CN111100831B

CN111100831B - Recombinant bacterium for producing L-carnitine and construction method and application thereof

Info

Publication number: CN111100831B
Application number: CN201811252374.7A
Authority: CN
Inventors: 林白雪; 梁秀君; 朴晓宇; 张莎莎; 陶勇
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2018-10-25
Filing date: 2018-10-25
Publication date: 2022-04-05
Anticipated expiration: 2038-10-25
Also published as: CN111100831A

Abstract

The invention discloses a recombinant bacterium for producing L-carnitine and a construction method and application thereof. The recombinant strain of the invention is a recombinant strain which can produce the L-carnitine by introducing the gene of the gamma-butyl betaine hydroxylase and the gene of the carnitine transporter into a receptor strain or a recombinant strain which can produce the L-carnitine by introducing the gene of the gamma-butyl betaine hydroxylase into the receptor strain; the recipient bacterium is mutant Escherichia coli or wild Escherichia coli. The invention realizes the production of L-carnitine in Escherichia coli, and improves the yield of L-carnitine by means of metabolic engineering.

Description

Recombinant bacterium for producing L-carnitine and construction method and application thereof

Technical Field

The invention relates to a recombinant bacterium for producing L-carnitine and a construction method and application thereof, belonging to the technical field of biology.

Background

L-carnitine (L-carnitine), also known as L-carnitine or transliteration carnitine, is an amino-like acid for promoting fat to be converted into energy, and red meat is a main source of the L-carnitine, has no toxic or side effect on human bodies, and is very easy to absorb moisture. The main physiological function of the L-carnitine is to promote fat to be converted into energy, and the L-carnitine can reduce body fat and weight without reducing water and muscle, so that the L-carnitine is considered as the most safe weight-reducing nutritional supplement without side effect by the international obesity health organization in 2003. The nutritional value, the medical value and the good market prospect of the L-carnitine attract the scientists of all countries in the world to carry out extensive and deep research on the L-carnitine.

Currently, only swiss, italy, japan, etc. are the major producers of l-carnitine in the world. Most of the L-carnitine in China still depends on import and is expensive, and a new development is urgently needed to be researched and developed so as to fill the domestic blank. Therefore, it is very important to continuously develop a new synthetic route of L-carnitine with low cost, high synthesis rate and easy realization of industrial production. L-carnitine is prepared by various methods, such as extraction from animal meat extract, biosynthesis, chemical synthesis and the like. The extraction method has low yield, multiple purification steps and high cost, and is difficult to form large-scale production. The chemical synthesis method mainly adopts 2 approaches: (1) firstly, preparing racemic carnitine, and separating out a levorotatory body by using a resolving agent; (2) different chemical substances are taken as raw materials for synthesis. The biosynthesis method for preparing L-carnitine mainly comprises two methods, namely a microbial fermentation method and an enzymatic conversion method.

The whole-cell biotransformation is an efficient and green biotransformation process, which is successfully applied to the industrial production of various products, and the whole-cell catalysis makes the enzyme more stable through the protection of cell walls, thereby making up the defect of unstable enzyme activity of in vitro enzyme method transformation. Therefore, the production of L-carnitine by a whole-cell catalysis method is worthy of intensive research.

Disclosure of Invention

The invention aims to solve the technical problem of providing a recombinant bacterium with high L-carnitine yield, a construction method and application thereof.

In order to solve the problems, the invention firstly provides a construction method of a recombinant bacterium for producing L-carnitine.

The construction method of the recombinant bacterium for producing L-carnitine provided by the invention comprises the following steps 1) or 2):

1) the method comprises the following steps: introducing a gamma-butyl betaine hydroxylase gene and a carnitine transporter gene into a receptor bacterium to obtain a recombinant bacterium for producing L-carnitine;

2) the method comprises the following steps: introducing a gamma-butyl betaine hydroxylase gene into a receptor bacterium to obtain a recombinant bacterium for producing L-carnitine;

the recipient bacterium is mutant Escherichia coli or wild Escherichia coli; the mutant Escherichia coli is any one of the following A1-A7:

a1, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1, a3 and a5, and is marked as Escherichia coli mutant S7;

a2, the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a5, and the mutant Escherichia coli is marked as an Escherichia coli mutant S6;

a3, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1, a2 and a3, and is marked as Escherichia coli mutant S5;

a4, the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a4, and the mutant Escherichia coli is marked as an Escherichia coli mutant S4;

a5, the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a3, and the mutant Escherichia coli is marked as an Escherichia coli mutant S3;

a6, the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a2, and the mutant Escherichia coli is marked as an Escherichia coli mutant S2;

a7, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and is recorded as an Escherichia coli mutant S1;

a1, knocking out an alpha-ketoglutarate dehydrogenase gene (sucA) in the genome of the wild type Escherichia coli;

a2, knocking out an isocitrate lyase gene (aceA) in the genome of the wild type Escherichia coli;

a3, replacing pyruvate oxidase gene (poxB) in the genome of said wild-type E.coli with acetyl-CoA synthetase gene (acs);

a4, knocking out a caiABCDE gene cluster consisting of a crotonobetaine reductase gene (caiA), a betaine/carnitine coenzyme A transferase gene (caiB), a coenzyme A ligase gene (caiC), a crotonobetaine CoA hydratase gene (caiD), a carnitine racemase and a carnitine dehydratase activity inducing gene (caiE) in the wild type escherichia coli genome;

a5, knocking out a cai TABCDE gene cluster consisting of a carnitine transporter gene (caiT), a crotonobetaine reductase gene (caiA), a betaine/carnitine coenzyme A transferase gene (caiB), a coenzyme A ligase gene (caiC), a crotonobetaine CoA hydratase gene (caiD), a carnitine racemase and a carnitine dehydratase activity inducing gene (caiE) in the wild type escherichia coli genome, and knocking out an operon fixABCX gene cluster at the upstream of the cai TABCDE gene cluster.

Both knockouts and substitutions in the above methods can be accomplished by those skilled in the art using means well known in the art, and also through the use of creative efforts. In a specific embodiment of the invention, both said knockout and said substitution are effected by homologous recombination.

Further, the protein encoded by the γ -butylbetaine hydroxylase gene introduced into the recipient bacterium is a protein represented by b1) or b 2):

b1) a protein consisting of an amino acid sequence shown in SEQ ID No. 1;

b2) protein derived from b1) having gamma-butylbetaine hydroxylase activity, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 1;

the protein encoded by the carnitine transporter gene introduced into the recipient bacterium is a protein represented by b3) or b 4):

b3) a protein consisting of an amino acid sequence shown in SEQ ID No. 3;

b4) a protein derived from b3) having carnitine transporter activity, obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 3;

the protein coded by the alpha-ketoglutarate dehydrogenase gene is the protein shown by c1) or c 2):

c1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73820.1;

c2) protein derived from c1) and having alpha-ketoglutarate dehydrogenase activity, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as GenBank number AAC 73820.1;

the protein coded by the isocitrate lyase gene is d1) or d 2):

d1) a protein consisting of an amino acid sequence shown in GenBank number AAC 76985.1;

d2) protein derived from d1) having isocitrate lyase activity obtained by substituting and/or deleting and/or adding one or several amino acid residues in the amino acid sequence shown in GenBank number AAC 76985.1;

the protein coded by the acetyl coenzyme A synthetase gene is a protein shown by e1) or e 2):

e1) a protein consisting of an amino acid sequence shown in GenBank number AAC 77039.1;

e2) a protein derived from e1) having acetyl-coa synthetase activity, which is obtained by substituting and/or deleting and/or adding one or several amino acid residues in an amino acid sequence represented by GenBank number AAC 77039.1;

the protein coded by the pyruvate oxidase gene is g1) or g 2):

g1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73958.1;

g2) protein derived from g1) and having pyruvate oxidase activity, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as GenBank number AAC 73958.1;

the protein coded by the crotonobetaine reductase gene is h1) or h 2):

h1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73150.1;

h2) protein derived from h1) and having crotonobetaine reductase activity, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown in GenBank number AAC 73150.1;

the protein coded by the betaine/carnitine coenzyme A transferase gene is a protein shown in i1) or i 2):

i1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73149.1;

i2) protein derived from i1) and having betaine/carnitine coenzyme A transferase activity, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as GenBank number AAC 73149.1;

the protein coded by the coenzyme A ligase gene is protein shown in j1) or j 2):

j1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73148.2;

j2) a protein derived from j1) having coenzyme A ligase activity obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown in GenBank number AAC 73148.2;

the protein coded by the crotonobetaine CoA hydratase gene is k1) or k 2):

k1) a protein consisting of an amino acid sequence shown in GenBank number AAC 73147.2;

k2) protein derived from k1) having crotonobetaine CoA hydratase activity obtained by substituting and/or deleting and/or adding one or several amino acid residues in the amino acid sequence represented by GenBank number AAC 73147.2;

the protein coded by the carnitine racemase and carnitine dehydratase activity induction gene is l1) or l 2):

l1) is protein composed of amino acid sequence shown in GenBank number AAC 73146.2;

l2) protein derived from l1) having the activity of inducing the activity of carnitine racemase and carnitine dehydratase, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in GenBank number AAC 73146.2;

the protein coded by the fixA gene in the fixaBCX gene cluster is m1) or m 2):

m1) is protein composed of amino acid sequence shown in GenBank number AAC 73146.2;

m2) is protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown as GenBank number AAC73146.2 and has the activity of the fibA protein and is derived from m 1);

the protein coded by the fixB gene in the fixABCX gene cluster is n1) or n 2):

n1) is protein composed of amino acid sequence shown in GenBank number AAC 73153.1;

n2) is protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as GenBank number AAC73153.1 and has the activity of the fixB protein and is derived from n 1);

the protein coded by the fixC gene in the fixABCX gene cluster is p1) or p 2):

p1) is protein composed of amino acid sequence shown in GenBank number AAC 73154.1;

p2) is protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as GenBank number AAC73154.1 and has the activity of the fixC protein and is derived from p 1);

the protein coded by the fixX gene in the fixxABCX gene cluster is the protein shown in q1) or q 2):

q1) is protein composed of amino acid sequence shown as GenBank number ACC 73155.1;

q2) is obtained by substituting and/or deleting and/or adding one or more amino acid residues in an amino acid sequence shown as the GenBank number ACC73155.1, and has the activity of the protein derived from q 1).

Further, the γ -butyrobetaine hydroxylase gene introduced into the recipient bacterium is any one of DNA molecules b11) -b 13):

b11) a cNDA molecule or genomic DNA of SEQ ID No 2;

b12) a cDNA molecule or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined in b11) and encodes said γ -butyrobetaine hydroxylase;

b13) a cDNA molecule or genomic DNA having more than 90% identity with the DNA molecule defined in b11) or b12) and encoding said gamma-butyrobetaine hydroxylase;

the carnitine transporter gene introduced into the recipient bacterium is any one of DNA molecules b31) -b 33):

b31) a cNDA molecule or genomic DNA of SEQ ID No. 4;

b32) a cDNA molecule or genomic DNA that hybridizes under stringent conditions to the DNA molecule defined in b31) and encodes the carnitine transporter;

b33) a cDNA molecule or genomic DNA having more than 90% identity to the DNA molecule defined in b31) or b32) and encoding the carnitine transporter;

the alpha-ketoglutarate dehydrogenase gene is any one DNA molecule of c11) -c 13):

c11) a cNDA molecule or genomic DNA as shown in the 758706-761507 position of the genomic sequence of Escherichia coli K12;

c12) a cDNA molecule or genomic DNA hybridizing under stringent conditions with the DNA molecule defined in c11) and encoding said α -ketoglutarate dehydrogenase;

c13) a cDNA molecule or genomic DNA having 90% or more identity to a DNA molecule defined in c11) or c12) and encoding said α -ketoglutarate dehydrogenase;

the isocitrate lyase gene is any one of d11) -d 13):

d11) the cNDA molecule or genomic DNA as shown in the 4217109-4218413 of the genomic sequence of Escherichia coli K12;

d12) a cDNA molecule or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined under d11) and codes for the isocitrate lyase;

d13) a cDNA molecule or genomic DNA having more than 90% identity to the DNA molecule defined by d11) or d12) and encoding said isocitrate lyase;

the acetyl-CoA synthetase gene is any one of DNA molecules of e11) -e 13):

e11) a cNDA molecule or genomic DNA as shown in the 4285413-4287371 of the genomic sequence of Escherichia coli K12;

e12) a cDNA molecule or genomic DNA hybridizing under stringent conditions with a DNA molecule defined in e11) and encoding said acetyl-coa synthetase;

e13) a cDNA molecule or genomic DNA having 90% or more identity to a DNA molecule defined in e11) or e12) and encoding said acetyl-coa synthetase;

the pyruvate oxidase gene is any one DNA molecule of g11) -g 13):

g11) a cNDA molecule or genomic DNA as shown in the 909331-911049 th site of the genome sequence of Escherichia coli K12;

g12) a cDNA molecule or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined in g11) and encodes said pyruvate oxidase;

g13) a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in g11) or g12) and encoding said pyruvate oxidase;

the crotonobetaine reductase gene is any one DNA molecule of h11) -h 13):

h11) a cNDA molecule or genomic DNA as shown in 39244-40386 of the genomic sequence of Escherichia coli K12;

h12) a cDNA molecule or genomic DNA which hybridizes under stringent conditions with the DNA molecule defined in h11) and encodes said crotonobetaine reductase;

h13) a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined by h11) or h12) and encoding said crotonobetaine reductase;

the betaine/carnitine coenzyme A transferase gene is any one of DNA molecules i11) -i 13):

i11) a cNDA molecule or genomic DNA as shown in the 37898-39115 th site of the genome sequence of Escherichia coli K12;

i12) a cDNA molecule or genomic DNA that hybridizes under stringent conditions to a DNA molecule defined in i11) and encodes the betaine/carnitine coa transferase;

i13) a cDNA molecule or genomic DNA having more than 90% identity to a DNA molecule defined in i11) or i12) and encoding the betaine/carnitine coa transferase;

the coenzyme A ligase gene is any one DNA molecule of j11) -j 13):

j11) a cNDA molecule or genomic DNA as shown in the 36271-37824 of the genomic sequence of Escherichia coli K12;

j12) a cDNA molecule or genomic DNA that hybridizes under stringent conditions to the DNA molecule defined in j11) and encodes the coa ligase;

j13) a cDNA molecule or genomic DNA having 90% or more identity to the DNA molecule defined in j11) or j12) and encoding the coa ligase;

the crotonobetaine CoA hydratase gene is any one DNA molecule of k11) -k 13):

k11) a cNDA molecule or genomic DNA shown in 35377-36162 of the genome sequence of Escherichia coli K12;

k12) a cDNA molecule or genomic DNA hybridizing under stringent conditions to the DNA molecule defined in k11) and encoding said crotonobetaine CoA hydratase;

k13) a cDNA molecule or genomic DNA having 90% or more identity to a DNA molecule defined by k11) or k12) and encoding said crotonobetaine CoA hydratase;

the carnitine racemase and carnitine dehydratase activity induction gene is any one DNA molecule of l11) -l 13):

l11) the cNDA molecule or genomic DNA indicated at positions 34781-35371 of the genomic sequence of Escherichia coli K12;

l12) cDNA molecules or genomic DNA which hybridize under stringent conditions with the DNA molecules defined in l11) and which code for carnitine racemase and carnitine dehydratase activity inducing protein;

l13) has more than 90% identity with the DNA molecule defined in l11) or l12) and encodes a cDNA molecule or genomic DNA of carnitine racemase and carnitine dehydratase activity inducing protein;

the fixABCX gene cluster gene is any one DNA molecule of m11) -m 13):

m11) the cNDA molecule or genomic DNA indicated at positions 42403-45750 of the genomic sequence of Escherichia coli K12;

m12) under stringent conditions with the DNA molecule defined in m11) and encoding a cDNA molecule or genomic DNA of the fibABCX gene cluster;

m13) and m11) or m12) and encoding a cDNA molecule or genomic DNA of the fibxABCX gene cluster.

The above stringent conditions are hybridization and washing of the membrane 2 times 5min at 68 ℃ in a solution of 2 XSSC, 0.1% SDS, and hybridization and washing of the membrane 2 times 15min at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS; alternatively, hybridization was carried out at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS, and the membrane was washed.

The above "identity" refers to sequence similarity to a native nucleic acid sequence. Includes nucleotide sequences having 90% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity to the nucleotide sequences of the present invention encoding the above proteins. "identity" can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In the above method, 1) wherein the γ -butylbetaine hydroxylase gene and the carnitine transporter gene are introduced into the recipient bacterium via a recombinant expression vector containing expression cassettes for the γ -butylbetaine hydroxylase gene and the carnitine transporter gene. The expression cassette of the gamma-butylbetaine hydroxylase gene and the carnitine transporter gene refers to DNA capable of expressing the gamma-butylbetaine hydroxylase gene and the carnitine transporter gene in a host cell, and the DNA can comprise a promoter for starting the transcription of the gamma-butylbetaine hydroxylase gene and the carnitine transporter gene and a terminator for stopping the transcription of the gamma-butylbetaine hydroxylase gene and the carnitine transporter gene. Further, the expression cassette may also include an enhancer sequence. Further, the promoter that initiates transcription of the γ -butylbetaine hydroxylase gene and carnitine transporter gene is the pBAD promoter.

In one embodiment of the invention, the γ -butyl betaine hydroxylase gene and the carnitine transporter gene are introduced into the recipient bacterium via recombinant vector pYB1 a-BBOX-caiT. The recombinant vector pYB 1-1 a-BBOX-caiT is a vector obtained by replacing a fragment between enzyme cutting sites of Bgl II and Pst I of a pYB1a vector with a gamma-butyl betaine hydroxylase gene shown in SEQ ID No.2, replacing a fragment between sites of Pst I and EcoR I with a carnitine transporter caiT gene shown in SEQ ID No.4 and keeping other sequences of a pYB1a vector unchanged.

In the above 2), the γ -butylbetaine hydroxylase gene is introduced into the recipient bacterium via a recombinant expression vector containing an expression cassette for the γ -butylbetaine hydroxylase gene. The expression cassette of the gamma-butyl betaine hydroxylase gene refers to DNA capable of expressing the gamma-butyl betaine hydroxylase gene in a host cell, and the DNA not only can comprise a promoter for starting the transcription of the gamma-butyl betaine hydroxylase gene, but also can comprise a terminator for stopping the transcription of the gamma-butyl betaine hydroxylase gene. Further, the expression cassette may also include an enhancer sequence. Further, the promoter that initiates transcription of the γ -butylbetaine hydroxylase gene and carnitine transporter gene is the pBAD promoter.

In another embodiment of the invention, the gamma-butyl betaine hydroxylase gene is introduced into the recipient bacterium via recombinant vector pYB1 a-BBOX; the recombinant vector pYB 1-1 a-BBOX is obtained by replacing a fragment between enzyme cutting sites of Bgl II and Pst I of the pYB1a vector with a gamma-butyl betaine hydroxylase gene shown in SEQ ID No.2 and keeping other sequences of the pYB1a vector unchanged.

In the 1) and the 2), the nucleotide sequence of the pBAD promoter is the same as that in the patent CN 104805047.

In the above method, the wild type Escherichia coli is Escherichia coli K12.

The escherichia coli mutant S1 is an escherichia coli K12 mutant which is obtained by knocking out (deleting) the alpha-ketoglutarate dehydrogenase gene (sucA) of escherichia coli K12 by replacing the alpha-ketoglutarate dehydrogenase gene (sucA) of escherichia coli K12 with a kanamycin resistance gene with FRT sites at two ends.

The escherichia coli mutant S2 is an escherichia coli K12 mutant in which an isocitrate lyase gene (aceA) of the escherichia coli mutant S1 is replaced with a kanamycin-resistant gene having FRT sites at both ends thereof, so that the isocitrate lyase gene (aceA) of the escherichia coli mutant S1 is knocked out (deleted).

The escherichia coli mutant S3 is an escherichia coli K12 mutant obtained by replacing a pyruvate oxidase gene (poxB) of an escherichia coli mutant S1 with an acetyl coenzyme A synthetase gene (acs) and a kanamycin resistance gene.

The escherichia coli mutant S4 is an escherichia coli K12 mutant obtained by replacing the entire gene cluster composed of the crotonobetaine reductase gene (caiA), the betaine/carnitine coenzyme a transferase gene (caiB), the coenzyme a ligase gene (caiC), the crotonobetaine CoA hydratase gene (caiD), the carnitine racemase and the carnitine dehydratase activity inducing gene (caiE) of S1 Δ kan (the kanamycin-resistant gene-deleted escherichia coli mutant S1) with a kanamycin-resistant gene.

The escherichia coli mutant S5 is an escherichia coli K12 mutant obtained by replacing a pyruvate oxidase gene (poxB) of an escherichia coli mutant S2 with an acetyl coenzyme A synthetase gene (acs) and a kanamycin resistance gene.

The escherichia coli mutant S6 is an escherichia coli K12 mutant obtained by replacing the carnitine transporter gene (caiT) of S1 delta kan, the crotonobetaine reductase gene (caiA), the betaine/carnitine coenzyme A transferase gene (caiB), the coenzyme A ligase gene (caiC), the crotonobetaine CoA hydratase gene (caiD), the carnitine racemase and carnitine dehydratase activity inducing gene (caiE) and the upstream operon gene cluster (fixABCX) with a kanamycin resistance gene in a whole.

The escherichia coli mutant S7 is an escherichia coli K12 mutant obtained by replacing a pyruvate oxidase gene (poxB) of an escherichia coli mutant S6 with an acetyl coenzyme A synthetase gene (acs) and a kanamycin resistance gene.

In order to solve the technical problems, the invention also provides the recombinant bacterium for producing the L-carnitine prepared by the method.

In the specific embodiment of the invention, the recombinant bacteria for producing L-carnitine are specifically recombinant bacteria S/1-BBOX-caiT obtained by introducing 1-BBOX-caiT into the Escherichia coli mutant S, pYB1 recombinant bacteria S7/pYB1a-BBOX-caiT obtained by introducing 1a-BBOX-caiT into the Escherichia coli mutant S7, recombinant bacteria S7/pYB1a-BBOX-caiT obtained by introducing pYB1a-BBOX-caiT into the Escherichia coli mutant S7, recombinant bacteria K12/pYB1a-BBOX obtained by introducing pYB1a-BBOX into wild type Escherichia coli K12, recombinant bacteria S1/pYB1a-BBOX obtained by introducing pYB1a-BBOX into the Escherichia coli mutant S1, and recombinant bacteria K12/pYB1a-BBOX obtained by introducing pYB1a-BBOX-caiT into wild type Escherichia coli K12.

The application of the recombinant bacterium for producing L-carnitine prepared by the method in the preparation of L-carnitine also belongs to the protection scope of the invention.

In order to solve the above technical problems, the present invention finally provides a method for preparing L-carnitine.

The method for preparing the L-carnitine comprises the steps of carrying out arabinose induction culture on the recombinant bacteria for producing the L-carnitine to obtain induced recombinant bacteria, and catalyzing gamma-butyl betaine by the induced recombinant bacteria to obtain the L-carnitine.

In the method for preparing L-carnitine, the arabinose induction culture is performed in a culture medium with arabinose concentration of 0.2g/100mL, the temperature of the induction culture can be 20-37 ℃, and the time of the induction culture can be 10-30 hours.

Further, the temperature of the induction culture may be 30 to 37 ℃ (e.g., 30 ℃), and the induction culture time may be 12 to 20 hours (e.g., 16 hours).

Experiments prove that the yield of the L-carnitine of the recombinant strain of the L-carnitine prepared by the invention is 30mM-50mM, and the method specifically comprises the following steps: the L-carnitine yield of S1/pYB1a-BBOX-caiT is 30.62mM, the L-carnitine yield of S2/pYB1a-BBOX-caiT is 34.21mM, the L-carnitine yield of S3/pYB1a-BBOX-caiT is 39.99mM, the L-carnitine yield of S4/pYB1a-BBOX-caiT is 37.37mM, the L-carnitine yield of S5/pYB1a-BBOX-caiT is 31.06mM, the L-carnitine yield of S6/pYB1a-BBOX-caiT is 39.55mM, and the L-carnitine yield of S7/pYB1a-BBOX-caiT is 50.67 mM. The invention realizes the production of the L-carnitine in the escherichia coli, and solves the supply and circulation of cofactors in the synthesis of the L-carnitine through the metabolic engineering transformation, thereby improving the yield of the L-carnitine.

Drawings

FIG. 1 is a physical map of pYB1 a.

FIG. 2 shows the PCR verification of S4 and S6. FIG. 2a shows the PCR verification of S4. FIG. 2b shows the PCR verification of S6. M: marker.

FIG. 3 shows the results of electrophoresis detection of the expression of gamma-butylbetaine hydroxylase protein and the expression of carnitine transporter in engineering bacteria. M: protein molecular weight standards; 1: disruption supernatant of K12/pYB1 a-BBOX; 2: S1/pYB1 a-BBOX; 3: disruption supernatant of K12/pYB1 a-BBOX-caiT; 4: S1/pYB1a-BBOX-caiT disruption supernatant; 5: S2/pYB1a-BBOX-caiT disruption supernatant; 6: S3/pYB1a-BBOX-caiT disruption supernatant; 7: S4/pYB1a-BBOX-caiT disruption supernatant; 8: S5/pYB1a-BBOX-caiT disruption supernatant; 9: S6/pYB1a-BBOX-caiT disruption supernatant; 10: S7/pYB1a-BBOX-caiT disruption supernatant.

FIG. 4 is an HPLC chromatogram of an L-carnitine standard.

FIG. 5 is an HPLC chromatogram of the catalytic conversion product of S7/pYB1a-BBOX-caiT whole cells.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Coli K12 is described in the literature "Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H: restriction of Escherichia coli K-12in-frame, single-gene knockout variants: the Keio collection. mol Syst Biol 2006,2: 2006.0008", as a non-pathogenic bacterium, with clear genetic background, short generation time, easy cultivation and inexpensive culture medium raw materials. The GenBank Accession of the whole genome sequence of Escherichia coli K12 was U00096.3 (GI: 545778205, update date AUG 01, 2014, version 3). The biological material is only used for repeating the relevant experiments of the present invention and is not used for other purposes.

The nucleotide sequence of the pYB1a vector in the following examples is shown as SEQ ID No.5, the map of the vector is shown in FIG. 1, and the vector comprises the following fragments: (1) araC-araBAD-MCS fragment (containing arabinose inducible promoter, multiple cloning site); (2) p15A replication origin fragment; (3) ampicillin resistance gene AmpR fragment.

The genotypes of the E.coli mutants in the following examples are shown in Table 1. Coli mutants S1, S2, S3 and S5 are described in CN104805047 and in the documents "Baixue Lin, Keqiang Fan, Jian Zhao, Junjie Ji, Linjun Wu, Keqian Yang, Yong Tao. Reconstation of TCA cycle with DAOCS to engineering E.coli in an effective cell system of pending fungi G.Proc Natl Acad Sci U A112 (32):9855-9 (2015)", and are publicly available from the institute of microorganisms, which are used only for repeating the experiments related to the present invention and are not used for other purposes.

TABLE 1 genotype of E.coli mutants

Bacterial strains	Traits
		S1	△sucA::kan
S2	△sucA△aceA::kan
		S3	△sucA△poxB::acs-kan
S4	△sucA△caiABCDE::kan
		S5	△sucA△poxB::acs△aceA::kan
S6	△sucA△caiTABCDE△fixABCX::kan
		S7	△sucA△poxB::acs△caiTABCDE△fixABCX::kan

The protein and gene sequences referred to in the following examples are as follows:

alpha-ketoglutarate dehydrogenase gene (sucA) sequences as EcoGene: EG10979 (consisting of 2802 nucleotides), GenBank of the amino acid sequence of α -ketoglutarate dehydrogenase encoded by the α -ketoglutarate dehydrogenase gene: AAC73820.1 (consisting of 933 amino acids);

isocitrate lyase gene (aceA) sequences as described in EcoGene: EG10022 (consisting of 1305 nucleotides), GenBank of the amino acid sequence of isocitrate lyase encoded by the isocitrate lyase gene: AAC76985.1 (consisting of 434 amino acids);

acetyl-coa synthetase gene (acs) sequences as EcoGene: EG11448 (consisting of 1959 nucleotides), GenBank of amino acid sequence of acetyl-coa synthetase encoded by acetyl-coa synthetase gene: AAC77039.1 (consisting of 652 amino acids);

pyruvate oxidase gene (poxB) sequences such as EcoGene: EG10754 (consisting of 1719 nucleotides), GenBank of the amino acid sequence of pyruvate oxidase encoded by pyruvate oxidase gene: AAC73958.1 (consisting of 572 amino acids);

crotonobetaine reductase gene (caiA) sequences as described in EcoGene: EG11560 (consisting of 1143 nucleotides), GenBank of the amino acid sequence of crotonobetaine reductase encoded by crotonobetaine reductase gene: AAC73150.1 (consisting of 380 amino acids).

Betaine/carnitine coa transferase gene (caiB) sequences as described by EcoGene: EG11559 (consisting of 1218 nucleotides), GenBank of amino acid sequence of betaine/carnitine coa transferase encoded by betaine/carnitine coa transferase gene: AAC73149.1 (consisting of 405 amino acids).

Coenzyme A ligase gene (caiC) sequences such as EcoGene: EG11558 (consisting of 1554 nucleotides), GenBank of the amino acid sequence of coa ligase encoded by the coa ligase gene: AAC73148.2 (consisting of 517 amino acids).

Crotonobetaine CoA hydratase gene (caiD) sequences such as EcoGene: EG11557 (consisting of 786 nucleotides), GenBank of the amino acid sequence of crotonobetaine CoA hydratase encoded by the crotonobetaine CoA hydratase gene: AAC73147.2 (consisting of 261 amino acids).

Carnitine racemase and carnitine dehydratase activity inducing gene (caiE) sequences as EcoGene: EG12608 (consisting of 591 nucleotides), GenBank of amino acid sequences of carnitine racemase and carnitine dehydratase activity-inducing proteins encoded by carnitine racemase and carnitine dehydratase activity-inducing genes: AAC73146.2 (consisting of 196 amino acids).

The sequence of the fixABCX gene cluster gene is shown as 42403-45750 th site of the genome sequence of Escherichia coli K12 (consisting of 3348 nucleotides), and the GenBank of the amino acid sequence of the fixABCX gene cluster encoded by the sequence of the fixABCX gene cluster gene is AAC73152.2, AAC73153.1, AAC73154.1 and AAC73155.1 (consisting of 256, 313, 428 and 95 amino acids respectively).

Example 1 construction of recombinant plasmid pYB1a-BBOX expressing gamma-butylbetaine hydroxylase

Recombinant plasmid pYB1a-BBOX expressing gamma-butylbetaine hydroxylase was constructed. The method comprises the following specific steps:

1. taking a synthesized gamma-butyl betaine hydroxylase gene (shown as SEQ ID No. 2) as a template, and adopting a primer pair PsVLB120-BBOX-F (Bgl II): AGCCTCGAGGGTAGATCTATGGGTAACGCAATTGCTGA and PsVLB120-BBOX-R (EcoR I): CAGACCGAGCTCACCGAATTCTTAACGTTGCAGCACCAGGA PCR amplification is carried out to obtain the coding gene of gamma-butyl betaine hydroxylase (BBOX).

The PCR conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 sec; 55 ℃ for 30sec (30 cycles); 72 ℃ for 1 min; 72 ℃ for 5 min. The fragment size was about 1190bp, as determined by 1% agarose gel electrophoresis, and was identical to the target fragment.

2. And (3) carrying out enzyme digestion on the BBOX gene obtained in the step (1) by using Bgl II and EcoR I, and recovering a BBOX gene fragment.

3. The pYB1a vector was digested with Bgl II and EcoR I, and the large fragment of the vector was recovered.

4. The BBOX gene fragment recovered in step 2 and the vector large fragment recovered in step 3 were ligated by the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA,3rd, Smith HO: Enzymatic association of DNA molecules up to specific and cloned genetic libraries Nat Methods 2009, 6:343 and 345.), and the ligation products were transformed into T1 competent cells (Beijing hologold organism, catalog # LB 501) and plated on a solid LB plate containing ampicillin. Overnight at 37 ℃, the single clone was picked to extract the plasmid, PCR verified, and the correct clone was sequenced. The recombinant plasmid with the correct sequencing was designated recombinant vector pYB1 a-BBOX.

The recombinant vector pYB1a-BBOX is obtained by replacing the fragment between the Bgl II and Pst I enzyme cutting sites of the pYB1a vector with the gamma-butyl betaine hydroxylase gene shown in SEQ ID No.2 and keeping other sequences of the pYB1a vector unchanged. The gene sequence of the gamma-butyl betaine hydroxylase shown in SEQ ID No.2 (consisting of 1158 nucleotides) codes for the gamma-butyl betaine hydroxylase shown in SEQ ID No.1 (consisting of 385 amino acids). Wherein, the promoter for starting the transcription of the gamma-butyl betaine hydroxylase gene is a pBAD promoter.

Example 2 construction of recombinant plasmid pYB1a-BBOX-caiT expressing gamma-butylbetaine hydroxylase and carnitine transporter

Recombinant plasmid pYB 1-1 a-BBOX-caiT expressing gamma-butylbetaine hydroxylase and carnitine transporter was constructed. The method comprises the following specific steps:

1. BW25113 genome as template, primer pair PsVLB120-BBOX-caiT-F (EcoR I)： CTGGTGCTGCAACGTTAAGAATTCAAGGAGATATAATGAAGAATGAAAAGAG and PsVLB120-BBOX-CaiT-R (pst I): GGCTGCCGCGCGGCACCAGCTGCAGTTAATCTTTCCAGTTCTGTT was amplified by PCR to obtain the coding gene for the transporter CaiT (caiT).

The PCR conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 sec; 55 ℃ for 30sec (30 cycles); 72 ℃ for 1 min; 72 ℃ for 5 min. The fragment size was about 1500bp, as determined by 1% agarose gel electrophoresis, and was consistent with the target fragment.

2. And (3) digesting the caiT gene obtained in the step (1) by using EcoR I and Pst I, and then recovering a caiT gene fragment.

3. After the recombinant vector pYB1a-BBOX obtained in example 1 was digested with EcoR I and Pst I, a pYB1a-BBOX large fragment was recovered.

4. The caiT gene fragment recovered in step 2 was ligated to the pYB1a-BBOX large fragment recovered in step 3 using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA,3rd, Smith HO: Enzymatic assembly of DNA molecules up to segmented human cloned murine 2009. Nat Methods 2009, 6: 343-. Overnight at 37 ℃, single clones were picked for plasmid extraction, verified, and the correct clones were sequenced. The recombinant plasmid with the correct sequencing was designated recombinant vector pYB1 a-BBOX-caiT.

The recombinant vector pYB1a-BBOX-caiT is a vector obtained by replacing the fragment between the enzyme cutting sites of Bgl II and Pst I of the pYB1a vector with gamma-butyl betaine hydroxylase gene shown in SEQ ID No.2, replacing the fragment between Pst I and EcoR I sites with carnitine transporter caiT gene shown in SEQ ID No.4, and keeping the other sequences of the pYB1a vector unchanged. The gene sequence of the gamma-butyl betaine hydroxylase shown in SEQ ID No.2 (consisting of 1158 nucleotides) codes for the gamma-butyl betaine hydroxylase shown in SEQ ID No.1 (consisting of 385 amino acids); the carnitine transporter CaiT gene sequence shown in SEQ ID No.4 (consisting of 1515 nucleotides) encodes the carnitine transporter shown in SEQ ID No.3 (consisting of 504 amino acids). Recombinant vector pYB 1-1 a-BBOX-caiT expresses a fusion protein of gamma-butylbetaine hydroxylase and carnitine transporter. Wherein, the promoter for starting the transcription of the gamma-butyl betaine hydroxylase gene and the carnitine transporter gene is a pBAD promoter.

Example 3 construction of E.coli mutants S1, S2, S3, S4, S5, S6, S7

In this example, different single gene knockouts of E.coli K12 were performed to construct S1, S2, S3, S4, S5, S6, S7 E.coli mutants.

Construction of Escherichia coli mutants S1, S2, S3 and S5

Coli mutants S1, S2, S3 and S5 are e.coli mutants PG01, PG16, PG03 and PG05 described in patent CN104805047, respectively. The specific construction method is shown in the patent CN 104805047.

The E.coli mutant S1 is an E.coli K12 mutant obtained by knocking out (deleting) the alpha-ketoglutarate dehydrogenase gene (sucA) of E.coli K12 by replacing the alpha-ketoglutarate dehydrogenase gene (sucA) of E.coli K12 with a kanamycin-resistant gene having FRT sites at both ends. S1. DELTA.kan is an E.coli mutant S1 in which the kanamycin resistance gene was deleted.

The E.coli mutant S2 is an E.coli K12 mutant obtained by knocking out (deleting) the isocitrate lyase gene (aceA) of the E.coli mutant S1 by replacing the isocitrate lyase gene (aceA) of the E.coli mutant S1 with a kanamycin-resistant gene having FRT sites at both ends.

The E.coli mutant S3 is an E.coli K12 mutant obtained by replacing the pyruvate oxidase gene (poxB) of the E.coli mutant S1 with the acetyl-CoA synthetase gene (acs) and the kanamycin-resistant gene.

Second, construction of E.coli mutant S4

The E.coli mutant S4 is an E.coli K12 mutant obtained by replacing the entire gene cluster composed of the crotonobetaine reductase gene (caiA), the betaine/carnitine coenzyme A transferase gene (caiB), the coenzyme A ligase gene (caiC), the crotonobetaine CoA hydratase gene (caiD), the carnitine racemase and the carnitine dehydratase activity inducing gene (caiE) of S1. delta. kan (E.coli mutant S1 in which the kanamycin resistance gene is deleted) with a kanamycin resistance gene. The specific construction method comprises the following steps:

1. preparation of host bacterium

The kanamycin resistance gene in the E.coli mutant S1 was deleted to obtain the E.coli mutant S1. delta. kan (abbreviated as S1. delta. kan). The specific deletion method is as follows: first, S1 was chemically transformed with a plasmid pCP20 (available from Clontech) expressing Flp recombinase, and the kanamycin resistance gene between the FRT sites of S1 was deleted to knock out the kanamycin resistance of S1, thereby giving an E.coli mutant S1 Δ kan (abbreviated as S3 Δ kan). S1 Δ kan did not grow on kanamycin-coated LB plates (kanamycin concentration 50. mu.g/mL), indicating that kanamycin resistance of S1 had been eliminated.

The plasmid pKD46 (purchased from Clontech) was transformed into a kanamycin-resistant E.coli mutant S1. delta. kan (S1. delta. kan for short) by chemical transformation to obtain recombinant E.coli pKD 46/S1. delta. kan containing the plasmid pKD 46. After the recombinant Escherichia coli pKD46/S1 delta kan is induced by arabinose, recombinant proteins of lambda phage are expressed, and the host bacteria have the capacity of homologous recombination.

2. Construction of S4

Using pKD13 plasmid (purchased from Clontech) as a template, the primer caiAup-Red-F was used: agaactggaaagattaattaacccccaaaatatcaagaggttgaaagatgattccggggatccgtcgacc and a downstream primer caiEdown-Red-R: atccagcaaccaggtcgcatccggcaagatcaccgtttaggcgtcacagaagttcctatactttctagag PCR amplification was performed to obtain a 1382bp caiAup-kan-caiEdown targeting fragment. The obtained caiAup-kan-caiEdown fragment was electroporated into the recombinant E.coli pKD 46/S1. delta. kan competent cells obtained in step 1, and positive clones were selected on an LB plate containing kanamycin (kanamycin concentration: 50. mu.g/mL). PCR verification was performed using caiA-up567-F (tatgcttatccagatcgatctcc) and caiE-d326-R (cagaaaataagctgcgaagttaag) (the primer binding sites were the upstream region of the caiA gene and the downstream region of the caiE gene, respectively, and the amplified product size of the positive clone was 2300bp), and the PCR identification results were shown in FIG. 2a, and the correct clones were sequenced. The correctly sequenced clone was designated as E.coli mutant S4 with the genotype Δ sucA Δ caiABCDE-kan. The sequencing result shows that: there was no caiABCDE fragment on the genome of S4.

Thirdly, construction of Escherichia coli mutant S6

The E.coli mutant S6 is an E.coli K12 mutant obtained by replacing the entire carnitine transporter gene (caiT), crotonobetaine reductase gene (caiA), betaine/carnitine coenzyme A transferase gene (caiB), coenzyme A ligase gene (caiC), crotonobetaine CoA hydratase gene (caiD), carnitine racemase and carnitine dehydratase activity-inducing gene (caiE), and upstream operon gene cluster (fixBCX) of S1. delta. kan (E.coli mutant S1 in which the kanamycin resistance gene is deleted) with a kanamycin resistance gene. The specific construction method comprises the following steps:

1. preparation of host bacterium

2. Construction of S6

Taking pKD13 plasmid as a template, adopting an upstream primer, namely, fixXdown-Red-F (tcagtcggcgttacgtatccaaaccaacatcaacatcagccgtaacgcgcgcgcgcgcgctacgctacacctacacaattccgggatcggcgacc) and a downstream primer, namely, caiEdown-R (atccagcaacccaggtcgcaccgcaccgcaccgcacaagatcacaccgtttgcgtgcgagaaggcttactttctctctag), to perform PCR amplification, and obtaining a fixXdown-kan-caiEdown targeting fragment with the size of 1383bp through amplification.

The obtained fitXdown-kan-caiEdown targeting fragment was electroporated into the recombinant E.coli pKD 46/S1. delta. kan competent cells obtained in step 1, and positive clones were selected using an LB plate containing kanamycin (kanamycin concentration: 50. mu.g/mL). PCR verification was performed using (primer binding sites were the downstream region of the caiE gene of E.coli and the downstream region of the fixX gene, respectively, and the amplification product size of the positive clone was 2100bp) FIxX-d346-F (gatacccagcgccgatggcgatg) and caiE-d326-R (cacagaaaataagctgcgctgaagtaag), and the PCR identification results were as shown in FIG. 2b, and the correct clones were sequenced. The correctly sequenced clone was designated as E.coli mutant S6 with the genotype Δ sucA Δ fixABCX Δ caiTABCDE-kan. The sequencing result shows that: the genome of S6 lacks the fixABCX-caiTABCDE fragment.

Fourthly, construction of Escherichia coli mutant S7

The E.coli mutant S7 is an E.coli K12 mutant obtained by replacing the pyruvate oxidase gene (poxB) of the E.coli mutant S6 with the acetyl-CoA synthetase gene (acs) and the kanamycin-resistant gene. The specific construction method comprises the following steps:

1. preparation of host bacterium

The kanamycin resistance gene between the FRT sites of S3 was deleted according to the method in step II 1 to obtain E.coli mutant S3. delta. kan (abbreviated as S3. delta. kan).

2. Construction of S7

The FIxXdown-kan-caiEdown targeting fragment was electroporated into recombinant E.coli pKD 46/S3. delta. kan competent cells, and positive clones were selected using an LB plate containing kanamycin (kanamycin concentration 50. mu.g/mL). The clone with correct sequencing is named as Escherichia coli mutant S7, and the genotype is delta sucA delta poxB, acs delta fixABCX delta caiTABCDE-kan. The sequencing result shows that: the genome of S7 lacks the fixABCX-caiTABCDE fragment.

Example 4 construction of genetically engineered bacteria

The expression vectors pYB1a-BBOX or pYB1a-BBOX-caiT constructed in example 1 and example 2 were transformed into E.coli K12 and E.coli mutants S1, S2, S3, S4, S5, S6 or S7 constructed in example 3 by chemical transformation, and positive clones were selected on LB plate containing ampicillin (ampicillin concentration: 50. mu.g/ml). Wherein a positive clone strain obtained by transforming pYB1a-BBOX into Escherichia coli K12 is named as K12/pYB1 a-BBOX; pYB 1-1 a-BBOX transformed Escherichia coli mutant S1 to obtain a positive clone strain, which is named as S1/pYB1 a-BBOX; pYB 1-1 a-BBOX-caiT is transformed into Escherichia coli K12 to obtain a positive clone strain, which is named as K12/pYB1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S1 to obtain a positive clone strain named as S1/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S2 to obtain a positive clone strain named as S2/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S3 to obtain a positive clone strain named as S3/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S4 to obtain a positive clone strain named as S4/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S5 to obtain a positive clone strain named as S5/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transforming Escherichia coli mutant S6 to obtain a positive clone strain named as S6/pYB 1-1 a-BBOX-caiT; pYB 1-1 a-BBOX-caiT transformed Escherichia coli mutant S7, and the obtained positive clone strain was named S7/pYB 1-1 a-BBOX-caiT.

Example 5 Induction culture of engineering bacteria and Whole cell catalytic production of L-Carnitine

Induced culture of engineering bacteria

Taking any one of the 10 strains constructed in example 4 as an engineering strain, the following experiments were carried out simultaneously: the engineering bacteria are streaked on an LB plate containing agar with the mass percentage concentration of 1.6 percent and ampicillin with the concentration of 100 mu g/ml, cultured for 12 hours at 37 ℃, the single clone grown on the plate is picked up and inoculated into a liquid LB culture medium containing ampicillin with the concentration of 100 mu g/ml, and shake culture is carried out for 8-10 hours at 37 ℃ overnight. The rotating speed is 200 revolutions per minute; the overnight culture was inoculated at a volume percentage of 2% into a 250mL baffle flask containing 150mL of 2YT medium (peptone 16g/L, yeast extract: 10g/L, sodium chloride 5g/L, 100. mu.g/mL ampicillin), grown at 37 ℃ for 4 hours with shaking at 200 rpm, arabinose (arabinose concentration 0.2g/100mL) was added, and induced at 30 ℃ for 16 hours at 200 rpm, to obtain induced cells. The experiment was repeated three times, 3 bottles of each engineering bacterium. And (3) carrying out ultrasonic crushing on the thalli collected by centrifugation to obtain a cell crushing liquid, and centrifuging the cell crushing liquid to respectively take supernatant fluid for SDS-PAGE analysis.

The results are shown in FIG. 3. The invention constructs the following 7 engineering bacteria: S1/pYB1a-BBOX-caiT, S2/pYB1a-BBOX-caiT, S3/pYB1a-BBOX-caiT, S4/pYB1a-BBOX-caiT, S5/pYB1a-BBOX-caiT, S6/pYB1a-BBOX-caiT and S7/pYB1a-BBOX-caiT are all expressed to obtain gamma-butyl betaine hydroxylase with the size of 43kDa and carnitine transporter with the size of 56 kDa.

Second, whole cell catalysis generation of L-carnitine and yield detection thereof

Centrifuging the induced cells obtained in the step one for 10min at 8000 rpm and 4 ℃, and collecting thalli; the cells were then washed twice with pre-cooled physiological saline (0.85% aqueous sodium chloride) and resuspended in transformation substrate solution to a final OD600nm value of 30. The conversion substrate solution formula is as follows: 100mM Tris-HCl (adjusted pH 7.5), 50mM gamma-butyl betaine hydrochloride (adjusted pH 7.5), 1% glucose, 1mM Fe²⁺，1mM Vc。

The transformation conditions were 30 ℃ and 1ml of transformation substrate was subjected to whole-cell catalysis in a 50ml large tube for 6 h.

After the conversion reaction is finished, taking a reaction system, and detecting the content of L-carnitine in the reaction system, wherein the method comprises the following specific steps:

(1) taking the reaction system, centrifuging at normal temperature and 12000rpm for 2min, and collecting the supernatant.

(2) The supernatant was diluted 10 times with distilled water and filtered through a 0.22 μm filter to obtain a supernatant.

(3) And (4) taking the sample liquid, and detecting the content of the L-carnitine by adopting a High Performance Liquid Chromatography (HPLC).

A chromatographic column: agilent XDB-C18; mobile phase: solution A: sodium octane sulfonate 10mM, 0.125% KH₂PO₄， 0.125％K₂HPO₄(pH3.0 adjusted by phosphate); and B, liquid B: 100% acetonitrile; solution A: solution B92: 8(V: V); flow rate: 0.3 mL/min; temperature: 25 ℃; a detector: DAD; detection wavelength: 210 nm; the sample injection amount is 10 uL; HPLC system: agilent 1260. The L-carnitine standards (Shanghai blue Wood chemical company, LLC S2388) were characterized by retention time and analyzed quantitatively using a standard curve method (external standard method). The experimental set-up was repeated three times and the results averaged. The HPLC chromatogram of the L-carnitine standard is shown in FIG. 4, and it can be seen that the retention time of the L-carnitine standard is 20.4 min.

The catalysis results of the strains are shown in Table 2, and the results show that the HPLC chromatogram of the transformation products of the 7 engineering bacteria has a peak of L-carnitine with a retention time of 20.4 min. Wherein, the HPLC profile of the transformed product of S7/pYB1a-BBOX-caiT is shown in FIG. 5. The results show that: the L-carnitine yield of K12/pYB1a-BBOX-caiT was 1.21 mM. The yield of L-carnitine of S1/pYB1a-BBOX-caiT is 30.62mM, which shows that after sucA is knocked out, the yield of L-carnitine is improved; the yield of the L-carnitine of S2/pYB1a-BBOX-caiT is 34.21mM, the yield of the L-carnitine of S3/pYB1a-BBOX-caiT is 39.99mM, the yield of the L-carnitine of S4/pYB1a-BBOX-caiT is 37.37mM, the transformation of the three double-knock strains is higher than that of single-knock sucA bacteria, and therefore, sucA and aceA are knocked out, sucA is knocked out, poxB is replaced by acs, and sucA and caiiCDABE gene clusters are knocked out, and the improvement of the transformation of the L-carnitine is facilitated. The yield of the L-carnitine of S5/pYB1a-BBOX-caiT is 31.06mM, and the yield of the L-carnitine of S6/pYB1a-BBOX-caiT is 39.55mM, which indicates that the further knockout gene poxB is replaced by acs on the basis of double knockout bacteria (sucA and aceA), or the further knockout gene cluster fixABCX is also favorable for the transformation of the L-carnitine. The gene poxB is further knocked out on the basis of S6 to be replaced by acs to obtain a S7 strain, the yield of L-carnitine of S7/pYB1a-BBOX-caiT is 50.67mM, and a substrate is 100% transformed, so that the combination delta sucA delta poxB is shown, the characters of acs delta cai TABCDE delta fixaBCX are favorable for producing L-carnitine, and the transformation efficiency of whole cells can be greatly improved.

TABLE 2L-Carnitine content of the respective engineering bacteria

Engineering bacteria	L-carnitine yield (mM)	L-carnitine yield (g/l)
			K12/pYB1a-BBOX	0.1±0.02	0.016±0.003
S1/pYB1a-BBOX	0.3±0.04	0.048±0.006
			K12/pYB1a-BBOX-caiT	1.21±1.58	0.20±0.25
S1/pYB1a-BBOX-caiT	30.62±0.67	4.94±0.11
			S2/pYB1a-BBOX-caiT	34.21±4.04	5.52±0.65
S3/pYB1a-BBOX-caiT	39.99±2.90	6.45±0.47
			S4/pYB1a-BBOX-caiT	37.37±3.20	6.02±0.52
S5/pYB1a-BBOX-caiT	31.06±2.81	5.01±0.45
			S6/pYB1a-BBOX-caiT	39.55±5.13	6.37±0.83
S7/pYB1a-BBOX-caiT	50.67±0.58	8.17±0.09

Sequence listing

<110> institute of microbiology of Chinese academy of sciences

<120> recombinant bacterium for producing L-carnitine and construction method and application thereof

<160>5

<170>PatentIn version 3.5

<210>1

<211>385

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Gly Asn Ala Ile Ala Asp Tyr Arg Thr Phe Pro Leu Ile Ser Pro

1 5 10 15

Leu Ala Ser Ala Ala Ser Phe Ala Gly Gly Val Ser Val Thr Trp Ala

20 25 30

Asp Gly Arg Val Ser Pro Phe His Asn Leu Trp Leu Arg Asp Asn Cys

35 40 45

Pro Cys Gly Asp Cys Val Tyr Glu Val Thr Arg Glu Gln Val Phe Leu

50 55 60

Val Ala Asp Val Pro Glu Asp Ile Gln Val Gln Ala Val Thr Ile Gly

65 70 75 80

Gly Asp Gly Arg Leu Val Val Gln Trp Asp Asp Gly His Ala Ser Ala

85 90 95

Tyr His Pro Gly Trp Leu Arg Ala His Ala Tyr Asp Ala Gln Ser Leu

100 105 110

Ala Glu Arg Glu Ala Ala Arg Pro His Lys His Arg Trp Met Gln Gly

115 120 125

Leu Ser Leu Pro Val Tyr Asp His Gly Ala Val Met Gln Asp Asp Asp

130 135 140

Thr Leu Leu Glu Trp Leu Leu Ala Val Arg Asp Val Gly Leu Thr Gln

145 150 155 160

Leu His Gly Val Pro Thr Glu Pro Gly Ala Leu Ile Pro Leu Ala Lys

165 170 175

Arg Ile Ser Phe Ile Arg Glu Ser Asn Phe Gly Val Leu Phe Asp Val

180 185 190

Arg Ser Lys Ala Asp Ala Asp Ser Asn Ala Tyr Thr Ala Phe Asn Leu

195 200 205

Pro Leu His Thr Asp Leu Pro Thr Arg Glu Leu Gln Pro Gly Leu Gln

210 215 220

Phe Leu His Cys Leu Val Asn Asp Ala Thr Gly Gly Asn Ser Thr Phe

225 230 235 240

Val Asp Gly Phe Ala Ile Ala Glu Ala Leu Arg Ile Glu Ala Pro Ala

245 250 255

Ala Tyr Arg Leu Leu Cys Glu Thr Pro Val Glu Phe Arg Asn Lys Asp

260 265 270

Arg His Ser Asp Tyr Arg Cys Thr Ala Pro Val Ile Ala Leu Asp Ser

275 280 285

Ser Gly Glu Val Arg Glu Ile Arg Leu Ala Asn Phe Leu Arg Ala Pro

290 295 300

Phe Gln Met Asp Ala Lys Arg Met Pro Asp Tyr Tyr Leu Ala Tyr Arg

305 310 315 320

Arg Phe Ile Gln Met Thr Arg Glu Pro Arg Phe Cys Phe Thr Arg Arg

325 330 335

Leu Glu Ala Gly Gln Leu Trp Cys Phe Asp Asn Arg Arg Val Leu His

340 345 350

Ala Arg Asp Ala Phe Asp Pro Ala Ser Gly Asp Arg His Phe Gln Gly

355 360 365

Cys Tyr Val Asp Arg Asp Glu Leu Leu Ser Arg Ile Leu Val Leu Gln

370 375 380

Arg

385

<210>2

<211>1158

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgggtaacg caattgctga ttatcgcacc tttccgctga tctctccgct ggcaagtgcg 60

gcctccttcg caggcggtgt cagtgtgacg tgggcggatg gtcgcgtttc cccgtttcat 120

aacctgtggc tgcgtgacaa ttgcccgtgt ggcgattgcg tttacgaagt cacccgtgaa 180

caggtgttcc tggttgcgga cgtcccggaa gatattcagg tgcaagccgt tacgatcggc 240

ggtgatggtc gcctggtggt tcagtgggat gacggtcatg cgtcagccta tcacccgggc 300

tggctgcgtg cacacgctta cgatgcccaa tcgctggcag aacgtgaagc agctcgcccg 360

cataaacacc gctggatgca gggtctgagc ctgccggtgt atgatcatgg cgcagttatg 420

caagatgacg ataccctgct ggaatggctg ctggcggtcc gtgatgtggg tctgacccag 480

ctgcacggtg tgccgacgga accgggcgcc ctgattccgc tggcaaaacg tatttcattt 540

atccgcgaat cgaactttgg cgttctgttc gatgtccgca gcaaagcgga cgccgattct 600

aacgcctata ccgcatttaa tctgccgctg cataccgatc tgccgacccg tgaactgcaa 660

ccgggtctgc aattcctgca ctgcctggtt aacgacgcca ccggcggtaa tagtacgttt 720

gtcgatggct tcgcaattgc tgaagcactg cgtatcgaag caccggcggc atatcgtctg 780

ctgtgcgaaa ccccggttga atttcgtaac aaagaccgcc atagcgatta ccgctgtacg 840

gctccggtca ttgcgctgga tagctctggt gaagtgcgtg aaatccgcct ggctaatttt 900

ctgcgtgcgc cgttccagat ggacgctaaa cgtatgccgg attattacct ggcatatcgt 960

cgctttattc agatgacccg tgaaccgcgc ttttgcttca cgcgtcgcct ggaagccggc 1020

caactgtggt gtttcgacaa tcgtcgcgtg ctgcatgctc gcgacgcgtt tgatccggcg 1080

agcggtgatc gtcacttcca gggctgttac gttgaccgtg atgaactgct gtctcgcatc 1140

ctggtgctgc aacgttaa 1158

<210>3

<211>504

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Met Lys Asn Glu Lys Arg Lys Thr Gly Ile Glu Pro Lys Val Phe Phe

1 5 10 15

Pro Pro Leu Ile Ile Val Gly Ile Leu Cys Trp Leu Thr Val Arg Asp

20 25 30

Leu Asp Ala Ala Asn Val Val Ile Asn Ala Val Phe Ser Tyr Val Thr

35 40 45

Asn Val Trp Gly Trp Ala Phe Glu Trp Tyr Met Val Val Met Leu Phe

50 55 60

Gly Trp Phe Trp Leu Val Phe Gly Pro Tyr Ala Lys Lys Arg Leu Gly

65 70 75 80

Asn Glu Pro Pro Glu Phe Ser Thr Ala Ser Trp Ile Phe Met Met Phe

85 90 95

Ala Ser Cys Thr Ser Ala Ala Val Leu Phe Trp Gly Ser Ile Glu Ile

100 105 110

Tyr Tyr Tyr Ile Ser Thr Pro Pro Phe Gly Leu Glu Pro Asn Ser Thr

115 120 125

Gly Ala Lys Glu Leu Gly Leu Ala Tyr Ser Leu Phe His Trp Gly Pro

130 135 140

Leu Pro Trp Ala Thr Tyr Ser Phe Leu Ser Val Ala Phe Ala Tyr Phe

145 150 155 160

Phe Phe Val Arg Lys Met Glu Val Ile Arg Pro Ser Ser Thr Leu Val

165 170 175

Pro Leu Val Gly Glu Lys His Ala Lys Gly Leu Phe Gly Thr Ile Val

180 185 190

Asp Asn Phe Tyr Leu Val Ala Leu Ile Phe Ala Met Gly Thr Ser Leu

195 200 205

Gly Leu Ala Thr Pro Leu Val Thr Glu Cys Met Gln Trp Leu Phe Gly

210 215 220

Ile Pro His Thr Leu Gln Leu Asp Ala Ile Ile Ile Thr Cys Trp Ile

225 230 235 240

Ile Leu Asn Ala Ile Cys Val Ala Cys Gly Leu Gln Lys Gly Val Arg

245 250 255

Ile Ala Ser Asp Val Arg Ser Tyr Leu Ser Phe Leu Met Leu Gly Trp

260 265 270

Val Phe Ile Val Ser Gly Ala Ser Phe Ile Met Asn Tyr Phe Thr Asp

275 280 285

Ser Val Gly Met Leu Leu Met Tyr Leu Pro Arg Met Leu Phe Tyr Thr

290 295 300

Asp Pro Ile Ala Lys Gly Gly Phe Pro Gln Gly Trp Thr Val Phe Tyr

305 310 315 320

Trp Ala Trp Trp Val Ile Tyr Ala Ile Gln Met Ser Ile Phe Leu Ala

325 330 335

Arg Ile Ser Arg Gly Arg Thr Val Arg Glu Leu Cys Phe Gly Met Val

340 345 350

Leu Gly Leu Thr Ala Ser Thr Trp Ile Leu Trp Thr Val Leu Gly Ser

355 360 365

Asn Thr Leu Leu Leu Ile Asp Lys Asn Ile Ile Asn Ile Pro Asn Leu

370 375 380

Ile Glu Gln Tyr Gly Val Ala Arg Ala Ile Ile Glu Thr Trp Ala Ala

385 390 395 400

Leu Pro Leu Ser Thr Ala Thr Met Trp Gly Phe Phe Ile Leu Cys Phe

405 410 415

Ile Ala Thr Val Thr Leu Val Asn Ala Cys Ser Tyr Thr Leu Ala Met

420 425 430

Ser Thr Cys Arg Glu Val Arg Asp Gly Glu Glu Pro Pro Leu Leu Val

435 440 445

Arg Ile Gly Trp Ser Ile Leu Val Gly Ile Ile Gly Ile Val Leu Leu

450 455 460

Ala Leu Gly Gly Leu Lys Pro Ile Gln Thr Ala Ile Ile Ala Gly Gly

465 470 475 480

Cys Pro Leu Phe Phe Val Asn Ile Met Val Thr Leu Ser Phe Ile Lys

485 490 495

Asp Ala Lys Gln Asn Trp Lys Asp

500

<210>4

<211>1515

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgaagaatg aaaagagaaa aacgggaata gaaccgaagg ttttctttcc gccgttaata 60

atcgtcggca tactttgttg gcttacagtc agagatctgg atgcagcgaa tgtcgttatt 120

aatgctgtat tcagttacgt caccaatgta tggggatggg catttgaatg gtatatggtg 180

gtgatgcttt tcggttggtt ctggctggtg tttggcccgt atgccaaaaa gcgtttaggt 240

aacgaaccgc cagaatttag caccgccagt tggatcttta tgatgttcgc ctcctgtacg 300

tctgctgccg tactgttctg gggatcgatt gagatctact actacatctc caccccgccg 360

tttggcttag aaccgaactc gacaggggcg aaagagttgg ggctggctta cagcttgttc 420

cactggggac ctctgccgtg ggccacttac agcttccttt cagtcgcctt cgcttacttc 480

ttctttgtcc gcaaaatgga agtgattcgc cccagctcga cactggtgcc gctggtaggt 540

gaaaaacacg ccaaagggtt gttcggcact atcgtcgaca acttctatct cgtcgccttg 600

atcttcgcga tgggtaccag tctgggcctt gccacgccgc tggtgaccga gtgtatgcaa 660

tggttgtttg gcattccgca taccctgcaa ctggacgcta tcatcattac ctgctggatt 720

atcctcaacg ccatttgcgt cgcttgcggt ctgcaaaaag gggtacgtat cgccagtgac 780

gtgcgtagtt acctgagctt cctgatgctg ggttgggtgt tcattgtcag cggtgccagc 840

ttcatcatga actacttcac cgattcggtg gggatgttgc tgatgtatct gccgcgcatg 900

ttgttctata ccgatcccat cgctaaaggc ggcttcccgc agggctggac cgtgttctac 960

tgggcatggt gggtgattta tgctatccag atgagtatct tcctcgcccg catctcccgt 1020

ggtcgtactg tgcgtgaact gtgcttcggc atggtgctgg ggctgacagc gtcaacctgg 1080

atcctgtgga ctgtactcgg tagtaacact ctgctgttga tagataaaaa catcatcaac 1140

attccaaatc tgatcgaaca gtacggtgtg gcgcgcgcca tcattgaaac ctgggccgct 1200

ctgccactca gcaccgccac catgtggggc ttcttcatcc tctgctttat tgccaccgtt 1260

acgctggtta acgcctgctc ttataccctg gcgatgtcca cttgccgcga agtacgcgat 1320

ggtgaagaac cacctctgct ggtgcgtatc ggttggtcaa ttctggttgg cattatcggt 1380

attgttctgc tggcgctcgg cggcctgaaa ccgattcaaa ccgccattat cgccggagga 1440

tgcccgctgt tcttcgtcaa cattatggtg acgctctcct ttattaaaga cgcgaaacag 1500

aactggaaag attaa 1515

<210>5

<211>3528

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac tccgtcaagc 60

cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca ttcacttttt 120

cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta aatacccgcg 180

agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata ggcatccggg 240

tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag cttaagacgc 300

taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag caaacatgct 360

gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg tactgacaag 420

cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct tccatgcgcc 480

gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc ccttcccctt 540

gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc gcttcatccg 600

ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca tgccagtagg 660

cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga tgacgaccgt 720

agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa acaaattctc 780

gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata taacctttca 840

ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc ggcgttaaac 900

ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt tgcgcttcag 960

ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat tgcatcagac 1020

attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta accccgctta 1080

ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt aacaaaagtg 1140

tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca ctttgctatg 1200

ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta tcgcaactct 1260

ctactgtttc tccatacccg ttttttgggc taacaggagg aattaaccat gggtacctct 1320

catcatcatc atcatcacag cagcggcctg gtgccgcgcg gcagcctcga gggtagatct 1380

ggtactagtg gtgaattcgg tgagctcggt ctgcagctgg tgccgcgcgg cagccaccac 1440

caccaccacc actaatacag attaaatcag aacgcagaag cggtctgata aaacagaatt 1500

tgcctggcgg cagtagcgcg gtggtcccac ctgaccccat gccgaactca gaagtgaaac 1560

gccgtagcgc cgatggtagt gtggggtctc cccatgcgag agtagggaac tgccaggcat 1620

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gtcgacgtgc gtcagcagaa 1680

tatgtgatac aggatatatt ccgcttcctc gctcactgac tcgctacgct cggtcgttcg 1740

actgcggcga gcggaaatgg cttacgaacg gggcggagat ttcctggaag atgccaggaa 1800

gatacttaac agggaagtga gagggccgcg gcaaagccgt ttttccatag gctccgcccc 1860

cctgacaagc atcacgaaat ctgacgctca aatcagtggt ggcgaaaccc gacaggacta 1920

taaagatacc aggcgtttcc ccctggcggc tccctcgtgc gctctcctgt tcctgccttt 1980

cggtttaccg gtgtcattcc gctgttatgg ccgcgtttgt ctcattccac gcctgacact 2040

cagttccggg taggcagttc gctccaagct ggactgtatg cacgaacccc ccgttcagtc 2100

cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggaaa gacatgcaaa 2160

agcaccactg gcagcagcca ctggtaattg atttagagga gttagtcttg aagtcatgcg 2220

ccggttaagg ctaaactgaa aggacaagtt ttggtgactg cgctcctcca agccagttac 2280

ctcggttcaa agagttggta gctcagagaa ccttcgaaaa actgccctgc aaggcggttt 2340

tttcgttttc agagcaagag attacgcgca gaccaaaacg atctcaagaa gatcatctta 2400

ttaatcagat aaaatatttc tagatttcag tgcaatttat ctcttcaaat gtagcacgcg 2460

gccgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 2520

gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac 2580

atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc 2640

cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca 2700

tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 2760

caatgatgag cacttttaaa gttctgctat gtgatacact attatcccgt attgacgccg 2820

ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac 2880

cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 2940

taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg 3000

agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac 3060

cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgc 3120

caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat 3180

taatagactg aatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg 3240

ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg 3300

cagcactggg gccagatggt aagcgctccc gtatcgtagt tatctacacc acggggagtc 3360

aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc 3420

attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 3480

tttaatttaa aaggatctag gtgaagatcc tttttgataa tcgcatgc 3528

Claims

1. The construction method of the recombinant bacterium for producing L-carnitine comprises the following steps: introducing a gamma-butyl betaine hydroxylase gene and a carnitine transporter gene into a receptor bacterium to obtain a recombinant bacterium for producing L-carnitine;

the recipient bacterium is mutant escherichia coli; the mutant Escherichia coli is any one of the following A1-A7:

a1, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1, a3 and a 5;

a2, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a 5;

a3, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1, a2 and a 3;

a4, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a 4;

a5, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a 3;

a6, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a1 and a 2;

a7, wherein the mutant Escherichia coli is a mutant of the wild Escherichia coli obtained by transforming the wild Escherichia coli with a 1;

a1, knocking out alpha-ketoglutarate dehydrogenase gene in the genome of the wild type Escherichia coli;

a2, knocking out isocitrate lyase gene in the wild-type Escherichia coli genome;

a3, replacing pyruvate oxidase gene in the wild type Escherichia coli genome with acetyl-CoA synthetase gene;

a4, knocking out caiABCDE gene cluster formed by crotonobetaine reductase gene, betaine/carnitine coenzyme A transferase gene, coenzyme A ligase gene, crotonobetaine CoA hydratase gene, carnitine racemase and carnitine dehydratase activity induction genes in the wild type escherichia coli genome;

a5, knocking out a cai TABCDE gene cluster consisting of a carnitine transporter gene, a crotonobetaine reductase gene, a betaine/carnitine coenzyme A transferase gene, a coenzyme A ligase gene, a crotonobetaine CoA hydratase gene, a carnitine racemase gene and a carnitine dehydratase activity inducing gene in the wild type escherichia coli genome, and knocking out an operon fixABCX gene cluster at the upstream of the cai TABCDE gene cluster;

the amino acid sequence of the protein coded by the gamma-butyl betaine hydroxylase gene introduced into the recipient bacterium is shown as SEQ ID No. 1;

the amino acid sequence of the protein coded by the carnitine transporter gene introduced into the recipient bacterium is shown in SEQ ID No. 3.

2. The method of claim 1, wherein: the gene of the gamma-butyl betaine hydroxylase introduced into the recipient bacterium is a cNDA molecule or genomic DNA shown in SEQ ID No. 2;

or, the carnitine transporter gene introduced into the recipient bacterium is a cNDA molecule represented by SEQ ID No.4 or genomic DNA.

3. The method according to claim 1 or 2, wherein: the amino acid sequence of the protein coded by the alpha-ketoglutarate dehydrogenase gene is shown as GenBank with the number of AAC 73820.1;

the amino acid sequence of the protein coded by the isocitrate lyase gene is shown in GenBank with the number of AAC 76985.1;

the amino acid sequence of the protein coded by the acetyl coenzyme A synthetase gene is shown as GenBank with the number of AAC 77039.1;

the amino acid sequence of the protein coded by the pyruvate oxidase gene is shown as GenBank with the number of AAC 73958.1;

the amino acid sequence of the protein coded by the crotonobetaine reductase gene is shown as GenBank with the number of AAC 73150.1;

the amino acid sequence of the protein coded by the betaine/carnitine coenzyme A transferase gene is shown in GenBank with the number of AAC 73149.1;

the amino acid sequence of the protein coded by the coenzyme A ligase gene is shown as GenBank with the number of AAC 73148.2;

the amino acid sequence of the protein coded by the crotonobetaine CoA hydratase gene is shown as GenBank with the number of AAC 73147.2;

the amino acid sequences of the proteins coded by the carnitine racemase and carnitine dehydratase activity induction genes are shown in GenBank with the number of AAC 73146.2;

the amino acid sequence of the protein coded by the fixA gene in the fixABCX gene cluster is shown as the GenBank number AAC 73146.2;

the amino acid sequence of the protein coded by the fixB gene in the fixABCX gene cluster is shown as the GenBank number AAC 73153.1;

the amino acid sequence of the protein coded by the fixC gene in the fixABCX gene cluster is shown as the GenBank number AAC 73154.1;

the amino acid sequence of the protein coded by the fixX gene in the fixABCX gene cluster is shown as ACC73155.1 in GenBank.

4. The method of claim 3, wherein:

the alpha-ketoglutarate dehydrogenase gene is a cNDA molecule or genomic DNA shown in 758706-761507 of a genome sequence of Escherichia coli K12;

the isocitrate lyase gene is a cNDA molecule or genomic DNA shown in 4217109-4218413 of a genome sequence of escherichia coli K12;

the acetyl coenzyme A synthetase gene is a cNDA molecule or genomic DNA shown in the 4285413-4287371 site of the genome sequence of Escherichia coli K12;

the pyruvate oxidase gene is a cNDA molecule or genomic DNA shown in the 909331-911049 site of a genome sequence of Escherichia coli K12;

the crotonobetaine reductase gene is a cNDA molecule or genomic DNA shown in 39244-40386 of the genome sequence of Escherichia coli K12;

the betaine/carnitine coenzyme A transferase gene is a cNDA molecule or genomic DNA shown in 37898-39115 site of a genome sequence of Escherichia coli K12;

the coenzyme A ligase gene is a cNDA molecule or genomic DNA shown in the 36271-37824 bit of the genome sequence of Escherichia coli K12;

the crotonobetaine CoA hydratase gene is a cNDA molecule or genomic DNA shown in 35377-36162 site of a genome sequence of Escherichia coli K12;

the carnitine racemase and carnitine dehydratase activity induction gene is a cNDA molecule or genomic DNA shown in the 34781-35371 site of a genome sequence of escherichia coli K12;

the fixABCX gene cluster gene is a cNDA molecule or genomic DNA shown in 42403-45750 th site of the genome sequence of Escherichia coli K12.

5. The method according to claim 1 or 2, characterized in that: the gamma-butyl betaine hydroxylase gene and the carnitine transporter gene are introduced into the recipient bacterium through a recombinant expression vector containing an expression cassette for the gamma-butyl betaine hydroxylase gene and the carnitine transporter gene; in the expression cassettes of the gamma-butyl betaine hydroxylase gene and the carnitine transporter gene, the promoter for starting the transcription of the gamma-butyl betaine hydroxylase gene and the carnitine transporter gene is a pBAD promoter.

6. The recombinant bacterium for producing L-carnitine constructed by the method of any one of claims 1-5.

7. The use of the recombinant bacterium for producing L-carnitine of claim 6 in the preparation of L-carnitine.

8. A method for preparing L-carnitine, which comprises subjecting the recombinant bacterium capable of producing L-carnitine of claim 6 to arabinose-induced culture to obtain an induced recombinant bacterium, and catalyzing gamma-butyl betaine with the induced recombinant bacterium to obtain the L-carnitine.