CN113278613A - Application of Ptchd3 gene or protein in preparation of medicine for treating chronic glomerulonephritis - Google Patents
Application of Ptchd3 gene or protein in preparation of medicine for treating chronic glomerulonephritis Download PDFInfo
- Publication number
- CN113278613A CN113278613A CN202110573815.9A CN202110573815A CN113278613A CN 113278613 A CN113278613 A CN 113278613A CN 202110573815 A CN202110573815 A CN 202110573815A CN 113278613 A CN113278613 A CN 113278613A
- Authority
- CN
- China
- Prior art keywords
- ptchd3
- gene
- protein
- sirna
- chronic glomerulonephritis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
Abstract
The invention discloses an application of a Ptchd3 gene or protein in preparing a medicament for treating chronic glomerulonephritis, wherein the medicament targets the Ptchd3 gene or protein; and siRNA molecules for treating chronic glomerulonephritis are provided, wherein the sequences of the siRNA are shown as SEQ ID No.1 and SEQ ID No. 2. The invention discovers a molecular marker Ptchd3 related to chronic glomerulonephritis and application of an inhibitor of the marker in preparing a medicament for treating chronic glomerulonephritis; the invention provides a new thought for clinical treatment of chronic glomerulonephritis and provides a new direction for researching gene therapy of chronic glomerulonephritis.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of a Ptchd3 gene or protein in preparation of a medicine for treating chronic glomerulonephritis.
Background
Chronic glomerulonephritis is a common kidney disease, mainly occurs in bilateral renal glomeruli, and is often manifested as edema, proteinuria, hematuria, renal function decline and other symptoms. With the advancement of China into the aging society, the population suffering from nephropathy is rising at a remarkable rate. The incidence of the chronic kidney disease in China is about 10.8%, and about one third of the chronic kidney disease is chronic glomerulonephritis. During the progression of glomerulonephritis, the glomeruli, which predominate in the inflammatory response, are often associated early with marked proliferation of mesangial cells (GMCs). The abnormal proliferation of mesangial cells, the release of secondary inflammatory reaction mediators and the deposition of extracellular matrix (ECM) actively participate in the development process of glomerulonephritis, and is one of the key pathogenic links which cause glomerulosclerosis and lead the glomerular diseases to move to the final stage. Glomerulonephritis is one of the common types of disease leading to adult nephrotic syndrome, and the etiology and pathogenesis are not clear. At present, more researches suggest that the disease is chronic glomerulonephritis induced by factors such as long-term fatigue, environmental pollution, drug abuse and immune genetic tendency. Chronic kidney diseases are not easy to cure once occurring, and the kidney burden can be further increased by long-term taking of the medicine.
At present, hormones and immunosuppressants (such as cyclophosphamide, mycophenolate mofetil, tacrolimus and cyclosporine A) are commonly used in clinic, and other drugs comprise kidney-protecting and toxicity-removing drugs such as blood pressure controlling drugs, diuretics, anti-platelet aggregation drugs, lipid-lowering drugs and the like. These drugs not only have unsatisfactory therapeutic effects, but also have certain toxicity or other side effects, which cause decreased compliance of patients and easy recurrence or progression of diseases. Therefore, the method has important clinical significance for searching novel and effective therapeutic drugs with less side effects, good compliance and moderate price.
How to diagnose nephropathy and perform early intervention is a problem which needs to be solved urgently in clinic. Detection of biomarkers can enable early diagnosis of kidney disease, prognostic diagnostic assessment of patients, and patient response to treatment. Currently, biomarkers for nephritis are mainly based on detection of urine proteins in urine and related proteomic analysis. The content detection of urine microalbumin, human lipocalin 2, beta-microglobulin and the like in urine has become a main marker for evaluating kidney diseases. However, these markers may only provide diagnostic value, but do not have much impact on kidney disease progression and are not therapeutic targets. The novel dual biomarkers with diagnosis and treatment effects are searched, so that nephritis can be diagnosed at an early stage, and novel medicines for preventing and treating nephritis are researched, and the significance is great.
Disclosure of Invention
The invention aims to provide a molecular target-Ptchd 3 for diagnosing or treating chronic glomerulonephritis and application of Ptchd3 in preparing a medicament for treating chronic glomerulonephritis.
In order to achieve the purpose, the invention provides application of the Ptchd3 gene or protein in preparing a medicine for treating chronic glomerulonephritis, wherein the medicine targets the Ptchd3 gene or protein.
Preferably, the Ptchd3 gene is up-regulated in chronic glomerulonephritis tissues or cells.
Further, the invention provides application of an inhibitor of Ptchd3 in preparing a medicament for treating chronic glomerulonephritis, wherein the inhibitor is selected from siRNA, dsRNA, shRNA, micro RNA and antisense nucleic acid which takes Ptchd3 protein or a transcript thereof as a primer sequence and can inhibit protein expression or gene transcription of the protein; or a construct capable of expressing or forming said siRNA, dsRNA, microRNA, antisense nucleic acid.
Further, the invention provides a medicament for treating chronic glomerulonephritis, wherein the main active ingredient of the medicament is an inhibitor of Ptchd 3; the medicament also comprises a pharmaceutically acceptable carrier.
The medicaments of the invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. Oral administration or injection administration is preferred.
The medicament of the invention can also be used in combination with other medicaments for treating chronic glomerulonephritis, other therapeutic compounds being able to be administered simultaneously with the main active principle, even in the same composition. Other therapeutic compounds may also be administered alone in a composition or dosage form different from the main active ingredient.
Further, the present invention also provides the use of an inhibitor of Ptchd3 in the preparation of an agent for inhibiting chronic mesangial cell proliferation;
the inhibitor is selected from siRNA, dsRNA, shRNA, micro RNA and antisense nucleic acid which takes Ptchd3 protein or transcript thereof as a binding sequence and can inhibit protein expression or gene transcription thereof; or a construct capable of expressing or forming said siRNA, dsRNA, microRNA, antisense nucleic acid.
Preferably, the siRNA sequence is shown as SEQ ID NO.1 and SEQ ID NO. 2.
Furthermore, the invention provides an siRNA molecule for treating chronic glomerulonephritis, wherein the siRNA sequence is shown in SEQ ID NO.1 and SEQ ID NO. 2.
Preferably, the siRNA is capable of reducing expression of the Ptchd3 gene or protein in a cell.
Still further, the invention provides an application of the Ptchd3 gene or protein in screening a candidate drug for preventing or treating chronic glomerulonephritis, wherein the candidate drug can reduce the expression level or activity of the Ptchd3 gene or protein.
Preferably, the step of screening the candidate drug is as follows:
(1) constructing a cell or animal model of chronic glomerulonephritis;
(2) treating the model with a candidate substance;
(3) detecting the expression condition of the Ptchd3 gene or protein in the model sample;
(4) and (4) judging a result: the candidate substance can reduce the expression of the Ptchd3 gene or protein and improve renal function and pathological injury of the kidney, and the candidate substance is indicated to be a candidate drug for preventing or treating chronic glomerulonephritis.
Preferably, the chronic glomerulonephritis animal model is an immune rat membranous glomerulonephritis model. Preferably, the chronic glomerulonephritis cell model is LPS-induced mesangial cells (HBZY-1).
Preferably, the method for detecting in step (3) comprises a real-time fluorescent quantitative PCR method; the primers used for detecting the expression of the Ptchd3 gene are shown as SEQ ID NO.3 and SEQ ID NO. 4.
Advantageous effects
The invention discovers that the expression of the Ptchd3 gene is related to chronic glomerulonephritis for the first time; after the expression of Ptchd3 in the mesangial cell strain is knocked down by using the siRNA technology, the mesangial cell shows reduced cell proliferation, so that a drug aiming at the Ptchd3 target gene can be designed and synthesized for treating chronic glomerulonephritis; the invention also discloses an application of the inhibitor-siRNA of the Ptchd3 gene in preparing a medicament for treating chronic glomerulonephritis; the invention provides a new thought for clinical treatment of chronic glomerulonephritis and provides a new direction for researching gene therapy of chronic glomerulonephritis.
Drawings
FIG. 1 HE staining and Masson staining results;
FIG. 2 shows the expression of Ptchd3 gene in the model of membrane glomerulonephritis in immune rats;
FIG. 3 change in expression of Ptchd3 mRNA after stimulation of mesangial cells by LPS;
FIG. 4 expression of Ptchd3 mRNA after transfection of mesangial cells with siRNA;
FIG. 5 MTT measures the proliferative changes of mesangial cells after siRNA transfection.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
The invention searches for molecular targets related to chronic glomerulonephritis by constructing an immune rat membranous glomerulonephritis model; further researching the action mechanism of the target on chronic glomerulonephritis from cell level and molecular level, providing experimental basis for clinical application of the target and a target inhibitor to treat nephritis diseases, and providing help for further discussing the mechanism of treating nephritis diseases.
In the present invention, RNA interference (RNAi) refers to a highly conserved phenomenon of highly efficient and specific degradation of homologous mrnas induced by double-stranded RNA (dsRNA) during evolution. To ensure that genes can be efficiently knocked out or silenced, siRNA-specific fragments were designed based on the mRNA sequence of the gene. The design of siRNA was accomplished by an in-line tool according to published general design principles (Elbashir et al 2001, Schwarz et al 2003, Khvorova et al 2003, Reynolds et al 2004, Hsieh et al 2004, Ui-Tei et al 2004) which was: siRNA Selection Program of Whitehead Institute (Bingbingyuan et al 2004, http:// jura. wi. mit. edu/bioc/siRNAext /) and BLOCK-iTTMRNAi Designer of INVITROGEN(winner of the 2004Frost&Sullivan Excellence in Research Award，https：//rnaidesigner.invitrogen.com/sirna/)。
Statistical methods used in the present invention:
experimental data on
The metrology data was examined using one-way anova, and analyzed using SPSS 16.0 statistical software.
Example 1 model of immune rat membranous glomerulonephritis
1. Preparation of antigen cationized bovine serum albumin (C-BSA)
Natural bovine serum albumin fraction V: electrophoretically pure, isoelectric point 4.5, Ameresco; carbodiimide (EDC): beijing chemical reagents Inc.; anhydrous Ethylenediamine (EDA): analytically pure, Beijing Chemicals, Inc.
Referring to the Border method [ Border WA, Ward HJ, Kamil ES, et al.Induction of molecular neuropathies in nanoparticles by administration of an exogenous cationic antigen.J. Clin Invest, 1982, 69: 451-461 ], adding 67mL of EDA into 500mL of double distilled water, slowly adding 350mL of 6M hydrochloric acid, adjusting the pH value to 4.75, cooling the solution to 25 ℃ on ice, dissolving 5g of BSA into 25mL of double distilled water, slowly adding the solution into the EDA solution, continuously stirring, adding 1.8g of EDC, reacting for 2 hours at constant temperature of 25 ℃, and terminating the reaction by 30mL of acetic acid buffer solution with pH4.75 to obtain the C-BSA solution with improved isoelectric point. Dialyzing with double distilled water at 4 deg.C for 48h (changing water every 8 hr), freeze drying to obtain C-BSA powder with isoelectric Point (PI) of above 8.4, and storing at-70 deg.C.
2. Making of models
The experimental animals are healthy female Sprague-Dawley rats with the weight of 160-180 g provided by Beijing Wintoli Hua. After 3 days of acclimatization, randomized into 2 groups: pathological groups 6 were used to replicate the nephritis model with C-BSA; the normal control group was 4, and was normally kept without any treatment.
With reference to the Border method, pre-immunization (prime immunization): 1.5mg of C-BSA was dissolved in 0.5mL of physiological saline, and mixed with 0.5mL of Freund's incomplete adjuvant to prepare "water-in-oil", which was used for subcutaneous multipoint injection for pre-immunization, and C-BSA was injected daily after 1 week. Intraperitoneal injection is carried out for 1 week, the doses from day 1 to day 7 are 0.5mg, 1mg, 2mg and 2.5mg in sequence, and then tail vein injection is carried out for 6 weeks. The doses on days 1 to 7 of the tail vein injection were 2.5mg, 3mg, 4mg, 5mg in this order, and thereafter 5mg daily until the end of the test.
3. Identification of rat model
Renal function examination: quantitative determination of urine protein. Urine protein content was determined every 2 weeks for 24h 1 time after intravenous injection of C-BSA. ② measuring serum creatinine, urine creatinine and serum urea nitrogen. After 6 weeks of intravenous injection, 2 groups of rats were each bled from the vein in the eye veins, centrifuged to obtain serum, and assayed for content using the assay kit.
And (3) morphological observation: two groups of rats were sacrificed after intravenous injection of C-BSA6 to take kidneys, rat body weight and kidney weight were weighed, organ coefficients were calculated, and formalin-fixed kidneys were kept ready for use and observed as follows: fixing renal cortex with 20% formaldehyde, dehydrating with ethanol, embedding in paraffin, making into 3 μm slices, performing HE and PAM-Masson staining, and observing with light microscope.
4. Results
Renal function examination:
(1) and (3) urine protein determination: after intravenous injection of C-BSA for 2 and 4 weeks, proteinuria occurred in some of the rats in the pathological group, and by the end of week 6, all rats showed more pronounced proteinuria except individually. The normal control group rats had no obvious proteinuria. The results are shown in Table 1.
(2) Serum creatinine, urine creatinine and serum urea nitrogen determination: after 6 weeks of intravenous injection of C-BSA, there was no significant change in the pathological blood, serum creatinine and serum urea nitrogen. The results are shown in Table 1.
(3) Organ coefficient: after 6 weeks of intravenous injection of C-BSA, the organ coefficients of pathological groups are obviously increased. The results are shown in Table 1.
And (3) morphological observation:
and (3) observation by using a light mirror: the results after 6 weeks of intravenous C-BSA, HE staining of kidney sections and Masson staining are shown in fig. 1:
normal control group: the glomerulus size, number, distribution state and renal tubular epithelial cells are not abnormally changed. The glomerular capillary endothelial cell count and mesangial cell count were mostly around 100, with an average of 93.30 ± 15.14(n ═ 10).
Tail vein injection of C-BSA, 6-week-old rat immune nephropathy model group: in 6 rats, 4 rats suffered from obvious lesion in kidney, and in addition, 2 rats suffered from mild lesion or no obvious lesion in kidney. The kidney lesion characteristics of the kidney are mainly characterized in that glomerular capillary endothelial cells and mesangial cells are proliferated diffusely, glomeruli are enlarged and deeply stained, some glomerular cystic stenosis, occlusion and adhesion exist, the number of the proliferated cells is at most 4 times of the number of normal glomerular cells, the average number is 285.10 +/-31.90 (n is 4), and the difference is very obvious compared with the number of the normal glomerular cells (p is less than 0.001). The PASM staining showed, in addition to endothelial and mesangial cell proliferation, thickening of the glomerular basement membrane, broadening of the mesangial zone, deposition of the rhodopsin, and significant narrowing or occlusion of the capillary lumen. No obvious pathological changes are found in renal tubular epithelial cells, renal pelvis mucous membrane, renal arteriole and the like.
The result identification proves that the rat membranous glomerulonephritis model is successfully established.
Example 2 tissue RNA extraction
The RNA extraction was carried out on 4 successfully established immune rat membranous glomerulonephritis models and 4 normal control rats.
1. Preparation of RNA
(1) Directly mashing 100mg of spleen tissue, adding 1mL of Trizol, repeatedly sucking for more than 20 times, fully lysing cells, and centrifuging at 12000r/min at 4 deg.C for 10 min.
(2) Transferring the supernatant into a new 1.5mL RNase-free EP tube, adding 100. mu.L chloroform, covering the lid, turning upside down, mixing for 15s, standing for 2min, and allowing it to separate into layers.
(3) Centrifuging at 12000r/min at 4 deg.C for 10min, and sucking the upper water phase containing total RNA into a new centrifugal tube for removing RNA enzyme.
(4) Adding equal volume of isopropanol, turning upside down, mixing for 15s, and standing on ice for 10 min.
(5) Centrifuging at 12000r/min at 4 deg.C for 10min, allowing part of the sample to be colloidal at the bottom of the tube, and discarding the supernatant.
(6) Adding 0.5mL of 75% ethanol, reversing, uniformly mixing, and washing RNA; centrifuging at 4 deg.C 12000r/min for 5min, removing ethanol, and standing at room temperature for 15min for 2 times.
(8) Adding 50-100 μ L RNase-free water, flicking the tube wall to dissolve RNA sufficiently, and storing at-80 deg.C.
2. RNA integrity and purity testing
Integrity: RNA integrity was checked by normal agarose gel electrophoresis (electrophoresis conditions: 1.2% gel; 0.5 XTBE electrophoresis buffer; 150v, 15 min). The maximum rRNA brightness in RNA samples should be 1.5-2.0 times the brightness of the next largest rRNA, otherwise this indicates degradation of the RNA sample. The appearance of diffuse flakes or disappearance of bands indicated severe degradation of the sample.
Purity: the OD260/OD280 ratio is an index for the degree of protein contamination in the RNA sample. High quality RNA samples with OD260/OD280 ratio (10mM Tris, ph7.5) around 2.0. The subsequent experiments can be carried out.
Example 3 transcriptome sequencing
1. Library construction sequencing
Firstly, extracting total RNA of a sample, and carrying out RNA quality detection; then for digestion of ribosomal RNA using TruSeq Stranded Total RNA with Ribo-Zero Gold kit, adding an interrupting agent to break the RNA into short fragments; taking broken RNA as a template, synthesizing single-strand cDNA by using a six-base random primer, preparing a double-strand synthesis reaction system to synthesize double-strand cDNA, replacing dTTP with dUTP during cDNA double-strand synthesis, connecting different joints, and digesting one strand containing dUTP by using a UNG enzyme method to only reserve one strand of the cDNA connected with the different joints of the strand; purifying one strand of cDNA by using a kit; carrying out end repair, tail A adding and sequencing joint connection on a purified cDNA chain, then carrying out fragment size selection, and finally carrying out PCR amplification; the constructed RNA library was qualified by Agilent 2100Bioanalyzer quality testing and then sequenced using an Illumina sequencer. This part was entrusted to Shanghai Europe and Yi biomedical science and technology Limited.
2. Quality control and comparative analysis
And (4) obtaining clearreads used for subsequent analysis through sequencing error rate inspection, GC content distribution inspection and original data filtration, and summarizing data. The original data obtained by sequencing contains a small amount of reads with sequencing joints or low sequencing quality, and in order to ensure the quality and reliability of data analysis, 20 times of filtering the original data are needed, and the filtering content is as follows: (1) linker removal (Adaptor); (2) removing reads with N bases; (3) reads with low sequencing quality are removed. Clean reads were aligned to the reference genomic sequence using TopHat2 software.
3. Differential gene expression analysis
The transcript expression was calculated by FPKM (FragmentsPeer kb Per Million Reads) as the number of fragments Per kilobase Per Million fragments from a transcript. FPKM considers the influence of sequencing depth and transcript length on fragments counting, and is the most common method for estimating the expression level of the transcripts at present. The FPKM method can eliminate the influence of the length of the transcript and the difference of sequencing quantity on the expression of the calculated transcript, and the expression quantity of the calculated transcript can be directly used for comparing the expression difference of the transcript among different samples.
The method comprises the steps of standardizing the counts number of transcripts of each sample by using DESeq software (estimating expression quantity by using basemean value), calculating the difference multiple, carrying out difference significance test on the reads number by using NB (negative binomial distribution test), and finally screening difference genes according to the difference multiple and the difference significance test result.
When using RNA-seq data to comparatively analyze whether the same gene in two samples is differentially expressed, two criteria can be selected: one is FoldChange, which is the fold change of the expression level of the same gene in two samples; secondly, the calculation method of the FDR value is to calculate p-value of each mRNA and then carry out multiple hypothesis test correction on the p-value by using an FDR error control method. The screening difference conditions are that p is less than 0.05 and the difference multiple is more than 2.
4. GO analysis and KEGG pathway enrichment analysis
Performing GO function enrichment analysis and KEGG channel enrichment analysis on the differential gene set by using clusterProfiler software. By carrying out enrichment analysis on the differential genes, the differential genes are found to be significantly related to which biological functions or pathways.
5. Results
By combining differential gene expression analysis, GO and KEGG enrichment analysis of differential expression genes and literature retrieval data to carry out deep analysis on sequencing results, the inventors finally screen out the up-regulated differential expression gene Ptchd3 which is possibly a key molecule causing chronic glomerulonephritis.
Example 4 real-time fluorescent quantitative PCR verification of expression of Ptchd3 Gene
The expression of the Ptchd3 gene in an immune rat membranous glomerulonephritis model is further verified to be up-regulated by real-time fluorescent quantitative PCR (polymerase chain reaction).
1. Firstly, extracting total RNA of a sample, and carrying out RNA quality detection.
2. Reverse transcription to synthesize cDNA
2.1 first Strand cDNA Synthesis kit (RevertAID Premium Reverse Transcriptase) (Thermo Scientific)TM EP0733)
2.2 first Strand cDNA Synthesis
(1) The following reagents were added to ice-bath nucleo-free PCR tubes:
(2) gently mixing, centrifuging for 3-5 s, performing warm bath on the reaction mixture at 65 ℃ for 5min, performing ice bath for 2min,
and then centrifuging for 3-5 s.
(3) The tube was ice-cooled and the following reagents were added:
4.0μL 5*RT Buffer
0.5μL Thermo Scientific RiboLock RNase Inhibitor(20U)
1.0μL RevertAid Premium Reverse Transcriptase(200U)
(4) gently mixing and centrifuging for 3-5 s
(5) Reverse transcription reaction was performed on a PCR instrument under the following conditions
Incubating at 25 deg.C for 10min
② cDNA synthesis at 50 ℃ for 30min
③ terminating the reaction at 85 ℃ for 5min, placing on ice after treatment
(6) The solution was stored at-20 ℃.
3、Real-Time PCR
On-line primer design software, Ptchd3 gene sequence was referenced ENSRNOG 00000046946; GAPDH was selected as an internal control, and primers were designed and synthesized by Shanghai Biotech. The specific primer sequences are as follows:
Ptchd3：
SEQID NO.3CAGAACTCGTCGCTGAACCT；
SEQID NO.4GTCGAGGAAGTGAGTCAGCC；
GAPDH：
SEQID NO.5TGGGTGTGAACCATGAGAAGT；
SEQID NO.6TGAGTCCTTCCACGATACCAA。
the operation process is as follows:
the reaction system is shown in Table 1, using Power
Amplification is carried out by Green PCR Master Mix, and the experimental operation is carried out according to the product instruction. The amplification procedure was: pre-reacting at 95 ℃ for 3 min; amplification reactions were performed for 45 cycles at 95 ℃ for 3s and 60 ℃ for 30 s.
TABLE 1 Real-Time PCR reaction System
| Components | Amount of |
| 2×mix | 10μL |
| Upstream primer (10uM) | 0.4μL |
| Downstream primer (10uM) | 0.4μL |
| Form panel | 2μL |
| Adding sterilized distilled water | To 20 μ L |
Diluting cDNA of each sample by 10 times, and taking 2 mu L as a template; the PCR reaction was carried out in an ABI Stepone plus type fluorescent quantitative PCR instrument.
4. Results of the experiment
According to a relative quantitative formula of qRT-PCR, the expression levels of the Ptchd3 gene in an immune rat membranous glomerulonephritis model group and a control group are compared. The results are shown in fig. 2, the expression level of the Ptchd3 gene in the membranous glomerulonephritis model group is higher than that of the control tissue, and the results prove that the transcriptome sequencing analysis obtains the result that the Ptchd3 gene is highly expressed in the membranous glomerulonephritis model.
Example 5 RNAi expression of the Ptchd3 Gene in rat mesangial cells
The main pathological changes of chronic nephritis are proliferation of mesangial cells (GMC) and extracellular matrix increase, which can lead to tubulointerstitial fibrosis and glomerulosclerosis, which are mesangial cells, and finally renal failure.
1 Experimental materials and methods
1.1 cell lines and reagents
Normal rat mesangial cell strain (HBZY-1) purchased from China Center for Type Culture Collection (CCTCC); lipopolysaccharide (LPS) and MTT kit are purchased from sigma company of America; DMEM medium was purchased from Gibco, USA; fetal Bovine Serum (FBS) was purchased from hangzhou siji serum company; an in situ apoptosis kit purchased from Biotech limited of Beijing Sizhengbai; NC-siRNA was purchased from Shanghai Producer.
1.2 cell culture
Rat mesangial cells at 2X105The cells/well were plated in 6-well plates using low sugar DMEM medium containing 10% (v/v) fetal calf serum, 100U/mL penicillin and 100U/mL streptomycin at 37 deg.C with 5% CO2And (5) culturing in an incubator.
Cells were divided into 2 groups: control group (normal HBZY-l cells) and LPS group (HBZY-l cell proliferation induced by LPS 1. mu.g/mL).
1.3 transfection of cells
The cells were arranged at 2X10560% of cells are inoculated in each hole of a 6-hole culture plateIn fusion, siRNA (Ptchd3-siRNA, negative control NC-siRNA) and equal amount of Opti-MEM and liposome Lipofectamine2000 were mixed according to the instructionsTMMixing, adding in serum-free Opti-MEM culture solution for incubation, and after 6 hours, replacing with low-sugar DMEM culture solution for incubation. After 24h, the expression of the enhanced red fluorescent protein in the cells is observed through a fluorescence inverted microscope, and the transfection efficiency is determined. The cells of each group were collected and the interference efficiency of siRNA was determined by PCR.
The Ptchd3-siRNA sequence is as follows:
SEQID NO.15’CAGCTACCTTTGCAGAAGTCA3’；
SEQID NO.25’GCTCGATCAATTTACCAACAT3’.
1.4 cell proliferation assay
At 5X 103Each cell/well is planted in a 96-well culture plate, and the cells are cultured in low-sugar DMEM culture solution until the cells are fused to 60%. Grouping cells: normal control group, LPS group, negative transfection group LPS + NC-siRNA, LPS + Ptchd3-siRNA transfection group, each group set 3 multiple holes. After 48h of cell intervention, the medium was discarded, 20. mu.L (5g/L) of MTT was added, and the cells were incubated at 37 ℃ for 4 h. Terminating the culture, removing the culture supernatant in each well, adding 150 μ L of dimethyl sulfoxide into each well, and shaking for 10min in dark. The absorbance value (OD) was measured at 490nm using a microplate reader.
2 results
2.1 expression Change of Ptchd3 after stimulation of cells with LPS
The fluorescent quantitative PCR result shows that the relative expression level of the Ptchd3 mRNA in the LPS group cells is obviously increased compared with the control group, and the difference has statistical significance (P is less than 0.05). See fig. 3.
2.2 transfection and determination of siRNA interference efficiency
The real-time fluorescent quantitative PCR method is used for detecting the expression of Ptchd3 in mesangial cells, compared with the Con and NC-siRNA groups, the expression of Ptchd3-siRNA transfection group Ptchd3 mRNA is obviously reduced, and the difference has statistical significance (P is less than 0.05). The Ptchd3-siRNA can reduce the expression level of the Ptchd3 gene. See fig. 4.
2.3 changes in mesangial cell proliferation following siRNA transfection
MTT results show that compared with a control group, after LPS induction, the glomerular mesangial cells are remarkably proliferated, and the difference has statistical significance (P is less than 0.05). Compared with the LPS group, the proliferation of the glomerular mesangial cells in the LPS + Ptchd3-siRNA group is remarkably reduced, and the difference has statistical significance (P is less than 0.05). See fig. 5.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing university of science and technology
Application of <120> Ptchd3 gene or protein in preparation of medicine for treating chronic glomerulonephritis
<141> 2020-06-15
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> human
<400> 1
cagcuaccuu ugcagaaguc a 21
<210> 2
<211> 21
<212> RNA
<213> human
<400> 2
gcucgaucaa uuuaccaaca u 21
<210> 3
<211> 20
<212> DNA
<213> human
<400> 3
cagaactcgt cgctgaacct 20
<210> 4
<211> 20
<212> DNA
<213> human
<400> 4
gtcgaggaag tgagtcagcc 20
<210> 5
<211> 21
<212> DNA
<213> human
<400> 5
tgggtgtgaa ccatgagaag t 21
<210> 6
<211> 21
<212> DNA
<213> human
<400> 6
tgagtccttc cacgatacca a 21
Claims (10)
- The application of the Ptchd3 gene or protein in preparing a medicament for treating chronic glomerulonephritis, wherein the medicament targets the Ptchd3 gene or protein.
- 2. The use of claim 1, wherein the Ptchd3 gene is up-regulated in chronic glomerulonephritis kidney tissue or damaged podocytes, mesangial cells and tubular epithelial cells.
- The application of an inhibitor of Ptchd3 in preparing a medicament for treating chronic glomerulonephritis is disclosed, wherein the inhibitor is selected from siRNA, dsRNA, shRNA, micro RNA and antisense nucleic acid which take Ptchd3 protein or a transcript thereof as a binding sequence and can inhibit protein expression or gene transcription of the protein; or a construct capable of expressing or forming said siRNA, dsRNA, microRNA, antisense nucleic acid.
- Use of an inhibitor of Ptchd3 in the preparation of an agent for inhibiting mesangial cell proliferation and tubular epithelial cell fibrosis under chronic inflammatory stimuli;the inhibitor is selected from siRNA, dsRNA, shRNA, micro RNA and antisense nucleic acid which takes Ptchd3 protein or transcript thereof as a binding sequence and can inhibit the protein expression or gene transcription; or a construct capable of expressing or forming said siRNA, dsRNA, microRNA, antisense nucleic acid; or a chemical small molecule compound which can inhibit the biological activity of the compound after in vitro activity screening.
- 5. The use of claim 3 or 4, wherein the siRNA has the sequence shown in SEQ ID No.1 and SEQ ID No. 2.
- 6. An siRNA molecule for treating chronic glomerulonephritis is characterized in that the siRNA sequence is shown as SEQ ID No.1 and SEQ ID No. 2.
- 7. The siRNA of claim 6, being capable of reducing expression of the Ptchd3 gene or protein in a cell.
- Use of the Ptchd3 gene or protein in the screening of a candidate drug for the prevention or treatment of chronic glomerulonephritis, said candidate drug being capable of reducing the expression level or activity of the Ptchd3 gene or protein in a cell or tissue.
- 9. The use of claim 8, wherein the step of screening for a drug candidate comprises:(1) constructing a cell or animal model of chronic glomerulonephritis;(2) treating the model with a candidate substance;(3) detecting the expression condition of the Ptchd3 gene or protein in the model sample;(4) and (4) judging a result: the candidate substance can reduce the expression of the Ptchd3 gene or protein, and the candidate substance is a candidate drug for preventing or treating chronic glomerulonephritis.
- 10. The use of claim 9, wherein the detection method in step (3) comprises real-time fluorescent quantitative PCR as shown in seq id No.3 and seq id No.4 for primers used for detecting Ptchd3 gene expression.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010542593X | 2020-06-15 | ||
| CN202010542593 | 2020-06-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113278613A true CN113278613A (en) | 2021-08-20 |
Family
ID=77281776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110573815.9A Pending CN113278613A (en) | 2020-06-15 | 2021-05-25 | Application of Ptchd3 gene or protein in preparation of medicine for treating chronic glomerulonephritis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113278613A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115044684A (en) * | 2022-06-22 | 2022-09-13 | 四川大学华西医院 | lcn2 gene as biomarker for detecting whether Stat5 gene is deleted |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2018148863A (en) * | 2017-03-14 | 2018-09-27 | 国立大学法人三重大学 | Genetic risk detection for kidney related disease |
| JP2018157776A (en) * | 2017-03-22 | 2018-10-11 | 国立大学法人三重大学 | Method for detecting hereditary risk of metabolic disease |
-
2021
- 2021-05-25 CN CN202110573815.9A patent/CN113278613A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2018148863A (en) * | 2017-03-14 | 2018-09-27 | 国立大学法人三重大学 | Genetic risk detection for kidney related disease |
| JP2018157776A (en) * | 2017-03-22 | 2018-10-11 | 国立大学法人三重大学 | Method for detecting hereditary risk of metabolic disease |
Non-Patent Citations (4)
| Title |
|---|
| KAKEN: "2014年度実施状況報告書——自殺感受性遺伝子の中枢神経系における機能解析", 《HTTPS://KAKEN.NII.AC.JP/JA/REPORT/KAKENHI-PROJECT-26461718/264617182014HOKOKU/》 * |
| MARQUITTA J WHITE ET AL.: "Novel genetic risk factors for asthma in African American children: Precision Medicine and the SAGE II Study", 《IMMUNOGENETICS》 * |
| YOSHIJI YAMADA ET AL.: "Identification of C21orf59 and ATG2A as novel determinants of renal function-related traits in Japanese by exome-wide association studies", 《ONCOTARGET》 * |
| YOSHIJI YAMADA ET AL.: "Identification of five genetic variants as novel determinants of type 2 diabetes mellitus in Japanese by exome-wide association studies", 《ONCOTARGET》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115044684A (en) * | 2022-06-22 | 2022-09-13 | 四川大学华西医院 | lcn2 gene as biomarker for detecting whether Stat5 gene is deleted |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10435689B2 (en) | MicroRNA inhibition for the treatment of inflammation and myeloproliferative disorders | |
| CN107267625B (en) | Application of lncRNA as biomarker in liver cancer diagnosis and treatment | |
| EP2298359A1 (en) | Nucleic acid capable of controlling degranulation of mast cell | |
| CN110123828B (en) | Application of PRALR inhibitor in preparation of medicine for treating paclitaxel-resistant ovarian cancer | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| CN110201172B (en) | Application of YY1 expression inhibitor in preparation of medicine for treating breast cancer | |
| CN108841955B (en) | Application of C22orf41 as pancreatic cancer tumor marker | |
| CN113278613A (en) | Application of Ptchd3 gene or protein in preparation of medicine for treating chronic glomerulonephritis | |
| WO2012093384A1 (en) | Compositions and methods for treatment of ovarian cancer | |
| CN110129319B (en) | siRNA of PRALR and application thereof | |
| CN110964831A (en) | Long non-coding RNA for detecting melanoma and application thereof | |
| CN117051106B (en) | Oral squamous carcinoma related biomarker and diagnostic and therapeutic methods | |
| CN112725436A (en) | Application of human circMKLN1 gene and related product | |
| CN111020036A (en) | Application of human circ-STXBP5L and related product | |
| CN111733247A (en) | Application of long-chain non-coding RNA in cancer diagnosis and treatment | |
| CN111733248A (en) | Application of LOC158435 as biomarker for diagnosing and treating laryngeal squamous cell carcinoma | |
| CN111378755A (en) | lncRNA biomarker for liver cancer diagnosis and application thereof | |
| CN112023046B (en) | Application of miR-2115in diagnosis and treatment of atopic dermatitis | |
| CN113018440B (en) | Application of miR-7977 as drug target for inhibiting high-sugar-induced apoptosis of Ad-MSCs | |
| CN112094895B (en) | MiRNA for diagnosis and treatment of atopic dermatitis | |
| CN111235263B (en) | Target gene for diagnosis and treatment of osteoarthritis | |
| Huang et al. | LINC1810064F22Rik sequesters miR-206-5p away from HDAC4 to exacerbate allergic airway inflammation and airway remodeling in an ovalbumin mouse model of asthma | |
| CN111118139B (en) | Molecular target for osteoporosis and application thereof | |
| Jiang et al. | Overexpression of MicroRNA‐155 aggravates pulpitis by targeting kinesin superfamily Proteins‐5C based on illumina high‐throughput sequencing | |
| CN109628592B (en) | Thyroid cancer related marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210820 |