RU2797843C9 - Microorganism producing lysine and a method of producing lysine - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention represents a bacterium Corynebacterium glutamicum producing L-lysine, a method of constructing such a bacterium and a method of producing L-lysine using such a bacterium.

EFFECT: obtaining L-lysine with a high degree of efficiency.

12 cl, 4 tbl, 9 ex

Description

TECHNICAL FIELD

The present invention relates to the field of biotechnology. In particular, the present invention relates to strains that produce L-lysine in large quantities, as well as methods for their construction and their use.

BACKGROUND ART

L-lysine, abbreviated lysine, is the most important essential amino acid in human and animal nutrition and is widely used in industries such as medicine, healthcare, food processing, animal feed and cosmetics. Lysine is mainly produced by microbial fermentation. Currently, the main producing strains include microorganisms such as Escherichia coli and Corynebacterium glutamicum. Due to the physiological superiority of Corynebacterium glutamicum, it has become the most important production strain in the industry. With the continuous development of biotechnology in recent years, methods for metabolic engineering of Corynebacterium glutamicum to improve its lysine yield are also constantly emerging, which include modifications of synthetic lysine pathways, attenuation of synthetic competing lysine pathways, etc. The acid-forming ability of lysine to produce strains on an industrial scale has now reached a higher level.

However, there is still a need in industry for lysine-producing strains with higher production capacity (yield and conversion) to further reduce production costs. Therefore, there is a great need in the art for new methods of constructing lysine-producing strains to further increase lysine yield.

BRIEF DESCRIPTION OF THE INVENTION

An object of the present invention is to provide a new lysine-producing strain, a method for constructing the strain, and a method for producing lysine by the engineered lysine-producing strain.

In a first aspect, the present invention relates to an L-lysine producing strain, wherein, compared to a wild-type strain containing an endogenous polypeptide, the L-lysine producing strain has at least one of the following characteristics (i)-(iii):

(i) reduced or absent polypeptide activity of the endogenous polypeptide;

(ii) reduced or absent expression level of the gene encoding the endogenous polypeptide;

(iii) reduced or absent expression level of the polynucleotide of interest;

wherein said endogenous polypeptide is a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably by at least 98% and most preferably at least 99% sequence identity with the amino acid sequence presented in SEQ ID NO: 1; And

said polynucleotide of interest is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2, or a polynucleotide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98% and most preferably at least 99% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

In a specific embodiment, in a strain, a polypeptide having 98% or more homology to the polypeptide presented in SEQ ID NO: 1 and having a FhuF domain at the C-terminus is inactivated.

In a specific embodiment of the invention, the strain is Corynebacterium glutamicum.

In a specific embodiment, the polypeptide shown in SEQ ID NO: 1 is inactivated in the strain.

In a specific embodiment, inactivation of a polypeptide means that, compared to an endogenous polypeptide, transcription or expression of the polypeptide's encoding gene is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98 % or at least 99%, or the encoding gene for the polypeptide is knocked out; or

the activity of the polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, for example by at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.

In a preferred embodiment of the invention, compared to an L-lysine producing strain containing an endogenous polypeptide, the L-lysine yield of the L-lysine producing strain is increased by at least 5%, preferably by at least 15%, more preferably by at least by at least 20%, more preferably by at least 25%, more preferably by at least 30%, and most preferably by at least 35%.

In a preferred embodiment of the invention, compared to an L-lysine-producing strain containing an endogenous polypeptide, the L-lysine-producing strain has glucose conversion increased by at least 10%, preferably 20%, and more preferably 30%, in process of L-lysine production.

In a preferred embodiment, the endogenous polypeptide can be inactivated by one or a combination of the following methods: partial knockout or complete knockout of the encoding gene for the polypeptide; mutations of the coding gene; changes to promoters or codons in the translational regulatory region or coding region of a coding gene to reduce its transcription or translation; changes in the sequence of a coding gene to reduce the stability of its mRNA or destabilize the structure of the protein it encodes; or by any other means of inactivating an endogenous polypeptide by modifying the coding region of the gene and adjacent upstream and downstream regions, etc.

In a preferred embodiment, the coding sequence of the gene causes a frameshift mutation, a missense mutation, a deletion, a start codon change, etc.

In a preferred embodiment, one or more genes selected from the group consisting of the following genes of the lysine-producing strain are enhanced or overexpressed:

a ₁ . the lysC gene, encoding aspartate kinase, which weakens feedback inhibition of lysine;

b ₁ . the dapA gene, encoding dihydrodipyridine synthase, which weakens feedback inhibition of lysine;

c ₁ . dapB gene, encoding dihydrodipicoline reductase;

d ₁ . the ddh gene encoding diaminopimelate dehydratase;

e ₁ . dapD, encoding tetrahydrodipicolinate succinylase, and dapE, encoding succinyldiaminopimelate deacylase;

f ₁ . the asd gene, encoding aspartate semialdehyde dehydratase;

g ₁ . ppc gene encoding phosphoenolpyruvate carboxylase; or

h ₁ . pntAB gene, encoding niacinamide adenine dinucleotide transhydrogenase.

In a preferred embodiment, one or more genes selected from the group consisting of the following genes of the strain are attenuated or their expression is reduced:

a ₂ . adhE gene, encoding ethanol dehydratase;

b ₂ . the ackA gene, encoding acetate kinase;

c ₂ . pta gene, encoding phosphate acetyltransferase;

_d2 . ldhA gene, encoding lactate dehydratase;

e ₂ . the focA gene, encoding the formate transporter;

f ₂ . the pflB gene, encoding pyruvate formate lyase;

_g2 . poxB gene, encoding pyruvate oxidase;

_h2 . thrA gene encoding aspartate kinase I/homoserine dehydratase I as a bifunctional enzyme;

i ₂ . thrB gene, encoding homoserine kinase;

_j2 . the ldcC gene, encoding lysine decarboxylase; And

_h2 . the cadA gene encoding lysine decarboxylase.

In a second aspect, the present invention relates to a method for constructing an L-lysine producing strain, comprising the steps of:

modifying a wild-type strain containing an endogenous polypeptide in order to reduce or ensure that the polypeptide activity of the endogenous polypeptide of the wild-type strain is absent; or

modifying a wild-type strain containing an endogenous polypeptide to reduce or eliminate the level of expression of a gene encoding the endogenous polypeptide of the wild-type strain; or

modifying the wild-type strain to reduce or ensure that the level of expression of the polynucleotide of interest in the wild-type strain is absent,

wherein the endogenous polypeptide is a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least at least 98% and most preferably at least 99% sequence identity with the amino acid sequence presented in SEQ ID NO: 1; And

the polynucleotide of interest is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2, or a polynucleotide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99%, sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

In a specific embodiment, the strain is modified wherein the polypeptide having 98% or more homology to the polypeptide presented in SEQ ID NO: 1 and having a FhuF domain at the C-terminus is inactivated.

In a specific embodiment of the invention, the strain is Corynebacterium glutamicum.

In a specific embodiment, the strain is modified where the polypeptide presented in SEQ ID NO: 1 is inactivated.

In a specific embodiment, inactivation of a polypeptide means that, compared to an endogenous polypeptide, transcription or expression of the polypeptide's encoding gene is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, e.g. by 60%, by at least 70%, by at least 80%, by at least 90%, by at least 95%, by at least 96%, by at least 97%, by at least 98% or at least 99%, or the encoding gene for the polypeptide is knocked out; or the activity of the polypeptide is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%, for example by at least 60%, at least 70%, at least 80% , at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.

In a preferred embodiment of the invention, compared to an L-lysine producing strain containing an endogenous polypeptide, the L-lysine yield of the L-lysine producing strain is increased by at least 5%, preferably by at least 15%, more preferably by at least by at least 20%, more preferably by at least 25%, more preferably by at least 30%, and most preferably by at least 35%.

In a preferred embodiment of the invention, compared to an L-lysine-producing strain containing an endogenous polypeptide, the L-lysine-producing strain has glucose conversion increased by at least 10%, preferably 20%, and more preferably 30%, in process of L-lysine production.

In a preferred embodiment, the endogenous polypeptide can be inactivated by one or a combination of the following methods: partial knockout or complete knockout of the encoding gene for the polypeptide; mutations of the coding gene; changes to promoters or codons in the translational regulatory region or coding region of a coding gene to reduce its transcription or translation; changes in the sequence of a coding gene to reduce the stability of its mRNA or destabilize the structure of the protein it encodes; or by any other means of inactivating an endogenous polypeptide by modifying the coding region of a gene in a cell and adjacent upstream and downstream regions, etc.

In a preferred embodiment, the coding sequence of a polypeptide gene causes a frameshift mutation, a missense mutation, a deletion, a start codon change, etc.

In a preferred embodiment of the invention, the method further comprises enhancing or overexpressing one or more genes selected from the group consisting of the following genes in the strain:

a ₁ . the lysC gene, encoding aspartate kinase, which weakens feedback inhibition of lysine;

b ₁ . the dapA gene, encoding dihydrodipyridine synthase, which weakens feedback inhibition of lysine;

c ₁ . dapB gene, encoding dihydrodipicoline reductase;

d ₁ . the ddh gene encoding diaminopimelate dehydratase;

e ₁ . dapD, encoding tetrahydrodipicolinate succinylase, and dapE, encoding succinyldiaminopimelate deacylase;

f ₁ . the asd gene, encoding aspartate semialdehyde dehydratase;

g ₁ . ppc gene encoding phosphoenolpyruvate carboxylase; or

h ₁ . pntAB gene, encoding niacinamide adenine dinucleotide transhydrogenase.

In a preferred embodiment of the invention, the method further comprises attenuating one or more genes selected from the group consisting of the following genes in a strain or reducing the expression of one or more genes selected from the group consisting of the following genes in a strain:

a ₂ . adhE gene, encoding ethanol dehydratase;

b ₂ . the ackA gene, encoding acetate kinase;

c ₂ . pta gene, encoding phosphate acetyltransferase;

_d2 . ldhA gene, encoding lactate dehydratase;

e ₂ . the focA gene, encoding the formate transporter;

f ₂ . the pflB gene, encoding pyruvate formate lyase;

_g2 . poxB gene, encoding pyruvate oxidase;

_h2 . thrA gene encoding aspartate kinase I/homoserine dehydratase I as a bifunctional enzyme;

i ₂ . thrB gene, encoding homoserine kinase;

_j2 . the ldcC gene, encoding lysine decarboxylase; And

_h2 . the cadA gene encoding lysine decarboxylase.

In a third aspect, the present invention relates to a method for producing L-lysine, comprising:

1) cultivating the L-lysine producing strain according to the first aspect or the L-lysine producing strain constructed by the method according to the second aspect so that the L-lysine producing strain begins to produce L-lysine;

2) optionally separating L-lysine from the culture solution obtained in step 1).

In a fourth aspect, the present invention relates to the use of an L-lysine producing strain according to the first aspect or an L-lysine producing strain obtained by a method according to the second aspect in producing L-lysine.

It should be understood that, within the scope presented herein, each of the above-mentioned technical features and each of the technical features specifically described below (for example, examples) in this invention can be combined with each other to create new or preferred technical solutions, which will not be repeated here one by one due to space limitations.

DETAILED DESCRIPTION OF THE INVENTION

After extensive and intensive research, the present invention unexpectedly discovered a gene encoding a hypothetical protein, and it was found that inactivation of this gene can significantly increase the yield of lysine, thereby resulting in a strain highly productive for lysine. Based on these findings, the present invention was carried out.

Polypeptide shown in SEQ ID NO: 1

Polypeptide shown in SEQ ID NO: 1

according to the present invention, is obtained from Corynebacterium glutamicum, which encodes the nucleotide sequence presented in SEQ ID NO: 2

The polypeptide is also annotated as a (2Fe-2S)-binding protein due to the presence of a FhuF domain at its C-terminus. BLAST (a program for detecting protein sequence similarity by local alignment) analysis revealed that this polypeptide is highly conserved across different Corynebacteria glutamicum and has a FhuF domain at each C-terminus. Therefore, the polypeptide has the same functions in different Corynebacteria glutamicum.

Definitions of terms

The polynucleotide, generally referred to as polyribonucleotide and polydeoxyribonucleotide, may be unmodified RNA or DNA or modified RNA or DNA. The nucleotide sequence described herein may be the nucleotide sequence set forth in SEQ ID NO: 2, or may be a nucleotide sequence hybridized to the nucleotide sequence set forth in SEQ ID NO: 2 under stringent conditions, or may be a nucleotide sequence hybridized to a probe derived from SEQ ID NO: 2. The term “stringent conditions” as used herein refers to conditions under which specific hybridization can occur while nonspecific hybridization does not occur. For example, washing is carried out in saline solution at a certain concentration at a time, and preferably two or three times, and the corresponding concentration is 1×SSC, 0.1% SDS, preferably 0.1×SSC, 0.1% SDS at 60 °C and more preferably 0.1×SSC, 0.1% SDS at 68°C; The length of the probe can be selected depending on the hybridization conditions, usually from 100 bp. (base pairs) up to 1 kt. (one thousand base pairs).

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein and represent a polymer of amino acids of any length. The polymer can be linear or branched. It may contain modified amino acids and may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (eg, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation such as conjugation to a labeled moiety).

The term "expression" includes any steps involved in the production of a polypeptide, including, but not limited to: transcription, post-transcriptional modification, translation, post-translational modification and secretion.

The terms "sequence identity" and "percentage identity" as used herein refer to the percentage of nucleotides or amino acids that are the same (ie, identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide sequences of the polynucleotides or the amino acid sequences of the polypeptides and assessing the number of positions at which the nucleotide or amino acid residues are identical in the aligned polynucleotides or polypeptides, and comparing the number of these positions with the number of positions at which nucleotide or amino acid residues differ in aligned polynucleotides or polypeptides. Polynucleotides may differ at one position, for example by containing a different nucleotide (ie, substitution or mutation) or deleting a nucleotide (ie, insertion or deletion of a nucleotide in one or two polynucleotides). Polypeptides may differ at one position, for example by containing a different amino acid (ie, substitution or mutation) or deleting an amino acid (ie, insertion or deletion of an amino acid in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions at which nucleotide or amino acid residues are identical by the total number of nucleotide or amino acid residues in the polynucleotides or polypeptides. For example, percent identity can be calculated by dividing the number of positions at which nucleotide or amino acid residues are identical by the total number of nucleotide or amino acid residues in the polynucleotides or polypeptides and multiplying the result by 100.

The term "wild type/endogenous" in this context means that the polypeptide or polynucleotide is in an unmodified state, i.e. in its natural state, in a microorganism. For example, a polypeptide, polynucleotide sequence, or microorganism that can be isolated from a single source in nature and that has not been intentionally modified by humans in a laboratory is naturally occurring. In this context, the terms "naturally occurring" and "wild type" are synonymous.

In some embodiments, a wild-type strain as used herein refers to a strain containing an endogenous polypeptide that is a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by a sequence having at least 80 %, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 1.

In a specific embodiment of the invention, the wild-type strain is Corynebacterium glutamicum containing an endogenous polypeptide.

In some embodiments, the present invention genetically modifies a wild-type strain to produce a recombinant strain having at least one of the following characteristics (i) to (iii) compared to the wild-type strain:

(i) reduced or absent polypeptide activity of the endogenous polypeptide;

(ii) reduced or absent expression level of the gene encoding the endogenous polypeptide; and

(iii) reduced or absent expression level of the polynucleotide;

wherein said endogenous polypeptide is a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably by at least 98% and most preferably at least 99% sequence identity with the amino acid sequence presented in SEQ ID NO: 1; And

said polynucleotide is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2, or a polynucleotide encoded by a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98% and most preferably at least 99% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

Based on the information presented in the present invention, it will be clear to one skilled in the art that the present invention improves the lysine yield of the strain by inactivating the polypeptide shown in SEQ ID NO: 1, Corynebacterium glutamicum. Thus, the phrase “the polypeptide represented in SEQ ID NO: 1 is inactivated” as described herein means that, compared with the wild-type strain, the expression of the polypeptide represented in SEQ ID NO: 1 is reduced, attenuated, or even completely is absent, or means that a gene is produced that is not expressed, or although the gene is expressed, the expression product has no activity or has reduced activity.

In a specific embodiment, compared to a wild-type polypeptide or an endogenous polypeptide, the transcription or expression of the mutated gene or the activity of the protein encoded by the mutated gene is reduced by at least 30%, preferably by at least 40%, more preferably by at least 50%. , for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97 %, at least 98% or at least 99%, or the encoding gene for a wild-type or endogenous polypeptide is knocked out.

The term "modification" as used herein refers to any genetic manipulation of a wild-type or parental strain, including, but not limited to, various molecular biological means. The terms "modification", "gene editing" and "genetic modification" as used herein may be used interchangeably.

The term "inactivation" as used herein may be accomplished by modifications including, but not limited to, deletion of part or all of the coding gene, frameshift mutation of the gene, attenuation of transcription or translation, or use of the gene or allele encoding the corresponding an enzyme or protein with lower activity, or inactivation of the corresponding gene or enzyme, and optionally the use of these methods in combination. Gene expression can be reduced by adopting suitable culture techniques or genetic modifications (mutations) of the gene expression signaling patterns. For example, gene expression signaling structures are regulator genes, active genes, operator genes, promoters, attenuators, ribosome binding sites, initiation codons, and terminators.

Based on the information presented in the present invention, one skilled in the art will appreciate that lysine yield can be improved by inactivating the encoding gene for the polypeptide set forth in SEQ ID NO: 1 or by ensuring that the polypeptide set forth in SEQ ID NO: : 1, cannot function normally in the cell. One skilled in the art can achieve the above object using technical means known in the art. This can be achieved, for example, by a defect in the enzyme-encoding gene on the chromosome or by modification of a single expression control sequence, such as a promoter or SD sequence (Shine-Dalgarno sequence); or it can be achieved by introducing an amino acid change (missense mutation) or terminator (nonsense mutation) into the coding region, or introducing an insertion or deletion of one or two bases (frameshift mutation) into the coding region, or deleting part of the gene (Journal of Biological Chemistry 1997, 272: 8611-8617). The present invention includes, but is not limited to, the above methods.

The term "glucose conversion" as used herein refers to the molar ratio of glucose as a substrate converted to lysine as a product.

The term "lysine-producing strain" as used herein refers to a strain that produces lysine when bacteria are cultured in the medium and can accumulate lysine or can secrete lysine into the medium, that is, extracellular free lysine can be obtained. For example, the strains may be naturally occurring lysine-producing strains or may be engineered lysine-producing strains obtained through genetic modification. Modifications include, but are not limited to, modification whereby one or more genes selected from the group consisting of the following genes of the strain are enhanced or overexpressed:

a ₁ . the lysC gene, encoding aspartate kinase, which weakens feedback inhibition of lysine;

b ₁ . the dapA gene, encoding dihydrodipyridine synthase, which weakens feedback inhibition of lysine;

c ₁ . dapB gene, encoding dihydrodipicoline reductase;

d ₁ . the ddh gene encoding diaminopimelate dehydratase;

e ₁ . dapD, encoding tetrahydrodipicolinate succinylase, and dapE, encoding succinyldiaminopimelate deacylase;

f ₁ . the asd gene, encoding aspartate semialdehyde dehydratase;

g ₁ . ppc gene encoding phosphoenolpyruvate carboxylase; And

h ₁ . pntAB gene, encoding niacinamide adenine dinucleotide transhydrogenase.

Additionally, modifications include, but are not limited to, modification in which one or more genes selected from the group consisting of the following genes of the strain are attenuated or their expression is reduced:

a ₂ . adhE gene, encoding ethanol dehydratase;

b ₂ . the ackA gene, encoding acetate kinase;

c ₂ . pta gene, encoding phosphate acetyltransferase;

_d2 . ldhA gene, encoding lactate dehydratase;

e ₂ . the focA gene, encoding the formate transporter;

f ₂ . the pflB gene, encoding pyruvate formate lyase;

_g2 . poxB gene, encoding pyruvate oxidase;

_h2 . thrA gene encoding aspartate kinase I/homoserine dehydratase I as a bifunctional enzyme;

i ₂ . thrB gene, encoding homoserine kinase;

_j2 . the ldcC gene, encoding lysine decarboxylase; And

_h2 . the cadA gene encoding lysine decarboxylase.

In some embodiments, engineered lysine-producing strains obtained through genetic modifications that have reduced or absent protein activity, reduced or absent expression of a gene encoding the protein, reduced or absent enzyme activity, or reduced or absent expression of a gene encoding the enzyme , include recombinant strains modified by the following genetic engineering methods: introduction of a weak promoter or weak ribosome binding site into the strain, gene knockout or knockdown of the protein or enzyme encoding gene, and insertion of a random fragment into the protein or enzyme encoding gene to cause loss of protein or enzyme activity.

In some embodiments, increased protein activity, increased expression of a gene encoding a protein, increased activity of an enzyme, or increased expression of a gene encoding an enzyme in engineered lysine producing strains obtained by genetic modification are achieved by modifications including the following gene modification methods: engineering: introduction of strong promoters or strong ribosome binding sites, introduction of recombinant expression vectors of non-integrated proteins or enzymes, and introduction of recombinant expression vectors of chromosomally integrated proteins or enzymes.

The term "vector" refers to a DNA construct containing DNA sequences operably linked to appropriate control sequences to express a gene of interest in a suitable host. The term "recombinant expression vector" refers to a DNA construct used to express, for example, a polynucleotide encoding a desired polypeptide. The recombinant expression vector may include, for example: i) a set of genetic elements having a regulatory effect on gene expression, such as promoters and enhancers; ii) a structure or coding sequence that is transcribed into mRNA and translated into protein; and iii) transcription subunits that appropriately transcribe and translate initiation and termination sequences. Recombinant expression vectors are constructed by any suitable method. The nature of the vector is not critical and any vector can be used, including plasmids, viruses, phages and transposons. Potential vectors used herein include, but are not limited to, chromosomal, non-chromosomal and synthetic DNA sequences such as bacterial plasmids, phage DNA, yeast plasmids and vectors derived from combinations of plasmids and phage DNA, and DNA from viruses such such as vaccines, adenoviruses, fowlpox, baculoviruses, SV40 and pseudorabies. In some embodiments, a “recombinant expression vector” as used herein refers to a mutant vector.

The terms "transformation, transfection and transduction" as used herein have the meanings commonly understood by one skilled in the art, namely, a method of introducing exogenous DNA into a host. Transformation, transfection and transduction methods include any method of introducing a nucleic acid into a cell. These methods include, but are not limited to, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE (diethylaminoethyl)-dextran method, cationic liposome and a method based on lithium acetate-DMSO (dimethyl sulfoxide).

The strains described herein can be cultured by conventional methods in the art, including, but not limited to, plate culture, shake flask culture, confinement culture, continuous culture, fed-batch culture, etc. In addition, various cultivation conditions such as temperature, time and pH value of the medium can be properly adjusted according to specific situations.

Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art to which this invention relates.

Advantages of the present invention:

1. The present invention relates to a new method for constructing strains that produce lysine, thereby opening up new ideas for constructing strains that produce L-lysine in large quantities;

2. Both the lysine yield and glucose conversion of the lysine-producing strains constructed herein are improved to some extent; And

3. The cost of producing lysine by the method described herein is reduced to some extent.

The present invention will be further illustrated with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental methods for which specific conditions are not indicated in the following examples are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press , 1989), or as recommended by the manufacturers.

Unless otherwise specified, all technical and scientific terms used in this description have the same meaning as commonly understood by one skilled in the art to which the present invention relates. Although any methods and materials similar or equivalent to those described herein may also be used to implement or test the present invention, the preferred methods and materials are described herein.

Example 1: Construction of a mutant lysC gene vector in Corynebacterium glutamicum

Due to feedback regulation of key genes, wild-type Corynebacterium glutamicum ATCC13032 cannot accumulate lysine. It has been reported in the literature that strains freed from feedback inhibition of aspartate kinase (encoded by the lysC gene) can accumulate lysine. With this in mind, we first constructed a strain with some ability to synthesize lysine by mutating aspartate kinase (Thr mutated to Ile at position 311). According to the published genomic sequence of Corynebacterium glutamicum ATCC13032, primers lysC-F1/R1 and lysC-F2/R2 were designed respectively, and the upstream and downstream homologous fragments of the lysC mutation arm (where the C base was mutated to T at position 932 of the lysC gene) were obtained by PCR amplification using the ATCC13032 genome as a template. The above PCR fragments were recovered and then ligated into the pK18mobsacB vector, which was digested with EcoRI and BamHI to obtain pK18-lysC as the lysC gene mutant vector.

Example 2. Construction of a mutant strain of the lysC gene in Corynebacterium glutamicum

Competent cells of Corynebacterium glutamicum ATCC13032 were obtained. Plasmid pK18-lysC as constructed above was transformed into this strain. The strain was covered with solid LBHIS medium (2.5 g/L yeast powder, 5 g/L peptone, 5 g/L sodium chloride, 18.5 g/L brain heart extract, 91 g/L sorbitol) containing 25 μg/L ml of kanamycin, and cultured at 30°C to obtain the first recombinant transformants. Correct transformants were transferred to LB medium (Luria-Bertani medium) containing 5 g/L glucose and cultured overnight. The culture was then transferred to LB medium containing 100 g/L sucrose and cultured at 30°C for 6 hours, and then overlaid with LB medium containing 100 g/L sucrose for screening to obtain SCgL30 as a lysC mutant strain.

Example 3 Construction of a coding gene knockout vector from the polypeptide shown in SEQ ID NO: 1, Corynebacterium glutamicum

According to the reported genome sequence of Corynebacterium glutamicum ATCC13032, primers SEQ ID NO: 1-F1/R1 and SEQ ID NO: 1-F2/R2 were designed respectively, and the upstream and downstream homologous gene arms for the polypeptide represented in SEQ ID NO: 1, were obtained by PCR amplification using the ATCC13032 genome as a template. The above PCR fragments were isolated and then ligated into the pK18mobsacB vector, which was digested with EcoRI and BamHI to obtain pK18-SEQ ID NO: 1 as a mutant gene vector for the polypeptide represented in SEQ ID NO: 1.

Example 4 Construction of a Deletion Strain of the Polypeptide Represented in SEQ ID NO: 1, Corynebacterium glutamicum

Competent cells of strain SCgL30 were obtained. Plasmid pK18-SEQ ID NO: 1, as constructed above, was transformed into this strain. The strain was covered with solid LBHIS medium containing 5 g/L glucose and 25 μg/ml kanamycin and cultured at 30°C to obtain the first recombinant transformants. Correct transformants were transferred to LB medium containing 5 g/L glucose and cultured overnight. The culture was then transferred to LB medium containing 100 g/L sucrose and cultured at 30°C for 6 hours, and then overlaid with LB medium containing 100 g/L sucrose for screening to obtain SCgL31 as a polypeptide deletion strain. presented in SEQ ID NO: 1.

Example 5. Effect of deletion of the polypeptide presented in SEQ ID NO: 1 on the synthesis of lysine from Corynebacterium glutamicum

In order to test how gene knockout for the polypeptide shown in SEQ ID NO: 1 in Corynebacterium glutamicum affected lysine production by the strain, fermentation tests were performed on SCgL30 and SCgL31, respectively. The fermentation medium was CGXII medium with the following main ingredients (g/l): (NH ₄ ) ₂ SO ₄ , 20; urea, 5; KH ₂ PO ₄ , 1; K ₂ HPO ₄ × 3H ₂ O, 1.3; 3-(N-morpholino)propanesulfonic acid (MOPS), 42; _CaCl2 , 0.01; FeSO ₄ × 7H ₂ O, 0.01; MnSO ₄ ×H ₂ O, 0.01; ZnSO ₄ × 7H ₂ O, 0.001; CuSO ₄ , 0.0002; NiCl×6H ₂ O, 0.00002; MgSO ₄ × 7H ₂ O, 0.25; protocatechuic acid, 0.03; vitamin B ₁ , 0.0001; biotin, 0.0002; and glucose, 80. Strains were first inoculated into LB medium containing 10 g/L glucose and cultured overnight. Cultures were inoculated as plates into a 24-well plate containing 600 μl of fermentation medium in each well with an initial OD (optical density) controlled at 0.5 and cultured at 30°C for 29 hours. The rotation speed of the plate shaker was 800 rpm. Three samples were established for each strain. After fermentation, lysine yield and glucose consumption were measured. The results are shown in Table 1. Both Lys yield and glucose conversion were significantly improved after knockout of the polypeptide shown in SEQ ID NO: 1.

Table 1. Strains Lysine
(g/l) Conversion
(mM/M×100%) SCgL30 3.80 59.40 SCgL31 4.20 65.32

Example 6: Construction of a strain with attenuated polypeptide SEQ ID NO: 1 based on dCas9

First of all, the Cas9 gene of the pCas9 plasmid (LIU, Jiao, et al. Development of a CRISPR/Cas9 genome editing toolbox for Corynebacterium glutamicum. Microbial cell factories, 2017, 16.1: 205) was mutated to D10A and H840A, thereby removing the restriction site enzyme BsaI from the plasmid backbone to obtain plasmid pdCas9. The gRNA-ccdB expression cassette was then amplified from pnCas9(D10A)-AID-gRNA-ccdBTS (WANG, Yu, et al. Expanding targeting scope, editing window, and base transition capability of base editing in Corynebacterium glutamicum. Biotechnology and bioengineering, 2019, 116:3016-3029) and cloned at the same position of pdCas9 to obtain pdCas9gRNA-ccdB as a CRISPRi plasmid that can be efficiently constructed.

The above dCas9-based attenuated system was used to construct the attenuated polypeptide vector shown in SEQ ID NO: 1 and its control vector. According to the reported genome sequence of Corynebacterium glutamicum ATCC13032, dCas-F/R primers were designed accordingly. The two primers were denatured and hybridized to produce complementary fragments. The above fragments were ligated with the plasmid pdCas9-ccdB, which was digested with BsaI enzyme through Goldengate to construct pdCas-SEQ ID NO: 1 as an attenuated vector with the gRNA (gRNA) of the polypeptide shown in SEQ ID NO: 1. According to the sequence of pdCas9gRNA-ccdB primers Cas-1, Cas-2, Cas-3 and Cas-4 were designed. Two plasmid fragments were obtained by PCR amplification and recombined using Vazyme as a recombinase to produce pdCas9 as a control vector without any complementary regions on the gRNA. The above recombinant vectors pdCas-SEQ ID NO: 1 and pdCas9 were transformed into strains SCgL30, respectively, to obtain SCgL30/pdCas-SEQ ID NO: 1 as the attenuated strain of the polypeptide shown in SEQ ID NO: 1, and SCgL30/pdCas9 as the control strain .

Example 7 Effect of attenuation of the polypeptide shown in SEQ ID NO: 1 on the synthesis of lysine from Corynebacterium glutamicum

In order to test how attenuation of the gene expression of the polypeptide shown in SEQ ID NO: 1 in Corynebacterium glutamicum affected the lysine production of the strain, fermentation tests were carried out on SCgL30/pdCas9 and SCgL30/pdCas-SEQ ID NO: 1, respectively. The fermentation medium ingredients were as follows (g/L): glucose, 80; yeast powder, 8; urea, 9; K ₂ HPO ₄ , 1.5; _MnSO4 , 0.01; MgSO ₄ , 0.6; _FeSO4 , 0.01; and MOPS, 42. Strains were first inoculated into LB medium containing 10 g/L glucose and cultured overnight. Cultures were inoculated as plates into a 24-well plate containing 600 μl of fermentation medium in each well with an initial OD controlled at 0.5 and cultured at 30°C for 29 hours. The rotation speed of the plate shaker was 800 rpm. Three samples were established for each strain. After fermentation, lysine yield and glucose consumption were measured. The results are shown in Table 2. Both Lys yield and glucose conversion were significantly improved after attenuation of the polypeptide shown in SEQ ID NO: 1. The results of the RT-PCR test showed that the transcription level of the polypeptide shown in SEQ ID NO: 1 strain SCgL30/pdCas-SEQ ID NO: 1 was reduced by 31% compared to the control strain.

Table 2. Strains Lysine
(g/l) Conversion
(mM/M×100%) SCgL30/pdCas9 1.33 23.15 SCgL30/pdCas-SEQ ID NO: 1 1.67 30.00

Example 8: Use of deletion of the polypeptide presented in SEQ ID NO: 1 in strains producing high amounts of lysine

(1) Construction of a deletion strain of the polypeptide shown in SEQ ID NO: 1 in a strain producing lysine in large quantities

The pK18mobsacB-based homologous recombination technique was used to mutate the threonine at position 311 of the aspartate kinase (encoded by the lysC gene) in the genome of Corynebacterium glutamicum ATCC13032 to isoleucine, to mutate the central region sequence at positions 279-317 of the promoter of the pyruvate carboxylase gene (encoded by the pyc gene) from CGATGTTTGATTGGGGGAATCGGGGGTT ACGATACTAGG to CGGGCCTTGATTGTAAGATAAGACATTTAGTATAATTAG and to mutate the central region sequence at positions 292-300 of the diaminopimelate dehydrogenase gene promoter (encoded by the ddh gene) from ATGCATCTC to CCTTGTTAT to construct SCgL40 into strains that produce lysine in large quantities. Competent cells of strain SCgL40 were obtained. Plasmid pK18-SEQ ID NO: 1, as constructed above, was transformed into this strain. The strain was covered with LBHIS medium containing 5 g/L glucose and 25 μg/mL kanamycin and cultured at 30°C for 6 hours. The culture was then overlaid with LB medium containing 100 g/L sucrose to screen to obtain SCgL31 as the polypeptide deletion strain shown in SEQ ID NO: 1.

(2) Effect of deletion of the polypeptide represented in SEQ ID NO: 1 on lysine synthesis by high-yield strains

In order to test how deletion of the polypeptide shown in SEQ ID NO: 1 affected the production of L-lysine by the high-yielding strain, fermentation tests were carried out on SCgL45 and SCgL40, respectively. The fermentation medium ingredients were as follows (g/L): glucose, 80 g/L; yeast powder, 1 g/l; soy peptone, 1 g/l; NaCl, 1 g/l; ammonium sulfate, 1 g/l; urea, 10 g/l; K ₂ HPO ₄ × 3H ₂ O, 1 g/l; MgSO ₄ × 7H ₂ O, 0.45 g/l; FeSO ₄ × 7H ₂ O, 0.05 g/l; biotin, 0.4 mg/l; vitamin B1, 0.1 mg/l; MOPS, 40 g/l; initial pH 7.2. The strains were first inoculated into liquid TSB medium and cultured for 8 h. Cultures were inoculated as plates into a 24-well plate containing 800 μl of fermentation medium in each well with an initial OD ₆₀₀ controlled at about 0.1 and cultured at 30°C for 21 hours. The rotation speed of the plate shaker was 800 rpm. Three samples were established for each strain. After fermentation, L-lysine yield and glucose consumption were measured, and the conversion from glucose to the sugar acid L-lysine was calculated. TSB medium ingredients were as follows (g/L): glucose, 5 g/L; yeast powder, 5 g/l; soy peptone, 9 g/l; urea, 3 g/l; succinic acid, 0.5 g/l; K ₂ HPO ₄ × 3H ₂ O, 1 g/l; MgSO ₄ × 7H ₂ O, 0.1 g/l; biotin, 0.01 mg/l; vitamin B1, 0.1 mg/l; and MOPS, 20 g/l. The results are shown in Table 3. Both the lysine yield and sugar acid conversion of the strains were significantly improved after removal of the polypeptide shown in SEQ ID NO: 1.

Table 3. Strains Lysine
(g/l) Conversion
(mM/M×100%) SCgL40 6.07 74.07 SCgL45 8.53 122.16

In order to further confirm the effect resulting from the deletion of the polypeptide shown in SEQ ID NO: 1 in high-yielding strains, the above two strains were subjected to fermentation tests in 5 L fermenters. The fermentation medium ingredients were as follows (g/L): glucose, 60 g/L; molasses, 15 g/l; corn plasma, 1.5 g/l; KCl, 0.5 g/l; ammonium sulfate, 20 g/l; phosphoric acid, 0.5 g/l; ferrous sulfate, 150 mg/l; manganese sulfate, 150 mg/l; MgSO ₄ × 7H ₂ O, 1 g/l; biotin, 1 mg/l; vitamin B1, 5 mg/l; glucose stock solution with make-up and ammonium sulfate stock solution. Strains were first activated in solid TSB medium and inoculated into liquid TSB medium and cultured for 12 h. 200 ml of the above cultures were inoculated as seeds into 5 L fermenters containing 1.8 L of fermentation medium and fermented at 370C for 24 hours. L-Lysine yield was assessed during fermentation. The fermentation results showed that the lysine yield of strain SCgL40 after fermentation for 24 hours was 30 g/L, while the lysine yield of strain SCgL45 with the deletion of the polypeptide shown in SEQ ID NO: 1 reached 48 g/L, which was a significantly improved value .

The primers used in these Examples are listed in the table below:

SEQ ID NO Name Sequence (5’-3’) 3 lysC-F1 ATGACATGATTACGAATTCACACTCCTCTGGCTAGGTAG 4 lysC-R1 ATGATGTCGGTGGTGCCGTCT 5 lysC-F2 ACGGCACCACGACATCATCTTCACCTGCCCTCGTTCC 6 lysC-R2 GGTCGACTCTAGAGGATCCACGCAGGTGCCTGAGACCTT 7 SEQ ID NO:1-F1 ATGACATGATTACGAATTCATCTCTGTGCACTCATCTAC 8 SEQ ID NO:1-R1 TGCTAATTCCTCGAGCGTGA 9 SEQ ID NO:1-F2 CACGCTCGAGGAATTAGCACGAGCTGGATGCTGCATGAT 10 SEQ ID NO:1-R2 AGTTATTGGTGCCCTTCGATTCCAAAAGTGCAGCCTAGA eleven dCas-F TTCATGCTAATTCCTCGAGCGTGA 12 dCas-R AAACTCACGCTCGAGGAATTAGCA 13 Cas-1 ACAGGTACAGTGTAATTCAGTTTTAGAGCTAGAAATAGC 14 Cas-2 TCAGTCACCTCCTAGCTGAC 15 Cas-3 GTCAGCTAGGAGGTGACTGA 16 Cas-4 TGAATTACACTGTACCTGTT

Example 9: Comparison of Homologies of the Polypeptide Represented in SEQ ID NO: 1 in Various Corynebacteria glutamicum

Sequence alignment and analysis of the polypeptide shown in SEQ ID NO: 1 was carried out based on the NCBI database. The results showed that the DNA sequence identity and amino acid sequence identity of this polypeptide in different Corynebacteria glutamicum reached 98.01% and 98.56% or more, respectively, indicating that the polypeptide was highly conserved in Corynebacterium glutamicum. In addition, sequence analysis showed that the protein contained a C-terminal FhuF (2Fe-2S-containing iron reductase in the cytoplasm of Escherichia coli) domain at the C-terminus, and this domain was present in all homologous sequences in the above Corynebacteria glutamicum. Therefore, either deletion or attenuation of the above homologous genes in various Corynebacteria glutamicum promoted lysine synthesis.

All documents referred to herein are incorporated herein by reference, as each document is individually incorporated by reference. It should be understood here that, upon reviewing the contents described above, one skilled in the art may make various changes or modifications to the present invention, and these equivalents are also within the scope of the claims appended to the present invention.

.

--->

LIST OF SEQUENCES

<110> Tianjin Institute of Industrial Biotechnology, Chinese

Academy of Sciences

<120> MICROORGANISM PRODUCING LYSINE AND METHOD

LYSINE PRODUCTION

<130> 6A17-2028701IB

<141> 2021-01-13

<150> 2020100422032

<151> 2020-01-15

<160> 16

<170> Patent In version 3.5

<210> 1

<211> 217

<212> PROTEIN

<213> Artificial sequence

<220>

<223> synthetic

<400> 1

Met Ser Ile Trp Lys Arg Leu Leu Val Gln Tyr Pro Arg Phe Ala Asp

1 5 10 15

Thr Leu Thr Ala Gly Gln Pro Ile Thr Leu Glu Glu Leu Ala Thr Pro

20 25 30

Glu Val Ile Leu Glu Ala Val Ala Lys Gly Gln Glu Ile Phe Gly Ile

35 40 45

Glu Gln Pro Lys His Ala Ala Gln Leu Trp Phe His Ser Leu Cys Thr

50 55 60

Ala Ile Val Gly Pro Ala Val Thr Ala Met Val Glu Phe Asp Val Ile

65 70 75 80

Pro Ser Leu Asp Ile Arg Arg Gly Gln Leu His Asn Ile Asp Gly Tyr

85 90 95

Trp Phe Gly Phe Arg Pro Glu Glu Met Leu Val Asp Ala Ser Leu His

100 105 110

Leu Ser Gly Thr Gln Phe Gly Glu Ser Ile Arg Val Val Ile Asp Ala

115 120 125

Leu Cys Ala Ala Thr Asp Leu Arg Pro Ala Pro Leu Trp Ala Val Ala

130 135 140

Ser Asp Ala Leu Gly Ile Ala Ala Ser Gly Ala Gly Val Glu Ala Phe

145 150 155 160

Glu Glu Glu His Ala Arg Glu Val Ala Glu Ala Leu Ile Glu Gly Met

165 170 175

Asn Ser Val Asn Ser Val Pro Ser Pro Arg Phe Asn Asp Asp Asp Tyr

180 185 190

Phe Ile Arg Ala Gly Cys Cys Met Ile Phe His Ser Pro Arg Ala Asp

195 200 205

Phe Cys Thr Ser Cys Pro Gln Lys Arg

210 215

<210> 2

<211> 654

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 2

atgagcatct ggaaacgtct gttagtgcag tacccgcgct tcgccgacac cctcacagcc 60

ggccaaccca tcacgctcga ggaattagca accccggaag tgatcttgga agctgttgcc 120

aaaggccaag aaattttcgg cattgagcag ccaaaacatg cagcacaact ctggtttcac 180

tccctgtgca ccgcaattgt cggccccgcc gtcaccgcca tggtggaatt cgatgtcatc 240

cccagcctcg acatacgtcg aggtcagctg cataacatcg acggttactg gttcggcttc 300

aggccggagg agatgcttgt cgacgcctcc ctccacctgt cgggcaccca attcggcgag 360

agtatccgcg tggtgattga tgcattatgc gctgccacgg atctgcgacc ggcacccctg 420

tgggcggttg cctcagatgc gttgggaatc gcagctagcg gcgcaggtgt cgaggccttt 480

gaagaagaac atgcccgcga ggtggcggaa gccctcattg aaggaatgaa tagtgtgaac 540

tcagttccat cgccgcggtt taacgacgac gattatttca ttcgagctgg atgctgcatg 600

attttccact caccacgagc tgatttttgc acgtcgtgcc cacagaagag gtga 654

<210> 3

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 3

atgacatgat tacgaattca cactcctctg gctaggtag 39

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 4

atgatgtcgg tggtgccgtc t 21

<210> 5

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 5

acggcaccac cgacatcatc ttcacctgcc ctcgttcc 38

<210> 6

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 6

ggtcgactct agaggatcca cgcaggtgcc tgagacctt 39

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 7

atgacatgat tacgaattca tctctgtgca ctcatctac 39

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 8

tgctaattcc tcgagcgtga 20

<210> 9

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 9

cacgctcgag gaattagcac gagctggatg ctgcatgat 39

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 10

agttattggt gcccttcgat tccaaaagtg cagcctaga 39

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 11

ttcatgctaa ttcctcgagc gtga 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 12

aaactcacgc tcgaggaatt agca 24

<210> 13

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 13

acaggtacag tgtaattcag ttttagagct agaaatagc 39

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 14

tcagtcacct cctagctgac 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 15

gtcagctagg aggtgactga 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 16

tgaattacac tgtacctgtt 20

<---

Claims (68)

1. An L-lysine-producing bacterium Corynebacterium glutamicum, wherein, compared to a wild-type strain containing an endogenous polypeptide, the L-lysine-producing bacterium has at least one of the following characteristics (i)-(iii): (i) reduced or absent polypeptide activity of the endogenous polypeptide; (ii) reduced or absent expression level of the gene encoding the endogenous polypeptide; and (iii) reduced or absent expression level of the polynucleotide of interest; wherein said endogenous polypeptide is a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by a sequence having at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; And said polynucleotide of interest is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2, or a polynucleotide encoded by a sequence having at least 90% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2. 2. The L-lysine producing bacterium according to claim 1, wherein in said bacterium, a polypeptide having 98% or more homology with the polypeptide shown in SEQ ID NO: 1 and having a FhuF domain at the C-terminus is inactivated. 3. The L-lysine producing bacterium according to claim 2, wherein the polypeptide shown in SEQ ID NO: 1 is inactivated in the bacterium. 4. The L-lysine-producing bacterium according to claim 2 or 3, wherein inactivation of the polypeptide means that, compared with the endogenous polypeptide, transcription or expression of the encoding gene for the polypeptide is reduced by at least 30%, or the encoding gene for the polypeptide is knocked out; or the activity of the polypeptide is reduced by at least 30%. 5. L-lysine-producing bacterium according to any one of paragraphs. 1-4, where, compared with an L-lysine-producing strain containing an endogenous polypeptide, the L-lysine yield of the L-lysine-producing bacterium is increased by at least 5%; And preferably, compared to an L-lysine-producing strain containing an endogenous polypeptide, the L-lysine-producing bacterium has a glucose conversion increased by at least 10% during the production of L-lysine. 6. L-lysine-producing bacterium according to any one of paragraphs. 1-5, wherein one or more genes selected from the group consisting of the following L-lysine producing bacterium genes are enhanced or overexpressed: a ₁ ) lysC gene, encoding aspartate kinase, which weakens feedback inhibition of lysine; b ₁ ) dapA gene, encoding dihydrodipyridine synthase, which weakens feedback inhibition of lysine; c ₁ ) dapB gene encoding dihydrodipicoline reductase; d ₁ ) ddh gene encoding diaminopimelate dehydratase; e ₁ ) dapD, encoding tetrahydrodipicolinate succinylase, and dapE, encoding succinyldiaminopimelate deacylase; f ₁ ) asd gene, encoding aspartate-semialdehyde dehydratase; g ₁ ) ppc gene encoding phosphoenolpyruvate carboxylase; And h ₁ ) pntAB gene, encoding niacinamide adenine dinucleotide transhydrogenase; optionally one or more genes selected from the group consisting of the following genes of the L-lysine producing bacterium are attenuated or their expression is reduced: a ₂ ) adhE gene encoding ethanol dehydratase; b ₂ ) ackA gene, encoding acetate kinase; c ₂ ) pta gene encoding phosphate acetyltransferase; d ₂ ) ldhA gene, encoding lactate dehydratase; e ₂ ) focA gene, encoding the formate transporter; f ₂ ) pflB gene encoding pyruvate formate lyase; g ₂ ) poxB gene encoding pyruvate oxidase; h ₂ ) thrA gene encoding aspartate kinase I/homoserine dehydratase I as a bifunctional enzyme; i ₂ ) thrB gene, encoding homoserine kinase; j ₂ ) ldcC gene encoding lysine decarboxylase; And h ₂ ) cadA gene, encoding lysine decarboxylase. 7. A method for constructing the bacterium Corynebacterium glutamicum producing L-lysine, including the stages: modifying a wild-type strain containing an endogenous polypeptide in order to reduce or ensure that the polypeptide activity of the endogenous polypeptide of the wild-type strain is absent; or modifying a wild-type strain containing an endogenous polypeptide to reduce or eliminate the level of expression of a gene encoding the endogenous polypeptide of the wild-type strain; or modifying the wild-type strain to reduce or eliminate the level of expression of the polynucleotide of interest in the wild-type strain; where the endogenous polypeptide is a polypeptide having the amino acid sequence presented in SEQ ID NO:1, or a polypeptide encoded by a sequence having at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO:1; And a polynucleotide of interest is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2, or a polynucleotide encoded by a sequence having at least 90% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2. 8. The construction method according to claim 7, wherein the bacterium is modified, and wherein the polypeptide having 98% or more homology with the polypeptide presented in SEQ ID NO: 1 and having a FhuF domain at the C-terminus is inactivated. 9. The method of claim 7 or 8, wherein the bacterium is modified, and wherein the polypeptide shown in SEQ ID NO: 1 is inactivated. 10. The method according to claim 8 or 9, wherein inactivation of the polypeptide means that, compared with the endogenous polypeptide, transcription or expression of the polypeptide encoding gene is reduced by at least 30%, or the polypeptide encoding gene is knocked out; or reduced or absent activity of a polypeptide means that the activity of the polypeptide is reduced by at least 30%. 11. Method according to any one of paragraphs. 7-10, further comprising enhancing or overexpressing one or more genes selected from the group consisting of the following genes in the bacterium: a ₁ ) lysC gene, encoding aspartate kinase, which weakens feedback inhibition of lysine; b ₁ ) dapA gene, encoding dihydrodipyridine synthase, which weakens feedback inhibition of lysine; c ₁ ) dapB gene encoding dihydrodipicoline reductase; d ₁ ) ddh gene encoding diaminopimelate dehydratase; e ₁ ) dapD, encoding tetrahydrodipicolinate succinylase, and dapE, encoding succinyldiaminopimelate deacylase; f ₁ ) asd gene, encoding aspartate-semialdehyde dehydratase; g ₁ ) ppc gene encoding phosphoenolpyruvate carboxylase; And h ₁ ) pntAB gene, encoding niacinamide adenine dinucleotide transhydrogenase; Optionally, the construction method further comprises attenuating one or more genes selected from the group consisting of the following genes in a bacterium or reducing the expression of one or more genes selected from the group consisting of the following genes in a bacterium: a ₂ ) adhE gene encoding ethanol dehydratase; b ₂ ) ackA gene, encoding acetate kinase; c ₂ ) pta gene encoding phosphate acetyltransferase; d ₂ ) ldhA gene, encoding lactate dehydratase; e ₂ ) focA gene, encoding the formate transporter; f ₂ ) pflB gene encoding pyruvate formate lyase; g ₂ ) poxB gene encoding pyruvate oxidase; h ₂ ) thrA gene encoding aspartate kinase I/homoserine dehydratase I as a bifunctional enzyme; i ₂ ) thrB gene, encoding homoserine kinase; j ₂ ) ldcC gene encoding lysine decarboxylase; And h ₂ ) cadA gene, encoding lysine decarboxylase. 12. A method for producing L-lysine, including: 1) cultivation of the bacterium Corynebacterium glutamicum, producing L-lysine, according to any one of claims. 1-6 or the bacterium Corynebacterium glutamicum, producing L-lysine, constructed by the method according to any one of paragraphs. 7-11, so that the L-lysine-producing bacterium begins to produce L-lysine; And 2) optionally separating L-lysine from the culture solution obtained in step 1).