱细胞色素P450两个新基因CYP4C61和CYP6CW1的克隆及表达研究", 《万方学位论文数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113322331B (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Quantitative PCR genotyping assay for the Ts65Dn mouse model of Down syndrome | |
| CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
| CN106282394A (en) | The method of high throughput testing Semen Maydis south rust resistance gene type and test kit thereof | |
| CN111534579A (en) | Capture sequencing based capture probe, kit and detection method for large fragment rearrangement detection | |
| Metcalfe et al. | Flow cytometric characterisation of the complex polyploid genome of Saccharum officinarum and modern sugarcane cultivars | |
| CN109517922B (en) | InDel molecular marker closely linked with major QTL synthesized by barley P3G and C3G and application thereof | |
| EP2768969B1 (en) | Detection of viable endophyte | |
| CN113322331B (en) | Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper | |
| CN109517921B (en) | InDel molecular marker closely linked with major QTL synthesized by barley P3G and C3G and application thereof | |
| Johnston et al. | PCR detection of Hordeum bulbosum introgressions in an H. vulgare background using a retrotransposon-like sequence | |
| CN114214448A (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| CN110714093B (en) | SCAR molecular marker related to banana wilt resistance and detection method and application thereof | |
| CN108707674B (en) | Method for predicting pest-causing capacity level of brown planthopper population to resist insect rice variety IR36 through single nucleotide polymorphism | |
| CN111394491B (en) | Mushroom mating type molecular marker and application thereof in identification of mushroom mating type | |
| CN107904318B (en) | Molecular biology-based Caloglossa flavomarginata identification primer and method | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| Reid et al. | Molecular characterization of a morphologically unusual potato cyst nematode | |
| JP2964233B2 (en) | Assay method for rice brown planthopper resistance, DNA fragment and PCR marker | |
| CN109161605A (en) | The development and application of the SNP marker of rice blast resistant gene Pi1 | |
| CN107955833A (en) | A kind of dry blood cake positive quality control product of heterozygous mutant for being suitable for deaf mutator detection | |
| NL2031136B1 (en) | Set of kompetitive allele specific pcr (kasp)-based core single nucleotide polymorphism (snp) markers for eggplant and use thereof | |
| CN109486988A (en) | The method and its kit of high throughput detection Maize Resistance To Stalk Rot Genotyping | |
| CN106957907A (en) | Genetic Detection for the liver copper accumulation in dog | |
| CN109385433A (en) | Sesame leaf roll cleistocarp gene SiCL1 and its mutated gene Sicl1 | |
| Sruoga et al. | Evaluation of genetic diversity of perch (Perca fluviatilis) and pikeperch (Sander lucioperca) populations from Curonian lagoon and inshore waters of the Baltic Sea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |