CN115044684A

CN115044684A - lcn2 gene as biomarker for detecting whether Stat5 gene is deleted

Info

Publication number: CN115044684A
Application number: CN202210762506.0A
Authority: CN
Inventors: 焦令; 牟大超; 吕晓霞; 陈思良; 马中南
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2022-06-22
Filing date: 2022-06-30
Publication date: 2022-09-13

Abstract

The invention provides an application of lcn2 gene as a biomarker in detecting whether Stat5 gene is deleted, belonging to the technical field of biology. The research of the invention finds that the expression level of lcn2 gene is closely related to whether Stat5 is knocked out. Compared with a normal mouse, the expression level of the lcn2 gene of the Stat5 knockout mouse is obviously improved. Therefore, the lcn2 gene can be used as a biomarker for assisting in judging whether Stat5 is knocked out.

Description

lcn2 gene as biomarker for detecting whether Stat5 gene is deleted

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of lcn2 gene as a biomarker in detecting whether Stat5 gene is deleted.

Background

Signal transducer and activator of transcription 5 (Stat 5) is a transcription factor in the non-receptor tyrosine kinase JAK2-Stat signaling pathway. Studies have shown that expression of Stat5 is tissue specific, with it being expressed predominantly in the arcuate nucleus of the hypothalamus. Stat5 can be activated by multiple hormones and cell growth factors, including growth hormone, interleukin 2, prolactin, etc., and can enter cell nucleus after forming dimer to play a role in promoting or inhibiting the expression of downstream genes. When Stat5 is knocked out under the condition, the mouse has the differentiation and dysplasia of lymphocytes, erythrocytes, muscle tissues, mammary tissues and the like, which proves that Stat5 plays an important role in cell growth and differentiation.

The research shows that after the Stat5 gene of a mouse is subjected to Nestin-Cre conditional knockout, the fat content of the mouse is obviously increased and is accompanied with dyslipidemia, the sensitivity of the mouse to mononuclear giant cell colony factor (GMCSF) is reduced, and the obesity tendency of the mouse cannot be prevented even if the center of the GMCSF is given for stimulation. Therefore, Stat5 is probably a key molecule for central regulation of obesity, and a novel method for losing weight is expected to be researched by utilizing a Stat5 deficient mouse model (MiR-193 b-mediated mechanism research on reduction of weight of Stat5NKO obese mice, university of traditional Chinese medicine in Nanjing, Master's academic paper). The research shows that the conditional knockout of the Stat5 gene in T cells can delay the plaque formation of an atherosclerotic mouse caused by Apoe deficiency by reducing the inflammation level and regulating the cholesterol metabolism. Stat 5-depleted CD4+ T cells can exert anti-melanoma effects through subset reconstitution of themselves and activation of Notch1 signaling. In addition, the Stat5 knockout allowed the construction of a stem cell-deficient mouse model. Therefore, the deletion of the mouse Stat5 gene by knockout of Stat5 is of great significance to various animal models and disease researches.

However, judging whether the Stat5 knockout is successful is complex, Stat5 is a transcription factor, and the expressed protein is intracellular protein, is located in cytoplasm and nucleus, is difficult to detect through body fluid such as peripheral blood, urine and the like, and is not suitable to be used as a biomarker capable of directly detecting through body fluid. Therefore, there is a need to find a biomarker that can be directly detected in body fluids (such as peripheral blood, urine, etc.) for determining or assisting in determining whether Stat5 knockout was successful, which is more convenient for determining whether the established Stat5 gene deletion model was successful.

Disclosure of Invention

The invention aims to provide application of lcn2 gene as a biomarker for detecting whether Stat5 gene is deleted or not.

The invention provides application of a reagent for detecting lcn2 gene in detecting whether Stat5 gene is deleted or not.

Further, the application of the lcn2 gene detection reagent in preparing a kit for detecting whether the Stat5 gene is deleted or not.

Further, the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene of mouse.

Further, the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in mouse tissue or body fluid.

Further, the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in peripheral blood of mouse.

Further, the detection method is an RNA sequencing method.

The invention also provides a kit for detecting whether the Stat5 gene is deleted, which comprises a reagent for detecting the lcn2 gene.

Further, the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in mouse tissue or body fluid;

preferably, the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in peripheral blood of mouse.

Further, the detection method is an RNA sequencing method.

The technical problem to be solved by the invention is to provide a biomarker which can be directly obtained from body fluid or tissues and can assist in judging whether the Stat5 gene is deleted. lcn2, it is a kind of protein in lipocalin superfamily, it has been shown in previous research that lcn2 protein in body fluid or tissue such as peripheral blood, urine, etc. can be used as biomarker of many diseases (such as tumor, metabolic syndrome, acute kidney injury, etc.), therefore lcn2 has the characteristic of easy detection in body fluid, and is easier to be used as a biomarker than direct detection of Stat 5. The invention discovers the relationship between Stat5 knockout and lcn2 gene expression quantity up-regulation through RNA sequencing, so that lcn2 can be used as a potential biomarker for judging whether Stat5 knockout is successful or not, and can also be used as a potential biomarker for reflecting Stat5 inhibitor effect, thereby having important significance for related research.

The research of the invention finds that the expression level of lcn2 gene is closely related to whether Stat5 is knocked out. Compared with a normal mouse, the expression level of the lcn2 gene of the Stat5 knockout mouse is obviously improved. lcn2 gene can be used as a biomarker for assisting in judging whether Stat5 is knocked out.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 is a schematic diagram of RNA sequencing experiment.

FIG. 2 shows Stat5 ^fl/fl Mouse and Stat5 ^CD4KO Expression level of lcn2 gene in mouse.

FIG. 3 is a ROC curve.

Detailed Description

The raw materials and equipment used in the embodiment of the present invention are known products and obtained by purchasing commercially available products.

Example 1 study of relationship between Stat5 Gene deletion and lcn2 Gene expression

First, animal model

Stat5 of the invention ^fl/fl Mice were provided by a Branch of the Cancer Science Institute of Singapore, YLL School of Medicine, National University of Singapore, Singapore. Stat5 ^fl/fl The acquisition channel of The mouse can also be found in The Jackson Laboratory, with The number of Strain # 032053-JAX. CD4-Cre ⁺ Transgenic mice were purchased from shanghai square model biotechnology development limited. All mice were of the C57BL/6 genetic background and were housed under specific pathogen-free conditions at the model animal research center of Nanjing university. All experiments were performed with 6-8 week old mice and approved by the institutional animal care and use committee of Nanjing university.

The genotype of the mice was determined by PCR using the following primers:

stat5 primer-1: GAAAGCATGAAAGGGTTGGAG (SEQ ID NO.1), primer-2: AGCAGCAACCAGAGGACTAC (SEQ ID NO.2), primer-3: TACCCGCTTCCATTGCTCAG (SEQ ID NO.3), (WT band 430 bp; Flox band 550 bp). CD4-Cre primer-1: CATGTCCATCAGGTTCTTGC (SEQ ID NO.4), primer-2: CCAGGGTCGGAGACAATAAC (SEQ ID No.5), (500 bp transgenic band).

The WT band 430bp means that one band appears at 430bp in DNA gel electrophoresis, and is a WT mouse (wild-type mouse). Similarly, the Flox band 550bp refers to a band 550bp appeared in DNA gel electrophoresis, and is a Flox mouse (Stat 5) ^fl/fl Mouse); the transgenic band of 500bp refers to a band of CD4-Cre appearing at 500bp in DNA gel electrophoresis ⁺ Transgenic mice.

Stat5 ^fl/fl Mouse and CD4-Cre ⁺ After mating of the transgenic mice, selecting the offspring genotype as Stat5 ^fl/fl 6 cases of mice (mice without knockout of Stat5 gene, but with flox sites at both ends of Stat5) with genotype of Stat5 ^CD4KO 5 cases of the mice (CD4 gene-specific knockout mice).

Detailed procedure for genotype determination:

1. solution preparation:

(1) preparing a 10% SDS solution: 50g SDS was made up to 500ml water.

(2) Preparing 1mol/l NaCl solution: 29.22g of NaCl was taken up in 500ml of water.

(3) Preparation of 0.4mol/l EDTA: 23.38g of EDTA were added to 200ml of water and the pH was adjusted to 8.

(4) Preparation of lysine solution (rat tail lysate)

1000ml：

Water was added to the reaction solution to bring the volume to 1000ml (the pH was adjusted to 11).

2. Extracting DNA of the rat tail:

(1) PK (protease K from Tritirachium album) powder, which was purchased from Galaxy organisms, for digesting proteins. 250mg were purchased at one time, all were made into 20mg/ml stock solution (1: 100 for use), and stored at 4 ℃.

(2) Preparing phenol-chloroform: mixing phenol and chloroform according to a volume ratio of 1:1 and mixing.

(3) The specific extraction steps are as follows:

(3-1) taking rat tail, adding 500 mu l of tail lysate (PK mother liquor is added into the lysate according to the volume ratio of the PK mother liquor to the rat tail lysate of 1: 100), and boiling at 55 ℃ for more than 6 h.

(3-2) adding 500. mu.l phenol-chloroform (for suction layer, in fume hood), mixing, and centrifuging at 12000r/min for 10min (taking care of standing of EP tube during centrifugation).

(3-3) taking the supernatant to a new EP tube.

(3-4) adding 2 times of volume of absolute ethyl alcohol (DNA is precipitated, isopropanol precipitation effect is better, but absolute ethyl alcohol is enough for Genotyping), mixing, and centrifuging at 12000r/min for 10 min.

(3-5) discarding the supernatant, adding 500. mu.l of 75% ethanol, mixing, and centrifuging at 12000r/min for 10 min.

(3-6) the supernatant was discarded, air-dried, and dissolved in 35 to 40. mu.l of millQ in accordance with the amount of the precipitate.

3. PCR reaction

And (3) PCR reaction system:

identification scheme:

Template DNA：1μl

Primer F：0.5μl(10μM)

Primer R：0.5μl(10μM)

2x Mix：10μl

adding dH ₂ O to 20 μ l

And (3) PCR reaction process:

after the above steps are carried out, the mouse genotype is judged according to the position of the upper end band appearing in the DNA gel electrophoresis.

Second, detection principle and method

1. Immunoblotting

Using radioimmunoprecipitation assay (RIPA): mouse spleen tissues (spleen tissues were cut with scissors after dissecting the mice and collected in an EP tube) were lysed using a buffer (50mM Tris-HCl,150mM NaCl,1mM EDTA, 1% NP-40, 0.1% SDS,1mM NaVO4,1mM NaF, pH 7.4) and disrupted using sonication. Protein quantification was performed using BCA protein quantification assay reagent (Thermo Fisher Scientific). Equal amounts of protein from each sample were loaded onto SDS-PAGE and transferred to PVDF membrane (Millipore). After blocking in TBST containing 5% BSA, the membrane was incubated with anti-STAT 5 antibody (antibody dilution ratio 1: 1000; Santa Cruz) and anti-GAPDH antibody (antibody dilution ratio 1: 1000; Santa Cruz) overnight at 4 ℃. Subsequently, the membrane was incubated with HRP-conjugated goat anti-rabbit or goat anti-mouse secondary antibody (antibody dilution ratio 1: 20000; Abclonal, China). Protein bands were visualized and quantified using chemiluminescence (ECL system; tonitrile). And judging whether the Stat5 knockout is successful.

2. Flow cytometry

Peripheral blood and spleen tissues of each group of mice are respectively taken for detection, and the method comprises the following steps:

extirpation Stat5 ^fl/fl Mouse and Stat5 ^CD4KO Bleeding the eyeball of the mouse to obtain 0.5ml of peripheral blood of the mouse; or excise Stat5 ^fl/fl Mouse and Stat5 ^CD4KO Mouse spleen, obtaining mouse spleen tissue; mouse spleen tissue and mouse peripheral blood were separately pushed into 70 μm Falcon ^TM In a cell filter (Thermo; catalog: 352350). Erythrocytes were lysed in RBC lysis buffer according to the manufacturer's protocol (BioLegend). All samples were collected in PBS containing 1% FBS and 2mM EDTA and placed on ice during staining and analysis. Cells were resuspended in 100 μ L of flow cytostaining buffer (PBS with 1% FBS). Surface antigens were stained at 4 ℃ for 1 hour and washed with flow cytostaining buffer. Cellular fluorescence was assessed using a BD LSRFortessa flow cytometer (BD Biosciences) and subpopulation percentages and MFI were analyzed by FlowJo software. The fluorescently labeled antibody used was FITC anti-mouse CD4 (eBioscience); BV421 against mouse CD4(BioLegend), from which CD4+ T cells were isolated in mouse peripheral blood and spleen.

3. RNA sequencing

3.1 schematic flow chart of experiment

The schematic diagram of the experimental flow is shown in figure 1. After the total RNA is qualified, magnetic beads connected with oligo (dT) are used for enriching eukaryotic mRNA. The extracted mRNA was randomly fragmented into short fragments by a Fragmentation Buffer, and single-stranded cDNA was synthesized using a six-base Random primer (Random hexamer) using the fragmented mRNA as a template, followed by addition of a Buffer, dNTPs, RNaseH and DNA Polymerase I for double-stranded cDNA synthesis. AMPure XP beads purification double-stranded product, utilize T4 DNA polymerase and Klenow DNA polymerase activity to repair the cohesive end of DNA to the blunt end, 3' end add base A and add the joint, AMPureXP beads carry on fragment selection, carry on PCR and amplify and obtain the final sequencing library finally. Sequencing is carried out after the quality of the library is qualified.

3.2RNA sample preparation

Animal test sample collection

a. Get Stat5 ^fl/fl Mouse and Stat5 ^CD4KO Mice, peripheral blood 0.5ml is put by removing eyeballs; or obtaining fresh spleen tissue, wherein the tissue volume is small, the length, width and height are less than or equal to 0.5cm as far as possible, considering operability, the size of the cut tissue block can refer to the size of mung bean particles, removing non-researched tissue types (such as connective tissue, adipose tissue and the like), rapidly cleaning stains on the surface of the tissue by 1 XPBS (phosphate buffered saline) or normal saline prepared by precooling RNase-Free water at 2-6 ℃, and sucking off liquid on the surface.

b. Peripheral blood or treated tissue is quickly put into a pre-cooled RNase-Free ultra-low temperature cryopreservation tube with a threaded port and a-192 ℃ resistance, wherein serial numbers are written, the tube is quickly frozen for 1 hour by liquid nitrogen and then stored at-80 ℃ for a long time, and repeated freeze thawing is avoided before RNA extraction.

c. Based on the principle of centrifugal adsorption column separation, the way in which the matrix (resin) on the column binds RNA depends on the salt ion concentration and pH of the buffer system, usually only RNA will bind to the column, and the protein will be washed into the downstream liquid phase or remain on top of the column, and then the RNA bound to the column is washed with the supplied wash solution to eliminate residual impurities, and finally the total RNA is eluted with the eluent (using LCB column chromatography; TRK-1001).

3.3 Instrument and sequencing and quality control

The invention adopts DNBSEQ-500 instrument for sequencing, and provides a desktop, high-flux, one-stop and open sequencing platform which is independently developed by Huada. And matching with an optional full-automatic library preparation system and a full-automatic sample loading system, and analyzing results from sequencing to data. The DNBSEQ-500 adopts an optimized combined probe-anchored polymerization technology (cPAS) and an improved DNA Nanosphere (DNB) core sequencing technology, and is one of leading high-throughput sequencing platforms in the industry.

Specifically, firstly, a DNA molecular anchor and a fluorescent probe are polymerized on a nanosphere, then, a high-resolution imaging system collects optical signals, and the optical signals are subjected to digital processing to obtain a sequence to be detected. Among them, DNB enhances signal by linear amplification, reducing the error rate of single copies. In addition, the size of DNB is matched with the size of active sites on the chip, and each site is combined with a DNA nanosphere, so that the utilization efficiency of the sequencing chip is improved under the condition of ensuring the sequencing precision.

On-machine sequencing was performed using a DNBSEQ-500 instrument (Huada Gene). The method comprises the following steps that raw data (raw data) generated by sequencing needs to be preprocessed, cutadapt is used for filtering out unqualified sequences to obtain effective data (clean data), and then the effective data is analyzed in the next step, wherein the specific processing steps are as follows:

a. removing reads of a tape connector (adapter);

b. removing reads containing N (N represents that base information cannot be determined) with the proportion of more than 5%;

c. removing low-quality Reads (the number of bases with a quality value Q less than or equal to 10 accounts for more than 20% of the total read);

d. and counting the original sequencing quantity, the effective sequencing quantity, Q20, Q30 and GC content, and performing comprehensive evaluation.

3.4 species-known Annotation information statistics

The reference genome alignment database is derived from:

genome:

ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_25/ GRCh38.p7.genome.fa.gz

mRNA database:

ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_25/ gencode.v25.transcripts.fa.gz

3.5 reference genome alignment

Performing reference genome comparison on the preprocessed Valid Data (Valid Data) by using Hisat, and respectively counting according to gene position information specified by a genome annotation file gtf, wherein the reference genome comparison comprises the following steps:

A. comparing sequencing data with reference genome and counting Reads;

B. a regional distribution summary of sequencing data versus reference genomes;

C. chromosome density distribution of the sequencing data aligned to the reference genome.

Hisat will distinguish reads that belong to the genome from reads that do not. The general genome alignment rate is preferably more than 60-70%, and the exon ratio is preferably more than 90%.

3.6 analysis of Total Gene expression level

The expression level of the gene is mainly measured by TPM (Transcripts per million) to measure the abundance value of the gene expression. The expression abundance of the TPM in different samples is counted for the known genes by adopting the TPM, and the expression amount of the TPM can be understood as the expression amount of the genes. Selecting expression quantities of lcn2 genes in different samples, comparing the difference of the expression quantities of the two groups by using independent sample t test, drawing a histogram, and reflecting the diagnostic value of the genes by using a receiver operator characteristic curve (ROC curve).

Third, experimental results

The invention detects the expression level of lcn2 genes in peripheral blood and spleen tissues of different mice, has consistent detection results, and obviously improves the expression level of the lcn2 genes of Stat5 knockout mice. Now, taking the results of the spleen tissue examination as an example, the following will be described: t test of an independent sample shows that the expression quantity of the lcn2 gene is in a genotype Stat5 ^fl/fl The mouse and the genotype of (1) are Stat5 ^CD4KO There was a significant difference in mice (t-6.703, p-0.000088). The histogram is shown in FIG. 2, where Stat5 ^fl/fl The representative genotype is Stat5 ^fl/fl KO denotes the genotype Stat5 ^CD4KO Mice (mice with Stat5 knockout success).

ROC curves were plotted, showing that the expression level of lcn2 gene was well differentiated between the two groups (AUC 1, p 0.006), and are shown in fig. 3.

In conclusion, the research of the invention finds that the expression level of lcn2 gene is closely related to whether Stat5 knockdown occurs. Compared with a normal mouse, the expression level of the lcn2 gene of the Stat5 knockout mouse is obviously improved. lcn2 gene can be used as a biomarker for assisting in judging whether Stat5 is knocked out.

SEQUENCE LISTING

<110> Sichuan university Hospital in western China

Application of <120> lcn2 gene as biomarker for detecting whether Stat5 gene is deleted or not

<130> GYKH1938-2022P0115560CCZR4

<150> 2022107135019

<151> 2022-06-22

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<400> 1

gaaagcatga aagggttgga g 21

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

agcagcaacc agaggactac 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

tacccgcttc cattgctcag 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

catgtccatc aggttcttgc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

ccagggtcgg agacaataac 20

Claims

1. The application of the reagent for detecting lcn2 gene in detecting whether Stat5 gene is deleted.

2. Use according to claim 1, characterized in that: the application of the reagent for detecting the lcn2 gene in preparing a kit for detecting whether the Stat5 gene is deleted or not.

3. Use according to claim 1 or 2, characterized in that: the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene of mouse.

4. Use according to claim 3, characterized in that: the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in mouse tissue or body fluid.

5. Use according to claim 4, characterized in that: the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in peripheral blood of mice.

6. Use according to claim 1 or 2, characterized in that: the detection method is an RNA sequencing method.

7. A kit for detecting whether Stat5 gene is deleted is characterized in that: it includes the reagent for detecting lcn2 gene.

8. The kit of claim 7, wherein: the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene of mouse.

9. The kit of claim 8, wherein: the reagent for detecting lcn2 gene is a reagent for detecting lcn2 gene in mouse tissue or body fluid;

10. The kit according to any one of claims 7 to 9, wherein: the detection method is an RNA sequencing method.