CN113265380B - Bacterial restriction-modification system and application thereof - Google Patents

Abstract

The invention discloses a bacterial restriction-modification system and application thereof. The restriction-modification system comprises a restriction-modification complex enzyme, wherein the restriction-modification complex enzyme consists of an R subunit and an M subunit, the R subunit is encoded by a gene c5372 (res 53), and the amino acid sequence of the R subunit is shown as SEQ ID NO. 3; the M subunit is encoded by a gene c5373 (mod 53), and the amino acid sequence of the M subunit is shown as SEQ ID NO. 4. According to the invention, the recombinant plasmid carrying the bacterial restriction-modification system is constructed and transformed into the common escherichia coli strain MG1655, so that the MG1655 can obviously resist exogenous phage infection, and the restriction-modification system can greatly improve the capability of escherichia coli in resisting phage infection. Therefore, the invention provides a new technical means for constructing engineering bacteria or live carrier vaccine bacteria of anti-phage.

Description

Bacterial restriction-modification system and application thereof

Technical Field

The invention relates to a bacterial restriction-modification system and application thereof. The invention belongs to the field of biotechnology.

Background

In bacteria, restriction-modification (RM) systems are ubiquitous and are often considered to be the most primitive immune system of bacteria for protection against foreign DNA, such as plasmids, phages, etc. Type III RM systems are typically composed of two parts: endonucleases, i.e., R subunits, are responsible for site-specific DNA cleavage; the methyltransferase, the M subunit, can methylate DNA, and its recognition site when modified is generally identical to that of endonuclease cleavage. Specifically, the recognition site of the type III RM system is a 5-6bp non-palindromic sequence, and the cleavage site is 25-27bp downstream of the recognition site. Based on RM-specific DNA recognition and cleavage properties, they are widely used for recombinant cloning, modification, etc. of DNA. For example, the type II RM system NcoI is a commonly used restriction enzyme and is widely used for molecular cloning. Type III RM systems are widely used to combat exogenous DNA transformation, conjugation, and phage infection.

Phage are a general term for viruses that infect microorganisms such as bacteria and fungi, and are widely found in soil, sewage, and air. Phage contamination seriously jeopardizes the fermentation industry of foods and the like, and is a main cause of abnormal fermentation. One of the important methods for phage contamination control is engineering sensitive strains or strain breeding, i.e., by genetic engineering or mutagenesis. For example, the introduction of plasmids carrying the RM system found in nature into lactococcus can increase its resistance to phage infection. The invention identifies a new set of RM systems in E.coli encoded by c5372 and c5373, respectively, designated res53 and mod53, respectively. The methylation site of the M subunit was found to be 5 '-CACACAG-3' by single molecule real-time sequencing analysis. The R subunit is functional and resists transformation of the plasmid into bacteria. The RM system was cloned into a vector and transformed into a common e.coli strain, which was found to be resistant to infection by T4 and λvir phages.

Disclosure of Invention

The invention aims to provide a novel bacterial restriction-modification system and application thereof.

In order to achieve the above purpose, the invention adopts the following technical means:

the invention firstly utilizes bioinformatics means such as gene function prediction, protein domain analysis and the like to preliminarily identify a novel bacterial restriction-modification system which is named as RM53 system and comprises genes c5372 (res 53) and c5373 (mod 53) for respectively encoding R and M subunits. And (3) respectively replacing mod53 and res53 genes by using a lambda Red recombination system and taking chloramphenicol resistance genes as screening markers to construct gene deletion strains CFT073 delta mod53 and CFT073 delta res53. The methylated groups of genomic DNA of wild type CFT073 and CFT073 Δmod53 mutants were analyzed using a single molecule real-time sequencing method, and Mod53 was found to be responsible for methylation of the second a in the 5'-CACAG-3' motif, thus demonstrating the methylation function of Mod53. In addition, comparing plasmid transformation efficiencies of wild-type CFT073 and CFT073 Δres53 mutants found that Res53 was responsible for cleavage of the plasmid and greatly reduced plasmid transformation efficiency, demonstrating the restriction DNA cleavage activity of Res53. A recombinant plasmid carrying an RM53 system is constructed, and the recombinant plasmid is electrically transformed and introduced into MG1655 to construct an MG1655 (+ RM 53) strain, and compared with the MG1655 strain, the RM53 system has the effect of greatly improving the capability of resisting phage infection of escherichia coli.

Thus, on the basis of the above studies, the present invention proposes a bacterial Restriction-modification (RM) system comprising a Restriction-modification complex enzyme, wherein the Restriction-modification complex enzyme consists of an R subunit and an M subunit, the R subunit being encoded by the gene c5372, the amino acid sequence of which is shown in SEQ ID No. 3; the M subunit is encoded by a gene c5373, and the amino acid sequence of the M subunit is shown as SEQ ID NO. 4.

Among them, the nucleotide sequences of the gene c5372 encoding R subunit and the gene c5373 encoding M subunit are preferably shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

Furthermore, the invention also provides a recombinant plasmid carrying the bacterial restriction-modification system, which comprises a fragment consisting of the gene c5372 encoding the R subunit, the gene c5373 encoding the M subunit and a promoter region common to the genes.

Wherein, preferably, the nucleotide sequence of the fragment consisting of the gene c5372 encoding R subunit, the gene c5373 encoding M subunit and the common promoter region is shown as SEQ ID NO. 5.

Preferably, the recombinant plasmid is constructed by the following steps:

(1) The primer sequences shown below were designed and synthesized:

Ptac-P53-RM53-F：ATGGGGCCCGCGGCCGCGGATCCGAAAGGGGCAAGCTGTAC

Ptac-P53-RM53-R：ACCAACAAGGACCATAGCATATGTACAGCATACACCCCAGC

(2) Obtaining of the insert

Using genome DNA of escherichia coli CFT073 as a template, using the synthesized primer, and carrying out PCR amplification by using Phanta mix of Nuo-wei company to obtain a fragment with homology arms and containing c5372 and c5373 genes and a promoter region common to the genes, wherein the fragment is named RM53 gene fragment, and the obtained sequence is shown as SEQ ID NO. 5;

(3) Construction and linearization of pGEN-Ptac vectors

1) Taking pGEN-mcs as an initial vector, and carrying out double-enzyme tangential linearization by using EcoRI and NdeI;

2) PCR amplification was performed using pMal-c2x as a template, lacIPtac-c2x-F/LacIPtac-c2x-R as a primer, and Phanta mix from Novain to obtain a lacI-Ptac double-element fragment with a homology arm;

LacIPtac-c2x-F：

TCATTTTCTGAAACTCTTCATGCTGGAATTCCCGACACCATCGAATGGT

LacIPtac-c2x-R：

GGCCGCGGATCCCGGTACCAAGCTTCATATGCTATGGTCCTTGTTGGTGAAG

3) Performing electrophoresis observation and rubber cutting recovery purification on the DNA product obtained in the steps 1) and 2) to obtain a standby carrier fragment and a lacI-Ptac double-element fragment with a homology arm;

4) Ligating the vector fragment obtained in step 3) with a lacI-Ptac duplex fragment having a homology arm;

5) Transferring the connection product obtained in the step 4) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

selecting a correct recombinant plasmid, naming the recombinant plasmid which is verified to be correct as pGEN-Ptac, and performing linearization by utilizing BamHI and NdeI double-enzyme digestion;

(4) Performing electrophoresis observation and rubber cutting recovery purification on the DNA products obtained in the steps (2) and (3) to obtain a standby pGEN-Ptac vector fragment and an RM53 gene fragment with a homology arm;

(5) Ligating the pGEN-Ptac vector fragment obtained in step (4) with the RM53 gene fragment having a homology arm;

(6) Transforming the ligation product obtained in the step (5) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

(7) The recombinant plasmid which is verified to be correct is obtained by PCR amplification to verify the insertion of the fragment, namely, the recombinant plasmid carrying the bacterial restriction-modification system of claim 1 or 2.

Preferably, the conversion in the step (6) is performed by an electric conversion method, and the steps are as follows: one time of electric shock at 2500V, adding 800. Mu.L of LB liquid medium to resuspend and resuscitate at 37 ℃ for 60min, centrifuging at 4000rpm for 3min, resuspending 100. Mu.L of supernatant to precipitate, spreading on LB solid medium with ampicillin concentration of 100. Mu.g/mL, and culturing overnight.

Wherein, preferably, the step (7) is performed by PCR amplification to verify the insertion of the fragment, and the specific steps include:

picking single colony, inoculating to LB liquid medium of ampicillin, shake culturing at 37deg.C for 12 hr, extracting to obtain recombinant plasmid DNA, taking the recombinant plasmid DNA as template, designing the following primers:

pMal-seq-F：TGGAATTGTGAGCGGATAAC

pGEN-seq-R：GTGGTCACGCTTTTCGTTGG

the insertion of the fragment was verified by PCR amplification under the following conditions: pre-denaturing at 95 ℃ for 5min, denaturing at 95 ℃ for 30s, annealing at 55 ℃ for 2min, extending at 72 ℃ for 5min, circularly amplifying for 30 times, and extending at 72 ℃ for 5min.

Preferably, the recombinant plasmid is named pGEN-Ptac-RM, and the nucleotide sequence of the recombinant plasmid is shown as SEQ ID NO. 6.

Furthermore, the invention also provides the application of the bacterial restriction-modification system in resisting phage infection. And

the recombinant plasmid is used for resisting phage infection.

Compared with the prior art, the invention has the beneficial effects that:

the present invention provides a novel bacterial restriction-modification system. The restriction-modification system can greatly improve the capability of the escherichia coli for resisting phage infection, and the invention provides a new technical means for constructing engineering bacteria or live carrier vaccine bacteria for resisting phage.

Drawings

FIG. 1 is a positional and domain display of the RM53 gene;

FIG. 2 shows the results of colony PCR identification of deleted strains;

wherein: cft073 Δmod53; cft073 Δres53;

FIG. 3 is a single molecule real-time sequencing to identify the methylation motif of Mod53;

FIG. 4 shows the results of plasmid transformation efficiency experiments;

FIG. 5 experimental results of RM53 system improving the ability of E.coli to combat phage infection.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. The embodiments are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

Example 1 construction of Gene-deleted strains CFT073 Δmod53 and CFT073 Δres53 Using the λRed System

The method comprises the following steps:

(1) Primers were designed and synthesized as shown in Table 1 below, and recombinant fragments Del-Mod53 and Del-res53 were obtained by PCR amplification using the Phanta high-fidelity DNA polymerase using the pKD3 plasmid as a template. The amplification conditions were: pre-denaturing at 95 ℃ for 3min, denaturing at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extending at 72 ℃ for 1min, circularly amplifying for 30 times, and extending at 72 ℃ for 10min.

TABLE 1 primer sequences

(2) About 2. Mu.g of the recombinant fragment Del-Mod53 or Del-res53 was respectively electrotransformed into CFT073 (containing pKD 46) competent cells, shake cultured at 37℃for 1 hour, and the transformant mixture was spread on LB plates containing chloramphenicol uniformly, and cultured overnight at 37 ℃.

(3) Primers were designed and synthesized, as shown in table 2 below, and colony PCR was performed to identify positive clones. The amplification conditions are 94 ℃ for 5min of pre-denaturation, 94 ℃ for 30s of denaturation, 55 ℃ for 30s of annealing, 72 ℃ for 2min of extension, and the cyclic amplification is carried out for 30 times. And then extending at 72 ℃ for 5min.

TABLE 2 primer sequences

Results: the colony PCR identification results are shown in FIG. 2. The results show that the gene deletion strains CFT073 delta mod53 and CFT073 delta res53 are constructed by using chloramphenicol resistance genes as selection markers to replace mod53 and res53 genes respectively.

Example 2 single molecule real time sequencing to identify the methylation motif of Mod53

(1) Culturing CFT073 wild type and CFT073 delta mod53 to logarithmic phase, taking 10mL of culture, centrifuging at 4000g for 10min, and collecting thallus; extracting to obtain high-purity and high-integrity genome DNA by using a TaKaRa MiniBEST Universal Genomic DNAExtraction Kit kit;

(2) Cutting about 10 mug of whole genome DNA, then selecting 10kb double-stranded DNA fragment, and carrying out end repair on the DNA fragment by using a universal hairpin joint; a 10kb sequencing library was created and sequenced on a PacBIO sequence instrument; sequencing data was analyzed using PacBio's SMRT Link software to obtain Interpulse duration (IPD) values for each base, and by comparison, the methylation sets (i.e., all modified bases and related motifs) for CFT073 WT and Δmod53 were obtained. The difference between the two strains is obtained after comparison, so that the methylation type and motif of Mod53 can be basically determined.

Results: the methylated groups of genomic DNA of wild type CFT073 and CFT073 Δmod53 mutants were analyzed using a single molecule real time sequencing method, and Mod53 was found to be responsible for methylation of the second a in the 5'-CACAG-3' motif, thus demonstrating the methylation function of Mod53, and the results are shown in figure 3.

Example 3 validation of endonuclease cleavage of DNA to affect transformation efficiency

(1) Electrotransformation competent cells of wild strain CFT073 and mutant strain CFT073Δres53 were prepared separately, each containing about 5X 10 cells ⁹ Individual cells.

(2) The pCJ112-pdeH plasmid is used as a target plasmid, 0.3 mug of plasmid is respectively transferred into competent cells of a wild strain CFT073 and a mutant strain CFT073 Deltares 53 by electrotransformation (2.5 kV,2mm electrotransformation cup), the transformed bacterial liquid is equally divided into two parts, the two parts are evenly coated on kanamycin-resistant and non-resistant LB plates, the culture is carried out at 37 ℃, the number of colonies which grow out is counted, and the transformation efficiency = (the number of transformants with kanamycin resistance/the number of CFU without resistance LB) ×100% is calculated.

Results: by comparing plasmid transformation efficiencies of wild-type CFT073 and CFT073 Δres53 mutants, res53 was found to be responsible for plasmid cleavage and thus greatly reduce plasmid transformation efficiency, demonstrating the restriction DNA cleavage activity of Res53, and the results are shown in fig. 4.

Example 4 the RM53 System greatly facilitates the E.coli against phage infection

1. Construction of recombinant plasmid carrying RM53 Gene

(1) The primer sequences shown below were designed and synthesized:

Ptac-P53-RM53-F：ATGGGGCCCGCGGCCGCGGATCCGAAAGGGGCAAGCTGTAC

Ptac-P53-RM53-R：ACCAACAAGGACCATAGCATATGTACAGCATACACCCCAGC

(2) Obtaining of the insert

Using the genomic DNA of e.coli CFT073 as a template, PCR amplification was performed using the primers synthesized above using the Phanta mix from nupran company to obtain RM53 gene fragments (comprising res53 and mod53 genes and their common promoter regions), under the amplification conditions: pre-denaturing at 95 ℃ for 3min, denaturing at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extending at 72 ℃ for 2.5min, circularly amplifying for 30 times, and extending at 72 ℃ for 10min. The obtained sequence is shown as SEQ ID NO. 5;

(3) Construction and linearization of pGEN-Ptac vectors

1) With pGEN-mcs (Addgene: # 44919) was used as a starting vector, and double-enzyme tangential restriction was performed using EcoRI and NdeI.

2) The lacI-Ptac duplex fragment with homology arms was obtained by PCR amplification using pMal-c2x (purchased from NEB company) as a template and using Phantamix from Novain company with the following primers: pre-denaturing at 95 ℃ for 3min, denaturing at 95 ℃ for 10s, annealing at 55 ℃ for 30s, extending at 72 ℃ for 1min, circularly amplifying for 30 times, and extending at 72 ℃ for 10min.

LacIPtac-c2x-F：

TCATTTTCTGAAACTCTTCATGCTGGAATTCCCGACACCATCGAATGGT

LacIPtac-c2x-R：

GGCCGCGGATCCCGGTACCAAGCTTCATATGCTATGGTCCTTGTTGGTGAAG

3) Performing electrophoresis observation and rubber cutting recovery purification on the DNA product obtained in the steps 1) and 2) to obtain a standby carrier fragment and a lacI-Ptac double-element fragment with a homology arm;

4) By Nor-NZan Co LtdMultiS One Step Cloning Kit (C112) connectionThe vector fragment obtained in the step 3) and the lacI-Ptac double-element fragment with a homology arm;

5) Transferring the connection product obtained in the step 4) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

6) Single colonies were picked up and inoculated in LB liquid medium of ampicillin, shake-cultured at 37℃for 12 hours, and extracted to obtain recombinant plasmid DNA. The recombinant plasmid DNA is used as a template, and the following primers are designed:

pMal-seq-F：TGGAATTGTGAGCGGATAAC

pGEN-seq-R：GTGGTCACGCTTTTCGTTGG

the insertion of the fragment was verified by PCR amplification under the following conditions: pre-denaturing at 95 ℃ for 5min, denaturing at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extending at 72 ℃ for 2min, and circularly amplifying for 30 times. And then extending at 72 ℃ for 5min.

The correct recombinant plasmid was picked up, DNA sequencing was performed, sequence fidelity was verified, and the correct recombinant plasmid was named pGEN-Ptac. pGEN-Ptac vector was linearized using BamHI and NdeI double enzyme cuts;

(4) Performing electrophoresis observation and rubber cutting recovery purification on the DNA products obtained in the steps (2) and (3) to obtain a standby pGEN-Ptac vector fragment and an RM53 gene fragment with a homology arm;

(5) By Nor-NZan Co LtdMultiS One Step Cloning Kit (C112) ligating the pGEN-Ptac vector fragment obtained in step (4) with the RM53 gene fragment having a homology arm;

(6) Transforming the ligation product obtained in the step (5) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

the conversion method is an electric conversion method, and comprises the following steps: electric shock at 2500V was applied once, resuspended in 800. Mu.LLB liquid medium and thawed at 37℃for 60min, centrifuged at 4000rpm for 3min, 100. Mu.L of supernatant was subjected to resuspension precipitation, spread on LB solid medium with ampicillin concentration of 100. Mu.g/mL, and cultured overnight.

(7) Single colonies were picked up and inoculated in LB liquid medium of ampicillin, shake-cultured at 37℃for 12 hours, and extracted to obtain recombinant plasmid DNA. The recombinant plasmid DNA is used as a template, and the following primers are designed:

pMal-seq-F：TGGAATTGTGAGCGGATAAC

pGEN-seq-R：GTGGTCACGCTTTTCGTTGG

the insertion of the fragment was verified by PCR amplification under the following conditions: pre-denaturing at 95 ℃ for 5min, denaturing at 95 ℃ for 30s, annealing at 55 ℃ for 2min, extending at 72 ℃ for 5min, and circularly amplifying for 30 times. And then extending at 72 ℃ for 5min.

And selecting the correct recombinant plasmid, carrying out DNA sequencing, verifying the sequence fidelity, and naming the correct recombinant plasmid pGEN-Ptac-RM, wherein the nucleotide sequence of the recombinant plasmid pGEN-Ptac-RM is shown as SEQ ID NO. 6.

2. Use of RM53 system for combating phages

(1) pGEN-Ptac and pGEN-Ptac-RM plasmids were introduced into MG1655 by electrotransformation, respectively, to construct MG1655 (v.c.) and MG1655 (+RM 53) strains.

(2) The phage stock solution (T4 and λvir) prepared in advance is diluted to 10-8 in gradient by utilizing LB medium, and can be stored at 4 ℃ for standby.

(3) To form a uniform lawn on the surface of the medium, 200. Mu.L of the logarithmic phase bacterial liquid, MG1655 (v.c.) and MG1655 (+RM 53), were added to 4mL of a 45℃0.3% soft agar solution, gently shaken, spread on LB plates uniformly, and air-dried under the cover.

(4) Sucking 20 mu L of phage dilutions of gradients (10-1 to 10-8) and dripping onto lawn plates at appropriate intervals without interfering with each other; uncapping and airing in a biosafety cabinet.

(5) The cells were incubated overnight at 25℃in an incubator for about 12 to 18 hours, and plaque production was observed.

Results: the results are shown in FIG. 5. From the results of FIG. 5, it can be seen that the RM53 system greatly enhances the ability of E.coli to resist phage infection.

Sequence listing

<110> Harbin veterinary institute of Chinese academy of agricultural sciences (Harbin division center of Chinese animal health and epidemiology center)

<120> a bacterial restriction-modification system and use thereof

<130> KLPI210340

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3072

<212> DNA

<213> Escherichia coli

<400> 1

atgaagctta aattcaaaca tcaaccctat caggctgccg cagtgcaggc ggtcgtcgat 60

atttttcagg ggcagccacc ggcctctgat gcggccatga gctatcgcct tgaccctggt 120

aataccaaaa acggtatggg tgatctgttt gcggtagata ctggttttaa aaatgctgag 180

ctaaccctta gtgaggttgc attgcttgat aacatccagc aggtgcagcg ccagcaaaat 240

ctgccgttgt cggagagctt ggtcaagacc aaggtcgcca agctaaatct tgatatcgag 300

atggaaacgg gtactggcaa gacctattgc tacatcaaga cagtcttcga actgaacaaa 360

cagtacggct ggagcaagtt cgtcatagtg gtgccgagca ttgccatccg cgagggcgta 420

gccaagtcgt tggaaatcac ggccgagcac tttcaggaga cctatcacaa gaaggcacgc 480

ttctttattt acaactctaa gcagctgcac catctggaga gtttctcctc agatgccggt 540

atcaatgtca tggtgatcaa cgtacaagcg tttaacgcca ctggcaaaga taaccgccgt 600

atctatgaag cgctcgatga ttttcagtca cgtcgcccga tcgatgtgat cagcgcaaac 660

cgacccatct tgatcctcga tgagccgcag cggatggagg ggggcaagac cctagattcc 720

ttggctaatt tcaacccgtt gatggtgttg cgctattccg ctacacacaa gaccacacac 780

aacaaaattc accgcctaga tgcgctcgat gcctacaacc agaagctggt gaagaagatt 840

gaggtgcgtg gtatctcggt gaagggactg gcgggaacca atgcctatct ctatttacaa 900

tccatcgaaa tctcaaacaa aaaaccgcca gtagcggttg tagagttcga acagaaactc 960

agcggtggaa acatcaagcg cgtcactcgc aaactgggta agggtgacaa tctgtttgtg 1020

ctatcgaacg agctggatca ataccgcgat gggtttgtgg tatcggacat caatgccaat 1080

acggacacct tgagctttac caatggcgta gaactgacgg tgggtgatgt gattggtgat 1140

atttccgaga tagcgctgcg ccgcattcag atccgtgaga cgatcaaggc gcactttgat 1200

aaggagatgg agctcttcga taaaggggtg aaggttctct cgttgttctt tattgacgaa 1260

gtggccaggt accgggacta ctccgctgtc gatgaaaagg gagagtacgc aaaaatattt 1320

gaagaggagt acgctaagca cattcaagaa gtgtttgata atgggtttat ggagggggat 1380

gccccttatg ctaaatatct acgccgcatt gcggccgata agacgcatag cggctacttt 1440

tccatcgaca agaagagcaa gcgcctcaca gatcccaaag ccgctgcgcg cggtgaaaat 1500

gcgggcttgt cggatgacgt agatgcttat gatctaatcc tcaaagacaa ggaacggtta 1560

ttatcactag ctgagccggt gcgttttatc ttctcacact cggccttacg tgagggctgg 1620

gataacccca acgtgtttgt tatctgcaca ctcaagcata gtgataacac catttcacgc 1680

cgccaagagg tcgggcgcgg cctgcgtttg tccgtcaatc aaaatggtga acgcatggat 1740

cacccatcca ttgttcatga cattaacgta ctgacagttg tggccagcga aagttacaag 1800

gacttcgtga ccgccttgca gaaggacatt agcgactcct tgtctgctcg cccgcgtgtg 1860

gcggacaagg cctacttcac gggcaagatg ctgaacacga aggaaggccc gattacggtc 1920

tcggacgacc aagccacgga catcgagttt tatctgatcc agaatggcta cgtcgataag 1980

aagcgcaata tcacagagaa ataccaccaa gctaagaaag acggcacatt agaggcattg 2040

ccggacgagc tgcagcccta tgcagagcag gtattccagc tgattaacag cgtattcagc 2100

gaaagccagc tcatgcaggt agaagatgga cgcaagccca aaagactgca gaccaacgcc 2160

aactttgaaa agcaggagtt caaagcgctg tgggggcgaa tcaatcgcaa agctacctac 2220

agcgtactgt ttgatgatgt tgagctagtg aacaatgcga tcaaggcgct caatgataag 2280

aatgctgggt tacgagtaac gccgttacaa tacaccattc accgtggcaa gcaggctgat 2340

acggcaactt acgatgacct caaaaagggt atcgccttcg agctgaaagt taccgaaaca 2400

gaatcgcaca ccgcctctat ccactccgct gtgcagtacg acttgattgg taagttatca 2460

gaggggactt tgcttacaag acgaaccatt gccgaaattc taaaaggtct ccatgctgac 2520

gtcttcgcgc aattcaagag caacccggaa agtttcattg ccgaagtcat tcgcttggtc 2580

aacgaacaaa aggccaatgt catcatcgag catctggcct atgacacgct agaagacaag 2640

tttgatttgg acatctttac cacgggtcag agcaaacagg atctcagtaa ggctgggaat 2700

aaattgcaaa atcacatcta tgattacgtg cttaccgact ctgcaattga gcgcaagttc 2760

gtcgaagagt tggataccag caaggatgtg gtggtatatg ccaagttgcc acgtggtttt 2820

ctgatcccaa cccctgtcgg cgattacaac cccgactggg ctatttcctt caaagaaggc 2880

tcggtcaagc atgtgtattt cgttgctgag accaagggct cgatgtcgtc actggattta 2940

cggcctattg aagccaccaa gattaaatgt gcccgtaagt tcttcgatgc ggttaacaag 3000

acgtttgctc cagaaaacgt gaagtatgac gtagtggata gcttcagtaa gctgatggaa 3060

gtggtgaagt aa 3072

<210> 2

<211> 2013

<212> DNA

<213> Escherichia coli

<400> 2

atggaaaagc taaaaatgca ttcacccaat ctcacgcagg acaacatcgc tcgcattcgc 60

gatctgtttc caggctgcgt caccgaagct aagggcgagg atggtagcgt gaagctggca 120

gtggattttg accaattgcg ccaggaactg tctgattcga ttgtagaagg gccgcaggaa 180

cgctaccagc tgaattggcc tggtaagcgc gaggcactgc tcactgcaaa tgcaccgatt 240

gcaaagacgc tccgtccagt acgtacgaca aaaaattcaa aaggcgaaca cattgaagag 300

agcgtcaact tcgacactac caagaatatc tttatcgagg gagataatct cgacgcgctg 360

aagctgcttc aggaaaatta tcttggcaaa atcaagatgg tctatatcga cccgccgtac 420

aacacgggaa acgattttgt ttacgccgac gattttgtag acgaggtctc tgagtttttt 480

cttcgttcaa atcaggtgga tagagaagga aaccgcttaa cagccaaccc cgaaacaagc 540

gggcgctttc actcagactg gctgtccatg atgtattcga gactaaagtt atcgcgcaac 600

ttgctacgag atgatggatt aatcgtaatt catattgatg agaatgaata tcccaacctg 660

gagaagcttc tggcagaaat atatggtgag aagaataatc tcggaactat tgtgtgggat 720

aagagaaatc caaaaggtga tgccacaggt gtcgcgcagc agcatgagct aatttgtatt 780

tactgcaaag atcgagaatt cttcaagaca acctgcgagt tccagcgacc aaaagagaat 840

gcaggaaaaa tgcttgcaaa agccaagcag attcttagca aggagggcgg ggtaactgaa 900

aaagcaagga aagaatacaa agattgggta aaccagcaag atctaactgg gggggaaaag 960

gcatataatc aaatcgatga caatggcgac gtcttccgtc cggtttctat ggcgtggccg 1020

aataagaaaa aagcaccgga agattatttc attccgctaa ttcatcctgt aacagggaag 1080

gagtgccctg ttcctgagcg tgggtggcga aaccctcctg caacaatgca agaactcttg 1140

aagtcagggt tgattatttt cggtccagac gagaagacgc agccaacaag aaaatatcgg 1200

ctgaatgaca atttattcga aaatatccct tctctacttt attacggtgg cagtgacgac 1260

gctttgcttg ctgaccttaa aattcctttt gatacaccga aaccggttca ggtagcaaag 1320

agactaattc aatcaatttg caagaatgac gatatattga tcgacttctt cgctggctcg 1380

tgcacggcgg cgcatgcact tatgcttttg aatgcggaag atggggcaaa tcgtcgattc 1440

ataatggttc aattgcccga ggaatgtgac gagaagtctg aagccaaaaa acttggatac 1500

tcagtagttt cggagattgg aaaaaatcgc attcggagag ctgcaaaaaa aattagagaa 1560

gaattttcag aaatattggc tacaagaaat acggaacttg acttaggatt tcgcctgctt 1620

aaagtcgata catcgaacat ggctgacgtc tactacagcc ccgatgtgct ggaaaaagcc 1680

aatctcgact tgtttgttga caacatcaag cctgatcgca cgcctgagga tctgctgttc 1740

caagtaatgc tggattgggg cgtcgatctg gccctgccta tcgccaagca gtccatccaa 1800

ggtaaagacg tgttctttgt cgatggcaat gtgcttaccg cctgcttcga cgccagtggc 1860

agcattgacg aaaccttcgt gaaggaactg gccaaactgc agccgctgcg cgttgtgttc 1920

cgcgacgcgg gctttaagaa cagtgcggtc aagatcaatg tcgagcagat tttcaagctc 1980

atgtcgcctg tcaccgaagt aaaatgtatc tga 2013

<210> 3

<211> 1023

<212> PRT

<213> Escherichia coli

<400> 3

Met Lys Leu Lys Phe Lys His Gln Pro Tyr Gln Ala Ala Ala Val Gln

1 5 10 15

Ala Val Val Asp Ile Phe Gln Gly Gln Pro Pro Ala Ser Asp Ala Ala

20 25 30

Met Ser Tyr Arg Leu Asp Pro Gly Asn Thr Lys Asn Gly Met Gly Asp

35 40 45

Leu Phe Ala Val Asp Thr Gly Phe Lys Asn Ala Glu Leu Thr Leu Ser

50 55 60

Glu Val Ala Leu Leu Asp Asn Ile Gln Gln Val Gln Arg Gln Gln Asn

65 70 75 80

Leu Pro Leu Ser Glu Ser Leu Val Lys Thr Lys Val Ala Lys Leu Asn

85 90 95

Leu Asp Ile Glu Met Glu Thr Gly Thr Gly Lys Thr Tyr Cys Tyr Ile

100 105 110

Lys Thr Val Phe Glu Leu Asn Lys Gln Tyr Gly Trp Ser Lys Phe Val

115 120 125

Ile Val Val Pro Ser Ile Ala Ile Arg Glu Gly Val Ala Lys Ser Leu

130 135 140

Glu Ile Thr Ala Glu His Phe Gln Glu Thr Tyr His Lys Lys Ala Arg

145 150 155 160

Phe Phe Ile Tyr Asn Ser Lys Gln Leu His His Leu Glu Ser Phe Ser

165 170 175

Ser Asp Ala Gly Ile Asn Val Met Val Ile Asn Val Gln Ala Phe Asn

180 185 190

Ala Thr Gly Lys Asp Asn Arg Arg Ile Tyr Glu Ala Leu Asp Asp Phe

195 200 205

Gln Ser Arg Arg Pro Ile Asp Val Ile Ser Ala Asn Arg Pro Ile Leu

210 215 220

Ile Leu Asp Glu Pro Gln Arg Met Glu Gly Gly Lys Thr Leu Asp Ser

225 230 235 240

Leu Ala Asn Phe Asn Pro Leu Met Val Leu Arg Tyr Ser Ala Thr His

245 250 255

Lys Thr Thr His Asn Lys Ile His Arg Leu Asp Ala Leu Asp Ala Tyr

260 265 270

Asn Gln Lys Leu Val Lys Lys Ile Glu Val Arg Gly Ile Ser Val Lys

275 280 285

Gly Leu Ala Gly Thr Asn Ala Tyr Leu Tyr Leu Gln Ser Ile Glu Ile

290 295 300

Ser Asn Lys Lys Pro Pro Val Ala Val Val Glu Phe Glu Gln Lys Leu

305 310 315 320

Ser Gly Gly Asn Ile Lys Arg Val Thr Arg Lys Leu Gly Lys Gly Asp

325 330 335

Asn Leu Phe Val Leu Ser Asn Glu Leu Asp Gln Tyr Arg Asp Gly Phe

340 345 350

Val Val Ser Asp Ile Asn Ala Asn Thr Asp Thr Leu Ser Phe Thr Asn

355 360 365

Gly Val Glu Leu Thr Val Gly Asp Val Ile Gly Asp Ile Ser Glu Ile

370 375 380

Ala Leu Arg Arg Ile Gln Ile Arg Glu Thr Ile Lys Ala His Phe Asp

385 390 395 400

Lys Glu Met Glu Leu Phe Asp Lys Gly Val Lys Val Leu Ser Leu Phe

405 410 415

Phe Ile Asp Glu Val Ala Arg Tyr Arg Asp Tyr Ser Ala Val Asp Glu

420 425 430

Lys Gly Glu Tyr Ala Lys Ile Phe Glu Glu Glu Tyr Ala Lys His Ile

435 440 445

Gln Glu Val Phe Asp Asn Gly Phe Met Glu Gly Asp Ala Pro Tyr Ala

450 455 460

Lys Tyr Leu Arg Arg Ile Ala Ala Asp Lys Thr His Ser Gly Tyr Phe

465 470 475 480

Ser Ile Asp Lys Lys Ser Lys Arg Leu Thr Asp Pro Lys Ala Ala Ala

485 490 495

Arg Gly Glu Asn Ala Gly Leu Ser Asp Asp Val Asp Ala Tyr Asp Leu

500 505 510

Ile Leu Lys Asp Lys Glu Arg Leu Leu Ser Leu Ala Glu Pro Val Arg

515 520 525

Phe Ile Phe Ser His Ser Ala Leu Arg Glu Gly Trp Asp Asn Pro Asn

530 535 540

Val Phe Val Ile Cys Thr Leu Lys His Ser Asp Asn Thr Ile Ser Arg

545 550 555 560

Arg Gln Glu Val Gly Arg Gly Leu Arg Leu Ser Val Asn Gln Asn Gly

565 570 575

Glu Arg Met Asp His Pro Ser Ile Val His Asp Ile Asn Val Leu Thr

580 585 590

Val Val Ala Ser Glu Ser Tyr Lys Asp Phe Val Thr Ala Leu Gln Lys

595 600 605

Asp Ile Ser Asp Ser Leu Ser Ala Arg Pro Arg Val Ala Asp Lys Ala

610 615 620

Tyr Phe Thr Gly Lys Met Leu Asn Thr Lys Glu Gly Pro Ile Thr Val

625 630 635 640

Ser Asp Asp Gln Ala Thr Asp Ile Glu Phe Tyr Leu Ile Gln Asn Gly

645 650 655

Tyr Val Asp Lys Lys Arg Asn Ile Thr Glu Lys Tyr His Gln Ala Lys

660 665 670

Lys Asp Gly Thr Leu Glu Ala Leu Pro Asp Glu Leu Gln Pro Tyr Ala

675 680 685

Glu Gln Val Phe Gln Leu Ile Asn Ser Val Phe Ser Glu Ser Gln Leu

690 695 700

Met Gln Val Glu Asp Gly Arg Lys Pro Lys Arg Leu Gln Thr Asn Ala

705 710 715 720

Asn Phe Glu Lys Gln Glu Phe Lys Ala Leu Trp Gly Arg Ile Asn Arg

725 730 735

Lys Ala Thr Tyr Ser Val Leu Phe Asp Asp Val Glu Leu Val Asn Asn

740 745 750

Ala Ile Lys Ala Leu Asn Asp Lys Asn Ala Gly Leu Arg Val Thr Pro

755 760 765

Leu Gln Tyr Thr Ile His Arg Gly Lys Gln Ala Asp Thr Ala Thr Tyr

770 775 780

Asp Asp Leu Lys Lys Gly Ile Ala Phe Glu Leu Lys Val Thr Glu Thr

785 790 795 800

Glu Ser His Thr Ala Ser Ile His Ser Ala Val Gln Tyr Asp Leu Ile

805 810 815

Gly Lys Leu Ser Glu Gly Thr Leu Leu Thr Arg Arg Thr Ile Ala Glu

820 825 830

Ile Leu Lys Gly Leu His Ala Asp Val Phe Ala Gln Phe Lys Ser Asn

835 840 845

Pro Glu Ser Phe Ile Ala Glu Val Ile Arg Leu Val Asn Glu Gln Lys

850 855 860

Ala Asn Val Ile Ile Glu His Leu Ala Tyr Asp Thr Leu Glu Asp Lys

865 870 875 880

Phe Asp Leu Asp Ile Phe Thr Thr Gly Gln Ser Lys Gln Asp Leu Ser

885 890 895

Lys Ala Gly Asn Lys Leu Gln Asn His Ile Tyr Asp Tyr Val Leu Thr

900 905 910

Asp Ser Ala Ile Glu Arg Lys Phe Val Glu Glu Leu Asp Thr Ser Lys

915 920 925

Asp Val Val Val Tyr Ala Lys Leu Pro Arg Gly Phe Leu Ile Pro Thr

930 935 940

Pro Val Gly Asp Tyr Asn Pro Asp Trp Ala Ile Ser Phe Lys Glu Gly

945 950 955 960

Ser Val Lys His Val Tyr Phe Val Ala Glu Thr Lys Gly Ser Met Ser

965 970 975

Ser Leu Asp Leu Arg Pro Ile Glu Ala Thr Lys Ile Lys Cys Ala Arg

980 985 990

Lys Phe Phe Asp Ala Val Asn Lys Thr Phe Ala Pro Glu Asn Val Lys

995 1000 1005

Tyr Asp Val Val Asp Ser Phe Ser Lys Leu Met Glu Val Val Lys

1010 1015 1020

<210> 4

<211> 670

<212> PRT

<213> Escherichia coli

<400> 4

Met Glu Lys Leu Lys Met His Ser Pro Asn Leu Thr Gln Asp Asn Ile

1 5 10 15

Ala Arg Ile Arg Asp Leu Phe Pro Gly Cys Val Thr Glu Ala Lys Gly

20 25 30

Glu Asp Gly Ser Val Lys Leu Ala Val Asp Phe Asp Gln Leu Arg Gln

35 40 45

Glu Leu Ser Asp Ser Ile Val Glu Gly Pro Gln Glu Arg Tyr Gln Leu

50 55 60

Asn Trp Pro Gly Lys Arg Glu Ala Leu Leu Thr Ala Asn Ala Pro Ile

65 70 75 80

Ala Lys Thr Leu Arg Pro Val Arg Thr Thr Lys Asn Ser Lys Gly Glu

85 90 95

His Ile Glu Glu Ser Val Asn Phe Asp Thr Thr Lys Asn Ile Phe Ile

100 105 110

Glu Gly Asp Asn Leu Asp Ala Leu Lys Leu Leu Gln Glu Asn Tyr Leu

115 120 125

Gly Lys Ile Lys Met Val Tyr Ile Asp Pro Pro Tyr Asn Thr Gly Asn

130 135 140

Asp Phe Val Tyr Ala Asp Asp Phe Val Asp Glu Val Ser Glu Phe Phe

145 150 155 160

Leu Arg Ser Asn Gln Val Asp Arg Glu Gly Asn Arg Leu Thr Ala Asn

165 170 175

Pro Glu Thr Ser Gly Arg Phe His Ser Asp Trp Leu Ser Met Met Tyr

180 185 190

Ser Arg Leu Lys Leu Ser Arg Asn Leu Leu Arg Asp Asp Gly Leu Ile

195 200 205

Val Ile His Ile Asp Glu Asn Glu Tyr Pro Asn Leu Glu Lys Leu Leu

210 215 220

Ala Glu Ile Tyr Gly Glu Lys Asn Asn Leu Gly Thr Ile Val Trp Asp

225 230 235 240

Lys Arg Asn Pro Lys Gly Asp Ala Thr Gly Val Ala Gln Gln His Glu

245 250 255

Leu Ile Cys Ile Tyr Cys Lys Asp Arg Glu Phe Phe Lys Thr Thr Cys

260 265 270

Glu Phe Gln Arg Pro Lys Glu Asn Ala Gly Lys Met Leu Ala Lys Ala

275 280 285

Lys Gln Ile Leu Ser Lys Glu Gly Gly Val Thr Glu Lys Ala Arg Lys

290 295 300

Glu Tyr Lys Asp Trp Val Asn Gln Gln Asp Leu Thr Gly Gly Glu Lys

305 310 315 320

Ala Tyr Asn Gln Ile Asp Asp Asn Gly Asp Val Phe Arg Pro Val Ser

325 330 335

Met Ala Trp Pro Asn Lys Lys Lys Ala Pro Glu Asp Tyr Phe Ile Pro

340 345 350

Leu Ile His Pro Val Thr Gly Lys Glu Cys Pro Val Pro Glu Arg Gly

355 360 365

Trp Arg Asn Pro Pro Ala Thr Met Gln Glu Leu Leu Lys Ser Gly Leu

370 375 380

Ile Ile Phe Gly Pro Asp Glu Lys Thr Gln Pro Thr Arg Lys Tyr Arg

385 390 395 400

Leu Asn Asp Asn Leu Phe Glu Asn Ile Pro Ser Leu Leu Tyr Tyr Gly

405 410 415

Gly Ser Asp Asp Ala Leu Leu Ala Asp Leu Lys Ile Pro Phe Asp Thr

420 425 430

Pro Lys Pro Val Gln Val Ala Lys Arg Leu Ile Gln Ser Ile Cys Lys

435 440 445

Asn Asp Asp Ile Leu Ile Asp Phe Phe Ala Gly Ser Cys Thr Ala Ala

450 455 460

His Ala Leu Met Leu Leu Asn Ala Glu Asp Gly Ala Asn Arg Arg Phe

465 470 475 480

Ile Met Val Gln Leu Pro Glu Glu Cys Asp Glu Lys Ser Glu Ala Lys

485 490 495

Lys Leu Gly Tyr Ser Val Val Ser Glu Ile Gly Lys Asn Arg Ile Arg

500 505 510

Arg Ala Ala Lys Lys Ile Arg Glu Glu Phe Ser Glu Ile Leu Ala Thr

515 520 525

Arg Asn Thr Glu Leu Asp Leu Gly Phe Arg Leu Leu Lys Val Asp Thr

530 535 540

Ser Asn Met Ala Asp Val Tyr Tyr Ser Pro Asp Val Leu Glu Lys Ala

545 550 555 560

Asn Leu Asp Leu Phe Val Asp Asn Ile Lys Pro Asp Arg Thr Pro Glu

565 570 575

Asp Leu Leu Phe Gln Val Met Leu Asp Trp Gly Val Asp Leu Ala Leu

580 585 590

Pro Ile Ala Lys Gln Ser Ile Gln Gly Lys Asp Val Phe Phe Val Asp

595 600 605

Gly Asn Val Leu Thr Ala Cys Phe Asp Ala Ser Gly Ser Ile Asp Glu

610 615 620

Thr Phe Val Lys Glu Leu Ala Lys Leu Gln Pro Leu Arg Val Val Phe

625 630 635 640

Arg Asp Ala Gly Phe Lys Asn Ser Ala Val Lys Ile Asn Val Glu Gln

645 650 655

Ile Phe Lys Leu Met Ser Pro Val Thr Glu Val Lys Cys Ile

660 665 670

<210> 5

<211> 5645

<212> DNA

<213> Escherichia coli

<400> 5

gaaaggggca agctgtacga tgggcggaca cttggttccg atgcgctggc aagcatcaac 60

gcaatgacgt ccagttcagc catccaaagg ctgggtaaga tcagtcaggc gaaccgcgaa 120

aaccatcagg tactggtggc ggagcctgcc attgctcgtg ttgtggtaga cgatgaagag 180

ggagaagaga aagtaacgtg cgcgtgttcg acatccagca catcaaaggc atggagttcg 240

aggcggtgtt ctttgtcagc attgaccagc tcgccactct gcacccggcg ctgttcgata 300

aatacctgta cgtcggcatc acccgtgcgg caacctacct ggacgtgacc tgctagggca 360

gcttgccatc tgcactcgag agcctgcgcc tgcacttttg ccaggactgg cagcaaggca 420

actaaccata ccaatacgaa cttgaattgt gagccgctat gccttttcaa taagcagcat 480

aacggccaga ggaaaagaat atggaaaagc taaaaatgca ttcacccaat ctcacgcagg 540

acaacatcgc tcgcattcgc gatctgtttc caggctgcgt caccgaagct aagggcgagg 600

atggtagcgt gaagctggca gtggattttg accaattgcg ccaggaactg tctgattcga 660

ttgtagaagg gccgcaggaa cgctaccagc tgaattggcc tggtaagcgc gaggcactgc 720

tcactgcaaa tgcaccgatt gcaaagacgc tccgtccagt acgtacgaca aaaaattcaa 780

aaggcgaaca cattgaagag agcgtcaact tcgacactac caagaatatc tttatcgagg 840

gagataatct cgacgcgctg aagctgcttc aggaaaatta tcttggcaaa atcaagatgg 900

tctatatcga cccgccgtac aacacgggaa acgattttgt ttacgccgac gattttgtag 960

acgaggtctc tgagtttttt cttcgttcaa atcaggtgga tagagaagga aaccgcttaa 1020

cagccaaccc cgaaacaagc gggcgctttc actcagactg gctgtccatg atgtattcga 1080

gactaaagtt atcgcgcaac ttgctacgag atgatggatt aatcgtaatt catattgatg 1140

agaatgaata tcccaacctg gagaagcttc tggcagaaat atatggtgag aagaataatc 1200

tcggaactat tgtgtgggat aagagaaatc caaaaggtga tgccacaggt gtcgcgcagc 1260

agcatgagct aatttgtatt tactgcaaag atcgagaatt cttcaagaca acctgcgagt 1320

tccagcgacc aaaagagaat gcaggaaaaa tgcttgcaaa agccaagcag attcttagca 1380

aggagggcgg ggtaactgaa aaagcaagga aagaatacaa agattgggta aaccagcaag 1440

atctaactgg gggggaaaag gcatataatc aaatcgatga caatggcgac gtcttccgtc 1500

cggtttctat ggcgtggccg aataagaaaa aagcaccgga agattatttc attccgctaa 1560

ttcatcctgt aacagggaag gagtgccctg ttcctgagcg tgggtggcga aaccctcctg 1620

caacaatgca agaactcttg aagtcagggt tgattatttt cggtccagac gagaagacgc 1680

agccaacaag aaaatatcgg ctgaatgaca atttattcga aaatatccct tctctacttt 1740

attacggtgg cagtgacgac gctttgcttg ctgaccttaa aattcctttt gatacaccga 1800

aaccggttca ggtagcaaag agactaattc aatcaatttg caagaatgac gatatattga 1860

tcgacttctt cgctggctcg tgcacggcgg cgcatgcact tatgcttttg aatgcggaag 1920

atggggcaaa tcgtcgattc ataatggttc aattgcccga ggaatgtgac gagaagtctg 1980

aagccaaaaa acttggatac tcagtagttt cggagattgg aaaaaatcgc attcggagag 2040

ctgcaaaaaa aattagagaa gaattttcag aaatattggc tacaagaaat acggaacttg 2100

acttaggatt tcgcctgctt aaagtcgata catcgaacat ggctgacgtc tactacagcc 2160

ccgatgtgct ggaaaaagcc aatctcgact tgtttgttga caacatcaag cctgatcgca 2220

cgcctgagga tctgctgttc caagtaatgc tggattgggg cgtcgatctg gccctgccta 2280

tcgccaagca gtccatccaa ggtaaagacg tgttctttgt cgatggcaat gtgcttaccg 2340

cctgcttcga cgccagtggc agcattgacg aaaccttcgt gaaggaactg gccaaactgc 2400

agccgctgcg cgttgtgttc cgcgacgcgg gctttaagaa cagtgcggtc aagatcaatg 2460

tcgagcagat tttcaagctc atgtcgcctg tcaccgaagt aaaatgtatc tgagggggac 2520

ggtgcaatga agcttaaatt caaacatcaa ccctatcagg ctgccgcagt gcaggcggtc 2580

gtcgatattt ttcaggggca gccaccggcc tctgatgcgg ccatgagcta tcgccttgac 2640

cctggtaata ccaaaaacgg tatgggtgat ctgtttgcgg tagatactgg ttttaaaaat 2700

gctgagctaa cccttagtga ggttgcattg cttgataaca tccagcaggt gcagcgccag 2760

caaaatctgc cgttgtcgga gagcttggtc aagaccaagg tcgccaagct aaatcttgat 2820

atcgagatgg aaacgggtac tggcaagacc tattgctaca tcaagacagt cttcgaactg 2880

aacaaacagt acggctggag caagttcgtc atagtggtgc cgagcattgc catccgcgag 2940

ggcgtagcca agtcgttgga aatcacggcc gagcactttc aggagaccta tcacaagaag 3000

gcacgcttct ttatttacaa ctctaagcag ctgcaccatc tggagagttt ctcctcagat 3060

gccggtatca atgtcatggt gatcaacgta caagcgttta acgccactgg caaagataac 3120

cgccgtatct atgaagcgct cgatgatttt cagtcacgtc gcccgatcga tgtgatcagc 3180

gcaaaccgac ccatcttgat cctcgatgag ccgcagcgga tggagggggg caagacccta 3240

gattccttgg ctaatttcaa cccgttgatg gtgttgcgct attccgctac acacaagacc 3300

acacacaaca aaattcaccg cctagatgcg ctcgatgcct acaaccagaa gctggtgaag 3360

aagattgagg tgcgtggtat ctcggtgaag ggactggcgg gaaccaatgc ctatctctat 3420

ttacaatcca tcgaaatctc aaacaaaaaa ccgccagtag cggttgtaga gttcgaacag 3480

aaactcagcg gtggaaacat caagcgcgtc actcgcaaac tgggtaaggg tgacaatctg 3540

tttgtgctat cgaacgagct ggatcaatac cgcgatgggt ttgtggtatc ggacatcaat 3600

gccaatacgg acaccttgag ctttaccaat ggcgtagaac tgacggtggg tgatgtgatt 3660

ggtgatattt ccgagatagc gctgcgccgc attcagatcc gtgagacgat caaggcgcac 3720

tttgataagg agatggagct cttcgataaa ggggtgaagg ttctctcgtt gttctttatt 3780

gacgaagtgg ccaggtaccg ggactactcc gctgtcgatg aaaagggaga gtacgcaaaa 3840

atatttgaag aggagtacgc taagcacatt caagaagtgt ttgataatgg gtttatggag 3900

ggggatgccc cttatgctaa atatctacgc cgcattgcgg ccgataagac gcatagcggc 3960

tacttttcca tcgacaagaa gagcaagcgc ctcacagatc ccaaagccgc tgcgcgcggt 4020

gaaaatgcgg gcttgtcgga tgacgtagat gcttatgatc taatcctcaa agacaaggaa 4080

cggttattat cactagctga gccggtgcgt tttatcttct cacactcggc cttacgtgag 4140

ggctgggata accccaacgt gtttgttatc tgcacactca agcatagtga taacaccatt 4200

tcacgccgcc aagaggtcgg gcgcggcctg cgtttgtccg tcaatcaaaa tggtgaacgc 4260

atggatcacc catccattgt tcatgacatt aacgtactga cagttgtggc cagcgaaagt 4320

tacaaggact tcgtgaccgc cttgcagaag gacattagcg actccttgtc tgctcgcccg 4380

cgtgtggcgg acaaggccta cttcacgggc aagatgctga acacgaagga aggcccgatt 4440

acggtctcgg acgaccaagc cacggacatc gagttttatc tgatccagaa tggctacgtc 4500

gataagaagc gcaatatcac agagaaatac caccaagcta agaaagacgg cacattagag 4560

gcattgccgg acgagctgca gccctatgca gagcaggtat tccagctgat taacagcgta 4620

ttcagcgaaa gccagctcat gcaggtagaa gatggacgca agcccaaaag actgcagacc 4680

aacgccaact ttgaaaagca ggagttcaaa gcgctgtggg ggcgaatcaa tcgcaaagct 4740

acctacagcg tactgtttga tgatgttgag ctagtgaaca atgcgatcaa ggcgctcaat 4800

gataagaatg ctgggttacg agtaacgccg ttacaataca ccattcaccg tggcaagcag 4860

gctgatacgg caacttacga tgacctcaaa aagggtatcg ccttcgagct gaaagttacc 4920

gaaacagaat cgcacaccgc ctctatccac tccgctgtgc agtacgactt gattggtaag 4980

ttatcagagg ggactttgct tacaagacga accattgccg aaattctaaa aggtctccat 5040

gctgacgtct tcgcgcaatt caagagcaac ccggaaagtt tcattgccga agtcattcgc 5100

ttggtcaacg aacaaaaggc caatgtcatc atcgagcatc tggcctatga cacgctagaa 5160

gacaagtttg atttggacat ctttaccacg ggtcagagca aacaggatct cagtaaggct 5220

gggaataaat tgcaaaatca catctatgat tacgtgctta ccgactctgc aattgagcgc 5280

aagttcgtcg aagagttgga taccagcaag gatgtggtgg tatatgccaa gttgccacgt 5340

ggttttctga tcccaacccc tgtcggcgat tacaaccccg actgggctat ttccttcaaa 5400

gaaggctcgg tcaagcatgt gtatttcgtt gctgagacca agggctcgat gtcgtcactg 5460

gatttacggc ctattgaagc caccaagatt aaatgtgccc gtaagttctt cgatgcggtt 5520

aacaagacgt ttgctccaga aaacgtgaag tatgacgtag tggatagctt cagtaagctg 5580

atggaagtgg tgaagtaaga ttaaacccag cctaccatta taaaggtcgg ctggggtgta 5640

tgctg 5645

<210> 6

<211> 12299

<212> DNA

<213> artificial sequence

<400> 6

cagcatgaag agtttcagaa aatgacagag cgtgagcaag tgcctttatt gaaattgcct 60

gaataacaga gacagtgcaa acgattattt cataataacg attatgtaat gactggtaag 120

aaaataactt gattgagttc cctttatcca gcctgatagt ggataaaggg aactcaataa 180

taattgaatt aatttattag cttcatcgca ttttttttgg tctcttcatc acttttttgc 240

tcttgttgtg aagaggattg agtgactatt gaagaattaa aatcggccat ctcttttgga 300

aatagcgatc tcaatatatt cacgatatct gaaaatgtgg tttctttcgt cagcagctca 360

cataaaagga aaggggtccg gggatcttgt ctgtataagg ccagacctgc cgtcagtgcg 420

gcccggttaa ggcggcttcg ttccccttgc gggatactgt ccagtgtatc acaaacaatt 480

ttatctgttt gatttacatc tggatttagt ttgaaggcaa tggttctgcg cttgtccatc 540

attaattacc tatgagatac ataccgttaa ctaaatcata ttgagagtta ttggttttga 600

aaaaacgttc atcacgaatc tgtgtgtgtt tttttactgc atcgcatatt aattctgcgc 660

caccgcctat aaccataaca tgagtataac cagaaaattc attgagcgta tttaatacac 720

gttgctcaag tttacgaagt gcttcattca ttgcttcggt gactattgat attttgttct 780

catcattaat tcgttgcttc agatagttat tatcttttct gtgaatgatt atatcgtcag 840

caagatagct acttcctttt gttctcgcaa gagaaagggc atcttttact gcagatgtaa 900

ccagagagac accaagagat gagtctccgt atattttact gatccccgat aatttcccca 960

ttacctgaga aatatctaat gtggtgcccc cgagatctat aattaataaa gaatctaact 1020

catccagttc ttgtagaact tcataacctg ccggtataga ttcaggcatg acttttacat 1080

cttttattgt gaatgtatcc ccgccattta atgtaatttt tttccggaag tttgctttct 1140

tacgctcaat attttccgta ttgggttggt tatttctgtc gtaatactct gtcagaggaa 1200

gtgtgcaaac aatatccact tcgcttaccg gcagaccact ggtcagtaag gcgtgatgca 1260

ctgcaacgac attaacgtcg ctgtattgcc atgcgatatt ggttgtgact acagcatccg 1320

ggctgattgg atcaaatgaa tactgttcgc cgttcagtgt gtagttaaag acctttttat 1380

caccaaaaga gactgcccac tcgcgtttga agctgttcgg gctaatgtgc tgtttaattg 1440

ttccgtcgct ttcctgccac tgtagtttga tgtttgttga accgtcatca atgaatacca 1500

acatttataa aactccttat ggtgtttttt tggtgtgtgt ttgggtatgt tttgggtttt 1560

aagtgggttt gtttgtcaag tttaccccat ttcaaccatc aatcaatgat tatttgtctt 1620

gttttggtgt tttattgggt tgggtatggg ttgtttttgg gttttgtttg gcgggtaaca 1680

aaagtgctcg agacaaactc cgggaggcag cgtgatgcgg caacaatcac acggatttcc 1740

cgtgaacggt ctgaatgagc ggattatttt cagggaaagt gagtgtggtc agcgtgcagg 1800

tatatgggct atgatgtgcc cggcgcttga ggctttctgc ctcatgacgt gaaggtggtt 1860

tgttgccgtg ttgtgtggca gaaagaagat agccccgtag taagttaatt ttcattaacc 1920

accacgaggc atccctatgt ctagtccaca tcaggatagc ctcttaccgc gctttgcgca 1980

aggagaagaa ggccatgaaa ctaccacgaa gttcccttgt ctggtgtgtg ttgatcgtgt 2040

gtctcacact gttgatattc acttatctga cacgaaaatc gctgtgcgag attcgttaca 2100

gagacggaca cagggaggtg gcggctttca tggcttacga atccggtaag tagcaacctg 2160

gaggcgggcg caggcccgcc ttttcaggac tgatgctggt ctgactactg aagcgccttt 2220

ataaaggggc tgctggttcg ccggtagccc ctttctcctt gctgatgttg tctagaagac 2280

gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt 2340

agacgtcagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct 2400

aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat 2460

attgaaaaag gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg 2520

cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg 2580

aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc 2640

ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat 2700

gtggcgcggt attatcccgt gttgacgccg ggcaagagca actcggtcgc cgcatacact 2760

attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca 2820

tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact 2880

tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg 2940

atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg 3000

agcgtgacac cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg 3060

aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg 3120

caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag 3180

ccggtgagcg tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc 3240

gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga 3300

tcgctgagat aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat 3360

atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc 3420

tttttgataa tctcatgacc aaaatccctt aactagtgtt ttagatccgg ttgacagtaa 3480

gacgggtaag cctgttgatg ataccgctgc cttactgggt gcattagcca gtctgaatga 3540

cctgtcacgg gataatccga agtggtcaga ctggaaaatc agagggcagg aactgctgaa 3600

cagcaaaaag tcagatagca ccacatagca gacccgccat aaaacgccct gagaagcccg 3660

tgacgggctt ttcttgtatt atgggtagtt tccttgcatg aatccataaa aggcgcctgt 3720

agtgccattt acccccattc actgccagag ccgtgagcgc agcgaactga atgtcacgaa 3780

aaagacagcg actcaggtgc ctgatggtcg gagacaaaag gaatattcag cgatttgcca 3840

gatccagctt ggctgttttg gcggatgaga gaagattttc agcctgatac agattaaatc 3900

agaacgcaga agcggtctga taaaacagaa tttgcctggc ggcagtagcg cggtggtccc 3960

acctgacccc atgccgaact cagaagtgaa acgccgtagc gccgatggta gtgtggggtc 4020

tccccatgcg agagtaggga actgccaggc atcaaataaa acgaaaggct cagtcgaaag 4080

actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc 4140

cgccgggagc ggatttgaac gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc 4200

cgccataaac tgccaggcat caaattaagc agaaggccat cctgacggat ggcctttttg 4260

cgtttctaca aactcttggg cctagtgttt tagatcctag aaatatttta tctgattaat 4320

aagatgatct tcttgagatc gttttggtct gcgcgtaatc tcttgctctg aaaacgaaaa 4380

aaccgccttg cagggcggtt tttcgaaggt tctctgagct accaactctt tgaaccgagg 4440

taactggctt ggaggagcgc agtcaccaaa acttgtcctt tcagtttagc cttaaccggc 4500

gcatgacttc aagactaact cctctaaatc aattaccagt ggctgctgcc agtggtgctt 4560

ttgcatgtct ttccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 4620

actgaacggg gggttcgtgc atacagtcca gcttggagcg aactgcctac ccggaactga 4680

gtgtcaggcg tggaatgaga caaacgcggc cataacagcg gaatgacacc ggtaaaccga 4740

aaggcaggaa caggagagcg cacgagggag ccgccagggg gaaacgcctg gtatctttat 4800

agtcctgtcg ggtttcgcca ccactgattt gagcgtcaga tttcgtgatg cttgtcaggg 4860

gggcggagcc tatggaaaaa cggctttgcc gcggccctct cacttccctg ttaagtatct 4920

cctaggccga gaaaaaaaag cccgctcatt aggcgggcta gctcattatt tgtagagctc 4980

atccatgcca tgtgtaatcc cagcagcagt tacaaactca agaaggacca tgtggtcacg 5040

cttttcgttg ggatctttcg aaagggcaga ttgtgtcgac cagctatcga tccatggggc 5100

ccgcggccgc ggatccgaaa ggggcaagct gtacgatggg cggacacttg gttccgatgc 5160

gctggcaagc atcaacgcaa tgacgtccag ttcagccatc caaaggctgg gtaagatcag 5220

tcaggcgaac cgcgaaaacc atcaggtact ggtggcggag cctgccattg ctcgtgttgt 5280

ggtagacgat gaagagggag aagagaaagt aacgtgcgcg tgttcgacat ccagcacatc 5340

aaaggcatgg agttcgaggc ggtgttcttt gtcagcattg accagctcgc cactctgcac 5400

ccggcgctgt tcgataaata cctgtacgtc ggcatcaccc gtgcggcaac ctacctggac 5460

gtgacctgct agggcagctt gccatctgca ctcgagagcc tgcgcctgca cttttgccag 5520

gactggcagc aaggcaacta accataccaa tacgaacttg aattgtgagc cgctatgcct 5580

tttcaataag cagcataacg gccagaggaa aagaatatgg aaaagctaaa aatgcattca 5640

cccaatctca cgcaggacaa catcgctcgc attcgcgatc tgtttccagg ctgcgtcacc 5700

gaagctaagg gcgaggatgg tagcgtgaag ctggcagtgg attttgacca attgcgccag 5760

gaactgtctg attcgattgt agaagggccg caggaacgct accagctgaa ttggcctggt 5820

aagcgcgagg cactgctcac tgcaaatgca ccgattgcaa agacgctccg tccagtacgt 5880

acgacaaaaa attcaaaagg cgaacacatt gaagagagcg tcaacttcga cactaccaag 5940

aatatcttta tcgagggaga taatctcgac gcgctgaagc tgcttcagga aaattatctt 6000

ggcaaaatca agatggtcta tatcgacccg ccgtacaaca cgggaaacga ttttgtttac 6060

gccgacgatt ttgtagacga ggtctctgag ttttttcttc gttcaaatca ggtggataga 6120

gaaggaaacc gcttaacagc caaccccgaa acaagcgggc gctttcactc agactggctg 6180

tccatgatgt attcgagact aaagttatcg cgcaacttgc tacgagatga tggattaatc 6240

gtaattcata ttgatgagaa tgaatatccc aacctggaga agcttctggc agaaatatat 6300

ggtgagaaga ataatctcgg aactattgtg tgggataaga gaaatccaaa aggtgatgcc 6360

acaggtgtcg cgcagcagca tgagctaatt tgtatttact gcaaagatcg agaattcttc 6420

aagacaacct gcgagttcca gcgaccaaaa gagaatgcag gaaaaatgct tgcaaaagcc 6480

aagcagattc ttagcaagga gggcggggta actgaaaaag caaggaaaga atacaaagat 6540

tgggtaaacc agcaagatct aactgggggg gaaaaggcat ataatcaaat cgatgacaat 6600

ggcgacgtct tccgtccggt ttctatggcg tggccgaata agaaaaaagc accggaagat 6660

tatttcattc cgctaattca tcctgtaaca gggaaggagt gccctgttcc tgagcgtggg 6720

tggcgaaacc ctcctgcaac aatgcaagaa ctcttgaagt cagggttgat tattttcggt 6780

ccagacgaga agacgcagcc aacaagaaaa tatcggctga atgacaattt attcgaaaat 6840

atcccttctc tactttatta cggtggcagt gacgacgctt tgcttgctga ccttaaaatt 6900

ccttttgata caccgaaacc ggttcaggta gcaaagagac taattcaatc aatttgcaag 6960

aatgacgata tattgatcga cttcttcgct ggctcgtgca cggcggcgca tgcacttatg 7020

cttttgaatg cggaagatgg ggcaaatcgt cgattcataa tggttcaatt gcccgaggaa 7080

tgtgacgaga agtctgaagc caaaaaactt ggatactcag tagtttcgga gattggaaaa 7140

aatcgcattc ggagagctgc aaaaaaaatt agagaagaat tttcagaaat attggctaca 7200

agaaatacgg aacttgactt aggatttcgc ctgcttaaag tcgatacatc gaacatggct 7260

gacgtctact acagccccga tgtgctggaa aaagccaatc tcgacttgtt tgttgacaac 7320

atcaagcctg atcgcacgcc tgaggatctg ctgttccaag taatgctgga ttggggcgtc 7380

gatctggccc tgcctatcgc caagcagtcc atccaaggta aagacgtgtt ctttgtcgat 7440

ggcaatgtgc ttaccgcctg cttcgacgcc agtggcagca ttgacgaaac cttcgtgaag 7500

gaactggcca aactgcagcc gctgcgcgtt gtgttccgcg acgcgggctt taagaacagt 7560

gcggtcaaga tcaatgtcga gcagattttc aagctcatgt cgcctgtcac cgaagtaaaa 7620

tgtatctgag ggggacggtg caatgaagct taaattcaaa catcaaccct atcaggctgc 7680

cgcagtgcag gcggtcgtcg atatttttca ggggcagcca ccggcctctg atgcggccat 7740

gagctatcgc cttgaccctg gtaataccaa aaacggtatg ggtgatctgt ttgcggtaga 7800

tactggtttt aaaaatgctg agctaaccct tagtgaggtt gcattgcttg ataacatcca 7860

gcaggtgcag cgccagcaaa atctgccgtt gtcggagagc ttggtcaaga ccaaggtcgc 7920

caagctaaat cttgatatcg agatggaaac gggtactggc aagacctatt gctacatcaa 7980

gacagtcttc gaactgaaca aacagtacgg ctggagcaag ttcgtcatag tggtgccgag 8040

cattgccatc cgcgagggcg tagccaagtc gttggaaatc acggccgagc actttcagga 8100

gacctatcac aagaaggcac gcttctttat ttacaactct aagcagctgc accatctgga 8160

gagtttctcc tcagatgccg gtatcaatgt catggtgatc aacgtacaag cgtttaacgc 8220

cactggcaaa gataaccgcc gtatctatga agcgctcgat gattttcagt cacgtcgccc 8280

gatcgatgtg atcagcgcaa accgacccat cttgatcctc gatgagccgc agcggatgga 8340

ggggggcaag accctagatt ccttggctaa tttcaacccg ttgatggtgt tgcgctattc 8400

cgctacacac aagaccacac acaacaaaat tcaccgccta gatgcgctcg atgcctacaa 8460

ccagaagctg gtgaagaaga ttgaggtgcg tggtatctcg gtgaagggac tggcgggaac 8520

caatgcctat ctctatttac aatccatcga aatctcaaac aaaaaaccgc cagtagcggt 8580

tgtagagttc gaacagaaac tcagcggtgg aaacatcaag cgcgtcactc gcaaactggg 8640

taagggtgac aatctgtttg tgctatcgaa cgagctggat caataccgcg atgggtttgt 8700

ggtatcggac atcaatgcca atacggacac cttgagcttt accaatggcg tagaactgac 8760

ggtgggtgat gtgattggtg atatttccga gatagcgctg cgccgcattc agatccgtga 8820

gacgatcaag gcgcactttg ataaggagat ggagctcttc gataaagggg tgaaggttct 8880

ctcgttgttc tttattgacg aagtggccag gtaccgggac tactccgctg tcgatgaaaa 8940

gggagagtac gcaaaaatat ttgaagagga gtacgctaag cacattcaag aagtgtttga 9000

taatgggttt atggaggggg atgcccctta tgctaaatat ctacgccgca ttgcggccga 9060

taagacgcat agcggctact tttccatcga caagaagagc aagcgcctca cagatcccaa 9120

agccgctgcg cgcggtgaaa atgcgggctt gtcggatgac gtagatgctt atgatctaat 9180

cctcaaagac aaggaacggt tattatcact agctgagccg gtgcgtttta tcttctcaca 9240

ctcggcctta cgtgagggct gggataaccc caacgtgttt gttatctgca cactcaagca 9300

tagtgataac accatttcac gccgccaaga ggtcgggcgc ggcctgcgtt tgtccgtcaa 9360

tcaaaatggt gaacgcatgg atcacccatc cattgttcat gacattaacg tactgacagt 9420

tgtggccagc gaaagttaca aggacttcgt gaccgccttg cagaaggaca ttagcgactc 9480

cttgtctgct cgcccgcgtg tggcggacaa ggcctacttc acgggcaaga tgctgaacac 9540

gaaggaaggc ccgattacgg tctcggacga ccaagccacg gacatcgagt tttatctgat 9600

ccagaatggc tacgtcgata agaagcgcaa tatcacagag aaataccacc aagctaagaa 9660

agacggcaca ttagaggcat tgccggacga gctgcagccc tatgcagagc aggtattcca 9720

gctgattaac agcgtattca gcgaaagcca gctcatgcag gtagaagatg gacgcaagcc 9780

caaaagactg cagaccaacg ccaactttga aaagcaggag ttcaaagcgc tgtgggggcg 9840

aatcaatcgc aaagctacct acagcgtact gtttgatgat gttgagctag tgaacaatgc 9900

gatcaaggcg ctcaatgata agaatgctgg gttacgagta acgccgttac aatacaccat 9960

tcaccgtggc aagcaggctg atacggcaac ttacgatgac ctcaaaaagg gtatcgcctt 10020

cgagctgaaa gttaccgaaa cagaatcgca caccgcctct atccactccg ctgtgcagta 10080

cgacttgatt ggtaagttat cagaggggac tttgcttaca agacgaacca ttgccgaaat 10140

tctaaaaggt ctccatgctg acgtcttcgc gcaattcaag agcaacccgg aaagtttcat 10200

tgccgaagtc attcgcttgg tcaacgaaca aaaggccaat gtcatcatcg agcatctggc 10260

ctatgacacg ctagaagaca agtttgattt ggacatcttt accacgggtc agagcaaaca 10320

ggatctcagt aaggctggga ataaattgca aaatcacatc tatgattacg tgcttaccga 10380

ctctgcaatt gagcgcaagt tcgtcgaaga gttggatacc agcaaggatg tggtggtata 10440

tgccaagttg ccacgtggtt ttctgatccc aacccctgtc ggcgattaca accccgactg 10500

ggctatttcc ttcaaagaag gctcggtcaa gcatgtgtat ttcgttgctg agaccaaggg 10560

ctcgatgtcg tcactggatt tacggcctat tgaagccacc aagattaaat gtgcccgtaa 10620

gttcttcgat gcggttaaca agacgtttgc tccagaaaac gtgaagtatg acgtagtgga 10680

tagcttcagt aagctgatgg aagtggtgaa gtaagattaa acccagccta ccattataaa 10740

ggtcggctgg ggtgtatgct gtacatatgc tatggtcctt gttggtgaag tgctcgtgaa 10800

aacacctaaa cggactggct gtttcctgtg tgaaattgtt atccgctcac aattccacac 10860

attatacgag ccgatgatta attgtcaaca gctcatttca gaatatttgc cagaaccgtt 10920

atgatgtcgg cgcaaaaaac attatccaga acgggagtgc gccttgagcg acacgaatta 10980

tgcagtgatt tacgacctgc acagccatac cacagcttcc gatggctgcc tgacgccaga 11040

agcattggtg caccgtgcag tcgatgataa gctgtcaaac atgagaattg tgcctaatga 11100

gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 11160

tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 11220

cgccagggtg gtttttcttt tcaccagtga gacgggcaac agctgattgc ccttcaccgc 11280

ctggccctga gagagttgca gcaagcggtc cacgctggtt tgccccagca ggcgaaaatc 11340

ctgtttgatg gtggttaacg gcgggatata acatgagctg tcttcggtat cgtcgtatcc 11400

cactaccgag atatccgcac caacgcgcag cccggactcg gtaatggcgc gcattgcgcc 11460

cagcgccatc tgatcgttgg caaccagcat cgcagtggga acgatgccct cattcagcat 11520

ttgcatggtt tgttgaaaac cggacatggc actccagtcg ccttcccgtt ccgctatcgg 11580

ctgaatttga ttgcgagtga gatatttatg ccagccagcc agacgcagac gcgccgagac 11640

agaacttaat gggcccgcta acagcgcgat ttgctggtga cccaatgcga ccagatgctc 11700

cacgcccagt cgcgtaccgt cttcatggga gaaaataata ctgttgatgg gtgtctggtc 11760

agagacatca agaaataacg ccggaacatt agtgcaggca gcttccacag caatggcatc 11820

ctggtcatcc agcggatagt taatgatcag cccactgacg cgttgcgcga gaagattgtg 11880

caccgccgct ttacaggctt cgacgccgct tcgttctacc atcgacacca ccacgctggc 11940

acccagttga tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg cgtgcagggc 12000

cagactggag gtggcaacgc caatcagcaa cgactgtttg cccgccagtt gttgtgccac 12060

gcggttggga atgtaattca gctccgccat cgccgcttcc actttttccc gcgttttcgc 12120

agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc tgataagaga caccggcata 12180

ctctgcgaca tcgtataacg ttactggttt cacattcacc accctgaatt gactctcttc 12240

cgggcgctat catgccatac cgcgaaaggt tttgcaccat tcgatggtgt cgggaattc 12299

Claims (10)

1. A bacterial Restriction-modification system (RM), said Restriction-modification system comprising a Restriction-modification complex enzyme, wherein said Restriction-modification complex enzyme consists of an R subunit and an M subunit, said R subunit being encoded by gene c5372 and having the amino acid sequence shown in SEQ ID No. 3; the M subunit is encoded by a gene c5373, and the amino acid sequence of the M subunit is shown as SEQ ID NO. 4.

2. The bacterial restriction-modification system according to claim 1, wherein the nucleotide sequences of gene c5372 encoding the R subunit and gene c5373 encoding the M subunit are shown in SEQ ID No.1 and SEQ ID No.2, respectively.

3. A recombinant plasmid carrying the bacterial restriction-modification system according to claim 1 or 2, comprising a fragment consisting of the gene c5372 encoding the R subunit, the gene c5373 encoding the M subunit, and a promoter region common to them.

4. The recombinant plasmid according to claim 3, wherein the fragment consisting of the gene c5372 encoding the R subunit, the gene c5373 encoding the M subunit and the promoter region common to them has the nucleotide sequence shown in SEQ ID NO. 5.

5. The recombinant plasmid according to claim 3 or 4, wherein the recombinant plasmid is constructed by:

(1) The primer sequences shown below were designed and synthesized:

Ptac-P53-RM53-F：ATGGGGCCCGCGGCCGCGGATCCGAAAGGGGCAAGCTGTAC

Ptac-P53-RM53-R：ACCAACAAGGACCATAGCATATGTACAGCATACACCCCAGC

(2) Obtaining of the insert

Using genome DNA of escherichia coli CFT073 as a template, using the synthesized primer, and carrying out PCR amplification by using Phanta mix of Nuo-wei company to obtain a fragment with homology arms and containing c5372 and c5373 genes and a promoter region common to the genes, wherein the fragment is named RM53 gene fragment, and the obtained sequence is shown as SEQ ID NO. 5;

(3) Construction and linearization of pGEN-Ptac vectors

1) Taking pGEN-mcs as an initial vector, and carrying out double-enzyme tangential linearization by using EcoRI and NdeI;

2) PCR amplification was performed using pMal-c2x as a template, lacIPtac-c2x-F/LacIPtac-c2x-R as a primer, and Phanta mix from Novain to obtain a lacI-Ptac double-element fragment with a homology arm;

LacIPtac-c2x-F：TCATTTTCTGAAACTCTTCATGCTGGAATTCCCGACACCATCGAATGGT

LacIPtac-c2x-R：GGCCGCGGATCCCGGTACCAAGCTTCATATGCTATGGTCCTTGTTGGTGAAG

3) Performing electrophoresis observation and rubber cutting recovery purification on the DNA product obtained in the steps 1) and 2) to obtain a standby carrier fragment and a lacI-Ptac double-element fragment with a homology arm;

4) Ligating the vector fragment obtained in step 3) with a lacI-Ptac duplex fragment having a homology arm;

5) Transferring the connection product obtained in the step 4) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

selecting a correct recombinant plasmid, naming the recombinant plasmid which is verified to be correct as pGEN-Ptac, and performing linearization by utilizing BamHI and NdeI double-enzyme digestion;

(4) Performing electrophoresis observation and rubber cutting recovery purification on the DNA products obtained in the steps (2) and (3) to obtain a standby pGEN-Ptac vector fragment and an RM53 gene fragment with a homology arm;

(5) Ligating the pGEN-Ptac vector fragment obtained in step (4) with the RM53 gene fragment having a homology arm;

(6) Transforming the ligation product obtained in the step (5) into DH5 competent cells, coating the transformant mixture on LB solid medium containing ampicillin, and culturing overnight;

(7) The recombinant plasmid which is verified to be correct is obtained by PCR amplification to verify the insertion of the fragment, namely, the recombinant plasmid carrying the bacterial restriction-modification system of claim 1 or 2.

6. The recombinant plasmid of claim 5, wherein the transformation in step (6) is performed by an electrotransformation method comprising the steps of: one time of electric shock at 2500V, adding 800. Mu.L of LB liquid medium to resuspend and resuscitate at 37 ℃ for 60min, centrifuging at 4000rpm for 3min, resuspending 100. Mu.L of supernatant to precipitate, spreading on LB solid medium with ampicillin concentration of 100. Mu.g/mL, and culturing overnight.

7. The recombinant plasmid of claim 5 wherein the step (7) is performed by PCR amplification to verify the insertion of the fragment, the steps comprising:

picking single colony, inoculating to LB liquid medium of ampicillin, shake culturing at 37deg.C for 12 hr, extracting to obtain recombinant plasmid DNA, taking the recombinant plasmid DNA as template, designing the following primers:

pMal-seq-F：TGGAATTGTGAGCGGATAAC

pGEN-seq-R：GTGGTCACGCTTTTCGTTGG

the insertion of the fragment was verified by PCR amplification under the following conditions: pre-denaturing at 95 ℃ for 5min, denaturing at 95 ℃ for 30s, annealing at 55 ℃ for 2min, extending at 72 ℃ for 5min, circularly amplifying for 30 times, and extending at 72 ℃ for 5min.

8. The recombinant plasmid of claim 5, wherein the recombinant plasmid is named pGEN-Ptac-RM and has the nucleotide sequence shown in SEQ ID NO. 6.

9. Use of the bacterial restriction-modification system of claim 1 or 2 for the preparation of a medicament against phage infection.

10. Use of the recombinant plasmid according to any one of claims 3-8 for the preparation of a medicament against phage infection.