CN115449519B - Polynucleotide having promoter activity based on dapB gene and use thereof - Google Patents

Polynucleotide having promoter activity based on dapB gene and use thereof Download PDF

Info

Publication number
CN115449519B
CN115449519B CN202110638508.4A CN202110638508A CN115449519B CN 115449519 B CN115449519 B CN 115449519B CN 202110638508 A CN202110638508 A CN 202110638508A CN 115449519 B CN115449519 B CN 115449519B
Authority
CN
China
Prior art keywords
gene
acid
protein
polynucleotide
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110638508.4A
Other languages
Chinese (zh)
Other versions
CN115449519A (en
Inventor
孙际宾
刘娇
郑平
周文娟
孙冠男
陈久洲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN202110638508.4A priority Critical patent/CN115449519B/en
Priority to PCT/CN2022/094734 priority patent/WO2022257757A1/en
Priority to ES202390215A priority patent/ES2958335A2/en
Priority to BR112023024799A priority patent/BR112023024799A2/en
Publication of CN115449519A publication Critical patent/CN115449519A/en
Application granted granted Critical
Publication of CN115449519B publication Critical patent/CN115449519B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present disclosure belongs to the field of biotechnology and genetic engineering technology, and specifically relates to a polynucleotide having promoter activity, a transcription expression cassette comprising the polynucleotide having promoter activity, a recombinant expression vector, a recombinant host cell, and a construction method of a promoter mutant, a method of regulating transcription of a target gene, a method of preparing a protein, and a method of producing a target compound. The polynucleotide having promoter activity in the present disclosure is a mutant of a dihydrodipicolinate reductase gene (dapB gene) promoter, and the promoter activity of the mutant is significantly improved as compared with that of a wild-type dapB gene. After the mutant is operably connected with the target gene, the expression efficiency of the target gene can be obviously improved, so that the yield and the conversion rate of the target compound are effectively improved, and the method has important industrial application value.

Description

Polynucleotide having promoter activity based on dapB gene and use thereof
Technical Field
The present disclosure belongs to the field of biotechnology and genetic engineering technology, and specifically relates to a polynucleotide having promoter activity, a transcription expression cassette comprising the polynucleotide having promoter activity, a recombinant expression vector, a recombinant host cell, a construction method of a promoter mutant, a method for regulating transcription of a target gene, a method for preparing a protein, and a method for producing a target compound.
Background
The microbial fermentation method can produce various target compounds, such as amino acid, organic acid and the like, and the target compounds can be widely applied to the fields of medicines, foods, animal feeds, cosmetics and the like and have great economic value. In recent years, with increasing market demands for amino acids, organic acids, and the like, it is an important problem to be solved how to increase the yield of a target compound and realize industrial mass production of the target compound.
The breeding of high-yield fermentation microorganisms is an important means for improving the industrial yield of target compounds, and compared with the traditional mutation breeding technology, the genetic engineering breeding technology is widely applied due to strong pertinence and high efficiency. Numerous studies have shown that efficient expression of key genes in the synthesis pathway of a target compound is key to improving yield and conversion rate of the target compound.
The key genes in the microbial metabolic pathway are modified by a genetic engineering method, and the method is an important method for improving the fermentation yield of a target compound. Promoters are important regulatory elements affecting gene expression, and fine regulation of promoters can achieve optimization of the conversion rate of a target compound. The promoters with different expression strengths can meet the requirements of different genes on different expression strengths, and further can improve the yield and the conversion rate of the target compound.
Therefore, the development of more promoters with high activity to enhance the expression of key genes in the synthesis pathway of target compounds, improve the yield of the target compounds and enhance the competitiveness of the biological fermentation industry is an important problem to be solved in the field of microbial fermentation.
Disclosure of Invention
Problems to be solved by the invention
In view of the technical problems in the prior art, for example, it is necessary to develop more promoters having high activity to increase the expression of key genes in the synthetic pathway of a target compound. To this end, the present disclosure provides a polynucleotide having promoter activity comprising a sequence as set forth in SEQ ID NO:1, compared with a wild promoter, the promoter activity of the mutant provided by the disclosure is obviously improved, and an expression regulatory element with great application potential is provided for the modification of a target gene. The mutant is operably connected with a target gene, so that the expression of the target gene can be effectively improved, and the yield and the conversion rate of a target compound can be effectively improved.
Means for solving the problems
The present disclosure provides a polynucleotide having promoter activity, wherein the polynucleotide is selected from any one of the following groups (i) to (iv):
(i) Comprises the amino acid sequence shown as SEQ ID NO:1, which mutant is represented in SEQ ID NO:1 at one or more positions 75-95 of the sequence set forth in seq id no;
(ii) (ii) a polynucleotide comprising a sequence that is the reverse complement of the nucleotide sequence set forth in (i);
(iii) (iii) a polynucleotide comprising a sequence that is the reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions;
(iv) (iii) a polynucleotide having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to the nucleotide sequence set forth in (i) or (ii);
wherein the polynucleotide of any one of (i) - (iv) is as set forth in SEQ ID NO:1 is not TCTGAACGGGTACGTCTAGAC; and, to SEQ ID NO:1 has an enhanced promoter activity as compared to a polynucleotide of any one of (i) to (iv).
In some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the mutant has a sequence identical to SEQ ID NO:1, has a promoter activity which is 3 to 12 times or more improved as compared with the polynucleotide having the sequence shown in 1.
In some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the mutant corresponds to SEQ ID NO:1 is selected from the group consisting of (P) dapB -1)-(P dapB -3) any one of the group consisting of:
(P dapB -1)CTCTGATGTGATAGTATAATT；
(P dapB -2)ATCATTTGGTGTATACTAAAT；
(P dapB -3)GTCCTGTGGTAAACTTTAGCG。
in some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the nucleotide sequence of the mutant is selected from the group consisting of SEQ ID NO: 2-4.
The present disclosure also provides a transcriptional expression cassette, wherein the transcriptional expression cassette comprises a polynucleotide having promoter activity according to the present disclosure; optionally, the transcription expression cassette further comprises a gene of interest operably linked to the polynucleotide having promoter activity; preferably, the target gene is a protein-encoding gene.
The present disclosure also provides a recombinant expression vector, wherein the recombinant expression vector comprises the polynucleotide having promoter activity according to the present disclosure, or the transcription expression cassette according to the present disclosure.
The present disclosure also provides a recombinant host cell, wherein the recombinant host cell comprises the transcriptional expression cassette of the present disclosure, or the recombinant expression vector of the present disclosure.
In some embodiments, the recombinant host cell according to the present disclosure, wherein the host cell is derived from a corynebacterium, brevibacterium, arthrobacter, microbacterium, or escherichia; preferably, the host cell is corynebacterium glutamicum or escherichia coli; more preferably, the host cell is Corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, corynebacterium glutamicum ATCC 14067 or a derivative strain of Corynebacterium glutamicum.
The present disclosure also provides a polynucleotide having promoter activity according to the present disclosure, a transcription expression cassette according to the present disclosure, a recombinant expression vector according to the present disclosure, use of a recombinant host cell according to the present disclosure in at least one of:
(a) Enhancing the transcription level of a gene, or preparing a reagent or a kit for enhancing the transcription level of a gene;
(b) Preparing a protein, or preparing a reagent or kit for preparing a protein;
(c) Producing a compound of interest, or preparing a reagent or kit for producing a compound of interest.
In some embodiments, the use according to the present disclosure, wherein the protein is selected from a gene expression regulatory protein, a protein associated with synthesis of a compound of interest, or a protein associated with membrane transport.
In some embodiments, the use according to the present disclosure, wherein the target compound comprises at least one of an amino acid, an organic acid;
optionally, the amino acid comprises one or a combination of two or more of the following: proline, hydroxyproline, lysine, glutamic acid, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or a derivative of any of the foregoing amino acids;
optionally, the organic acid comprises one or a combination of two or more of: citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, pentanoic acid, malic acid or derivatives of any of the above organic acids.
The present disclosure also provides a construction method of the promoter mutant, wherein the construction method comprises the following steps:
mutation step: for SEQ ID NO:1, and mutating the polynucleotide having the sequence shown in SEQ ID NO:1 having a mutation at one or more positions 75-95 of the sequence set forth in seq id no;
a screening step: screening for peptides similar to SEQ ID NO:1, and a mutant of the polynucleotide having an increased promoter activity as compared with the polynucleotide having the sequence shown in 1.
In some embodiments, the method of construction according to the present disclosure, wherein the mutating step comprises: for SEQ ID NO:1, and mutating the polynucleotide having the sequence shown in SEQ ID NO:1, and nucleotide mutations at 75-95 th positions of the sequence shown in the formula 1 are nucleotide sequences shown as follows: nnnnnnnnnnnnnnnnnnnnnnnnnntntannn; wherein N is selected from A, T, C or G;
preferably, the amino acid sequence is identical to SEQ ID NO:1, the promoter mutant has a promoter activity which is increased by 3 to 12 times or more as compared with the polynucleotide having the sequence shown in 1.
The present disclosure also provides a method of regulating transcription, wherein the method comprises the step of operably linking the polynucleotide having promoter activity according to the present disclosure with a target RNA or a target gene. Optionally, the target RNA comprises at least one of tRNA, sRNA, and the target gene comprises at least one of a gene encoding a protein involved in synthesis of a target compound, a gene encoding a gene expression regulatory protein, and a gene encoding a protein involved in membrane transport;
optionally, the target gene comprises at least one of: pyruvate carboxylase gene, phosphoenolpyruvate carboxylase gene, gamma-glutamyl kinase gene, glutamate semialdehyde dehydrogenase gene, pyrroline-5-carboxylate reductase gene, amino acid transporter gene, ptsG system-related gene, pyruvate dehydrogenase gene, homoserine dehydrogenase gene, oxaloacetate decarboxylase gene, glucorepressor gene, glucose dehydrogenase gene, aspartokinase gene, aspartate semialdehyde dehydrogenase gene, aspartate ammonia lyase gene, dihydrodipicolinate synthase gene, dihydropicolinate reductase gene, succinyldiaminopimelate aminotransferase gene, tetrahydropyridinedicarboxylate succinylase gene, succinyldiaminopimelate deacylase gene, diaminopimelate epimerase gene, diaminopimelate deacylase gene, glyceraldehyde-3-phosphate dehydrogenase gene, transketolase gene, diaminopimelate dehydrogenase gene.
The present disclosure also provides a method of producing a protein, wherein the method comprises the step of expressing the protein using the transcription expression cassette of the present disclosure, the recombinant expression vector of the present disclosure, or the recombinant host cell of the present disclosure; optionally, the protein is a protein associated with synthesis of a target compound, a protein associated with membrane transport, or a gene expression regulatory protein;
optionally, the method further comprises the step of isolating or purifying the protein.
The present disclosure also provides a method for producing a target compound, wherein the method comprises the step of expressing a protein involved in synthesis of the target compound, a protein involved in membrane transport or a gene expression regulatory protein using the transcription expression cassette, the recombinant expression vector or the recombinant host cell of the present disclosure, and producing the target compound in the presence of the protein involved in synthesis of the target compound, the protein involved in membrane transport or the gene expression regulatory protein;
optionally, the target compound comprises at least one of an amino acid, an organic acid;
optionally, the amino acid comprises one or a combination of two or more of the following: lysine, glutamic acid, threonine, proline, hydroxyproline, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or a derivative of any of the above amino acids;
optionally, the organic acid comprises one or a combination of two or more of: citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, pentanoic acid, malic acid, or a derivative of any of the above-mentioned organic acids;
optionally, the protein involved in the synthesis of the target compound is a protein involved in the synthesis of an L-amino acid; optionally, the protein involved in L-amino acid synthesis comprises one or a combination of two or more of pyruvate carboxylase, phosphoenolpyruvate carboxylase, γ -glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydrodipicolinate reductase, dihydropicolinate reductase, succinyl diaminopimelate aminotransferase, tetrahydropyridinedicarboxylate succinylase, succinyl diaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, transketolase, diaminopimelate dehydrogenase;
optionally, the method further comprises the step of isolating or purifying the target compound.
ADVANTAGEOUS EFFECTS OF INVENTION
In some embodiments, the polynucleotide having promoter activity provided by the present disclosure is a mutant of a dihydrodipicolinate reductase gene (dapB gene) promoter, the mutant having significantly increased promoter activity compared to the promoter of a wild-type dapB gene. After the mutant is operably connected with the target gene, the expression efficiency of the target gene can be obviously improved, and an expression element with high application potential is provided for the transformation of key genes in the synthesis path of a target compound. The mutant is applied to the production of target compounds, can obviously improve the conversion rate of the target compounds, and provides a strong promoter with great application potential for the industrial fermentation of the target compounds such as amino acid, organic acid and the like.
In some embodiments, the present disclosure provides polynucleotides having promoter activity with 3-12 fold or more increased promoter activity compared to the promoter of the wild-type dapB gene.
In some embodiments, the present disclosure provides transcriptional expression cassettes, recombinant expression vectors, recombinant host cells, comprising the polynucleotides having promoter activity described above. In a transcription expression cassette, a recombinant expression vector and a recombinant host cell, the polynucleotide with promoter activity is operably connected with a target gene, and the high-efficiency expression of key genes in a target compound synthesis path can be realized.
In some embodiments, the present disclosure provides a method for preparing a protein, which can increase the expression amount of a protein or a gene expression regulatory protein involved in the synthesis of amino acids, organic acids, etc., thereby achieving efficient production of a target compound.
In some embodiments, the present disclosure provides a method for producing a target compound, which can increase the expression efficiency of a protein involved in the synthesis of the target compound by using the polynucleotide having promoter activity, thereby effectively increasing the yield and the transmissibility of the target compound and realizing large-scale industrial production of the target compound.
Drawings
FIG. 1 shows pEC-XK99E-P dapB -plasmid map of rfp;
FIG. 2 shows a graph of fluorescence results of growing mutant clones on plate medium.
Detailed Description
The terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification can mean "one," but can also mean "one or more," at least one, "and" one or more than one.
As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.
Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.
When used in the claims or specification, the term "range of values" is selected/preferred to include both the end points of the range and all natural numbers subsumed within the middle of the end points of the range with respect to the aforementioned end points of values.
As used in this disclosure, the term "dihydrodipicolinate reductase" (dihydrodipicolinate reductase) catalyzes an NAD (P) H-dependent reductive reaction of dihydrodipicolinate to produce pipecolinic acid. The dihydrodipicolinate reductase is encoded by the dapB gene. In some embodiments, the dapB gene of the present disclosure is derived from Corynebacterium glutamicum (Corynebacterium glutamicum).
As used in this disclosure, the term "phosphoenolpyruvate carboxylase" (Phosphopyruvate carboxylase) catalyzes the conversion of phosphoenolpyruvate (PEP) to oxaloacetate, encoded by the ppc gene.
As used in this disclosure, the term "Pyruvate carboxylase" (Pyruvate carboxylase) catalyzes the reversible carboxylation of Pyruvate, forming oxaloacetate, encoded by the pyc gene.
As used in this disclosure, the term "polynucleotide" refers to a polymer composed of nucleotides. Polynucleotides may be in the form of individual fragments, or may be a component of a larger nucleotide sequence structure, derived from nucleotide sequences that have been isolated at least once in quantity or concentration, and which are capable of being recognized, manipulated, and recovered in sequence, and their component nucleotide sequences, by standard molecular biology methods (e.g., using cloning vectors). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T". In other words, "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (either individual fragments or whole fragments), or may be a component or constituent of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.
As used in this disclosure, the term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, that can be isolated from a source in nature, and that has not been intentionally modified by man in the laboratory, is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonyms. In some embodiments, the wild-type promoter in the present disclosure refers to the promoter of the wild-type dapB gene, i.e. the promoter as set forth in SEQ ID NO: 1.
As used in this disclosure, the term "mutant" refers to a polynucleotide that comprises alterations (i.e., substitutions, insertions, and/or deletions) at one or more (e.g., several) positions relative to a "wild-type", or "comparable" polynucleotide or polypeptide, wherein a substitution refers to the substitution of a nucleotide occupying one position with a different nucleotide.
In some embodiments, a "mutation" of the present disclosure is a "substitution", which is a mutation caused by the substitution of a base in one or more nucleotides with another, different base, also referred to as a base substitution mutation (mutation) or a point mutation (point mutation).
Specifically, SEQ ID NO:1 is the promoter sequence of the dapB gene comprising the nucleotide sequence "ACGGTCAGTTAGGTATGGATCACAGCACCTTCTGAACGGGTACGTCTAGACTGGTGGGCG ", wherein the underlined position is a-10 region sequence. The mutants in this disclosure are at position-10Mutant nucleotide is introduced nearby, and after mutation is introduced at the position, the activity of the mutant promoter is obviously enhanced, a novel strong promoter is obtained, and abundant expression regulatory elements are provided for efficient synthesis of a target compound.
In some embodiments, a polynucleotide having promoter activity refers to a polynucleotide comprising a sequence as set forth in SEQ ID NO:1, which mutant is a variant of a polynucleotide having a sequence as set forth in SEQ ID NO:1, and does not comprise a nucleotide having a mutation at one or more of positions 75-95 of the sequence set forth in SEQ ID NO:1 into the TCTGAACGGGGTACGTCTAGAC. And a polypeptide comprising SEQ ID NO:1, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 1.
In some embodiments, the nucleic acid sequence of SEQ ID NO:1, and a polynucleotide comprising the sequence of SEQ ID NO:1, has a promoter activity which is increased by 3 to 12 times or more as compared with the polynucleotide having the sequence shown in 1.
In some more specific embodiments, the mutant has a mutation in a sequence comprising SEQ ID NO:1, has 3.7, 3.8 and 11.2 times higher promoter activity than the polynucleotide having the sequence shown in 1.
As used in this disclosure, the term "promoter" refers to a nucleic acid molecule, typically located upstream of the coding sequence of a target gene, that provides a recognition site for RNA polymerase and is located upstream in the 5' direction of the mRNA transcription start site. It is a nucleic acid sequence that is not translated and RNA polymerase binds to this nucleic acid sequence to initiate transcription of the target gene. In ribonucleic acid (RNA) synthesis, a promoter may interact with transcription factors that regulate gene transcription, controlling the initiation time and extent of gene expression (transcription), including the core promoter region and regulatory regions, like a "switch," which determines the activity of the gene and, in turn, which protein the cell begins to produce.
As used in this disclosure, the term "promoter core region" refers to a nucleic acid sequence located in a promoter region of a prokaryote, which is a core sequence region functioning as a promoter, mainly including a region between-35 region, -10 region, -35 region and-10 region, and a transcription initiation site, -35 region is a recognition site for RNA polymerase, and-10 region is a binding site for RNA polymerase. In some embodiments, the polynucleotide having promoter activity of the present disclosure is a mutant comprising a promoter core region of dapB gene, and a mutation is introduced near the-10 position of the promoter core region to obtain significantly increased promoter activity compared to the promoter of dapB gene.
As used in this disclosure, the terms "sequence identity" and "percent identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides containing the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides containing different nucleotide or amino acid residues. Polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or deleted nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). Polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.
In some embodiments, two or more sequences or subsequences have "sequence identity" or "percent identity" of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleotide when compared and aligned for maximum correspondence as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both of the biopolymers (e.g., polynucleotides) being compared.
As used in this disclosure, the term "complementary" refers to hybridization or base pairing between nucleotides, such as between two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide being sequenced or amplified, and the like.
As used in this disclosure, the term "high stringency conditions" means prehybridization and hybridization at 42 ℃ in 5X SSPE (saline sodium phosphate EDTA), 0.3% sds, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide for 12 to 24 hours, following standard southern blotting procedures for probes of at least 100 nucleotides in length. Finally, the carrier material is washed three times, each for 15 minutes, at 65 ℃ using 2 XSSC, 0.2% SDS.
As used in this disclosure, the term "very high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ℃ in 5 SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard southern blotting procedures for 12 to 24 hours. Finally, the carrier material is washed three times, each for 15 minutes, at 70 ℃ using 2 XSSC, 0.2% SDS.
In some embodiments, the polynucleotides of the present disclosure having promoter activity can be used to initiate expression of a protein-encoding gene. In some other embodiments, the polynucleotides of the present disclosure having promoter activity can be used to initiate expression of a non-coding gene.
As used in this disclosure, the term "expression" includes any step involving RNA production and protein production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
As used in this disclosure, the term "transcriptional expression cassette" is a recombinant expression element comprising a polynucleotide having promoter activity. In some embodiments, the transcriptional regulatory element that regulates the target gene may include, in addition to a polynucleotide having promoter activity, an enhancer, a silencer, an insulator, and the like. In some embodiments, the target gene in the present disclosure is specifically a protein-encoding gene. "operably linked" with a polynucleotide having promoter activity means that the polynucleotide having promoter activity is functionally linked with the target gene to initiate and mediate transcription of the target gene in any manner described by one skilled in the art.
As used in this disclosure, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to suitable control sequences for expression of a gene of interest in a suitable host. "recombinant expression vector" refers to a DNA construct used to express, for example, a polynucleotide encoding a desired polypeptide. Recombinant expression vectors can include, for example, a collection comprising i) genetic elements that have a regulatory effect on gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) transcriptional subunits of appropriate transcriptional and translational initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not critical and any vector may be used, including plasmids, viruses, phages and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40 and pseudorabies. In the present disclosure, "recombinant expression vector" and "recombinant vector" may be used interchangeably.
As used in this disclosure, the term "target RNA" includes functional RNAs that play a role in genetic coding, translation, regulation, gene expression, and the like. In the present disclosure, the target RNA linked to the polynucleotide having promoter activity may be any functional RNA in the art.
In some embodiments, the target RNA is tRNA or sRNA. In other embodiments, the target RNA may also be sgRNA, crRNA, tracrRNA, miRNA, siRNA, or other species of RNA.
As used in this disclosure, the term "target gene" relates to any one of genes linked to a polynucleotide having promoter activity in this disclosure to regulate the transcription level thereof.
In some embodiments, the target gene is a gene encoding a protein involved in the synthesis of the target compound. In some embodiments, the target gene is a gene encoding a gene expression regulatory protein. In some embodiments, the target gene is a gene encoding a protein associated with membrane transport.
Illustratively, the target gene is a gene encoding an enzyme involved in biosynthesis of the target compound, a gene encoding an enzyme involved in reducing power, a gene encoding an enzyme involved in glycolysis or TCA cycle, or a gene encoding an enzyme involved in release of the target compound, or the like.
Illustratively, the target gene includes at least one of the following genes: pyruvate carboxylase gene, phosphoenolpyruvate carboxylase gene, gamma-glutamyl kinase gene, glutamate semialdehyde dehydrogenase gene, pyrroline-5-carboxylate reductase gene, amino acid transporter gene, ptsG system-related gene, pyruvate dehydrogenase gene, homoserine dehydrogenase gene, oxaloacetate decarboxylase gene, glucorepressor gene, glucose dehydrogenase gene, aspartokinase gene, aspartate semialdehyde dehydrogenase gene, aspartate ammonia lyase gene, dihydrodipicolinate synthase gene, dihydropicolinate reductase gene, succinyldiaminopimelate aminotransferase gene, tetrahydropyridinedicarboxylate succinylase gene, succinyldiaminopimelate deacylase gene, diaminopimelate epimerase gene, diaminopimelate deacylase gene, glyceraldehyde-3-phosphate dehydrogenase gene, transketolase gene, diaminopimelate dehydrogenase gene. As used in this disclosure, the term "target compound" may be selected from amino acids, organic acids, and also from other classes of compounds that are available in the art, possibly by biosynthesis.
In some embodiments, the compound of interest is an "amino acid" or an "L-amino acid". "amino acid" or "L-amino acid" generally refers to the basic building block of a protein in which an amino group and a carboxyl group are bound to the same carbon atom. Illustratively, the amino acid is selected from one or more of the following: glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, hydroxyproline, 5-aminolevulinic acid, or a derivative of any of the above amino acids. In addition, the amino acid may be other kinds of amino acids in the art.
In some embodiments, the target compound is an organic acid. The organic acid may be an organic compound having acidity, for example, those including a carboxyl group and a sulfonic acid group. Exemplary organic acids include one or more of the following: lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, citric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, valeric acid, malic acid or derivatives of any of the above organic acids. Further, the organic acid may be other kinds of organic acids in the art.
The term "protein-encoding gene" in the present disclosure refers to a synthetic DNA molecule capable of directing a protein through a certain rule, and the process of directing protein synthesis by a protein-encoding gene generally includes a transcription process using double-stranded DNA as a template and a translation process using mRNA as a template. The protein-encoding gene contains a CDS Sequence (Coding Sequence) that directs the production of mRNA encoding the protein.
Illustratively, protein-encoding genes include, but are not limited to, genes encoding proteins involved in the synthesis of the compound of interest, and in some embodiments, the protein-encoding genes are involved in genes encoding proteins involved in the synthesis of L-amino acids. Exemplary proteins involved in the synthesis of L-amino acids include, but are not limited to, pyruvate carboxylase, phosphoenolpyruvate carboxylase, gamma-glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, or a combination of two or more thereof. In some embodiments, the protein involved in the synthesis of L-amino acids is a protein involved in the synthesis of L-lysine, and for the protein involved in the synthesis of L-lysine, one or a combination of two or more of aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydrodipicolinate reductase, dihydropicolinate reductase, succinyldiaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyldiaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, lysine transporter, transketolase, diaminopimelate dehydrogenase, and pyruvate carboxylase is included.
In some embodiments, the protein-encoding gene is directed to a gene encoding a protein associated with the synthesis of an organic acid, illustratively a protein-encoding gene for encoding a protein associated with the synthesis of oxaloacetate, a protein associated with the synthesis of citrate, or a protein associated with the synthesis of succinate.
In some embodiments, the protein-encoding gene is involved in a gene encoding an enzyme involved in promoting oxaloacetate synthesis. Illustratively, the protein-encoding gene is the phosphoenolpyruvate carboxylase-encoding gene ppc gene, or the pyruvate carboxylase-encoding gene pyc gene. According to the prior art [1] The expression of the related enzyme promoting the synthesis of oxaloacetate is enhanced, so that the yield of the 5-aminolevulinic acid can be improved.
The term "gene expression regulatory protein" of the present disclosure includes, but is not limited to, exogenous gene expression regulatory tool proteins, such as dCas9 protein, dCpf1 protein, hfq protein, etc., required for sRNA regulation, as well as endogenous or exogenous transcriptional regulatory factors, which in turn regulate the expression of key genes in metabolic pathways.
The term "host cell" in the present disclosure means any cell type that is susceptible to transformation, transfection, transduction, and the like with a transcription initiation element or expression vector comprising a polynucleotide of the present disclosure. The term "recombinant host cell" encompasses host cells which differ from the parent cell after introduction of a transcription initiation element or a recombinant expression vector, the recombinant host cell being specifically achieved by transformation.
The term "transformation" in the present disclosure has the meaning commonly understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The method of transformation includes any method of introducing a nucleic acid into a cell, including, but not limited to, electroporation, calcium phosphate precipitation, calcium chloride (CaCl) 2 ) Precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposome, and lithium acetate-DMSO.
The host cell of the present disclosure may be a prokaryotic cell or a eukaryotic cell, as long as the polynucleotide having promoter activity of the present disclosure can be introduced into the cell. In some embodiments, the host cell refers to a prokaryotic cell, in particular, the host cell is derived from a microorganism suitable for the fermentative production of amino acids, organic acids, such as Corynebacterium, brevibacterium, arthrobacter, microbacterium or Escherichia. Preferably, the host cell is Corynebacterium glutamicum derived from the genus Corynebacterium. Among them, the Corynebacterium glutamicum may be Corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, corynebacterium glutamicum ATCC 14067, or the like, and a mutant strain producing an amino acid, particularly lysine, or a derivative strain of Corynebacterium glutamicum prepared from the above strains. In some embodiments, the host cell in the present disclosure may be any type of strain having an amino acid-producing ability, including wild-type strains and recombinant strains.
Illustratively, the host cell is a lysine-producing host cell. In some embodiments, for lysine-producing host cells, can be in the Corynebacterium glutamicum ATCC13032 based on the expression of feedback inhibition of aspartate kinase strain. In addition, lysine-producing host cells may also be other kinds of strains having lysine-producing ability.
In some embodiments, one or more genes selected from the group consisting of:
a. the adhE gene encoding alcohol dehydrogenase;
b. the ackA gene encoding acetate kinase;
c. a pta gene encoding a phosphate acetyltransferase;
d. an ldhA gene encoding lactate dehydrogenase;
e. the focA gene encoding a formate transporter;
f. the pflB gene encoding pyruvate formate lyase;
g. a poxB gene encoding pyruvate oxidase;
h. a thrA gene encoding an aspartokinase I/homoserine dehydrogenase I bifunctional enzyme;
i. the thrB gene encoding homoserine kinase;
j. an ldcC gene encoding lysine decarboxylase; and
h. the cadA gene which codes for lysine decarboxylase.
In some embodiments, one or more genes selected from the group consisting of:
a. the dapA gene encoding dihydrodipicolinate synthase which relieves feedback inhibition by lysine;
b. a dapB gene encoding dihydrodipicolinate reductase;
c. a ddh gene encoding diaminopimelate dehydrogenase;
d. dapD encoding a tetrahydropyridyldicarboxylate succinylase and dapE encoding a succinyldiaminopimelate deacylase;
e. an asd gene encoding aspartate-semialdehyde dehydrogenase;
f. the ppc gene encoding phosphoenolpyruvate carboxylase;
g. the pntAB gene encoding nicotinamide adenine dinucleotide transhydrogenase;
i. the lysE gene of the transport protein which codes for lysine.
Illustratively, the host cell is a threonine producing host cell. In some embodiments, the threonine producing host cell is a strain that expresses the feedback-released aspartate kinase LysC on the basis of corynebacterium glutamicum ATCC 13032. In other embodiments, the threonine-producing host cell can also be other species of strain that have threonine-producing ability.
In some embodiments, one or more genes selected from the group consisting of:
a. the thrABC gene encoding the threonine operon;
b. the hom gene encoding homoserine dehydrogenase which relieves feedback inhibition;
c. a gap gene encoding glyceraldehyde-3-phosphate dehydrogenase;
d. the pyc gene encoding pyruvate carboxylase;
e. encoding malic acid: the mqo gene of quinone oxidoreductase;
f. the tkt gene encoding transketolase;
g. the gnd gene which codes for 6-phosphogluconate dehydrogenase;
h. the thrE gene encoding threonine export;
i. the eno gene which codes for enolase.
Illustratively, the host cell is a host cell that produces isoleucine. In some embodiments, the host cell that produces isoleucine is a strain that produces L-isoleucine by substituting alanine for the amino acid at position 323 of the ilvA gene of L-threonine dehydratase. In other embodiments, the host cell producing isoleucine may also be another species of strain having isoleucine-producing ability.
Illustratively, the host cell is a host cell producing O-acetylhomoserine. In some embodiments, the host cell producing O-acetylhomoserine is a strain that produces O-acetylhomoserine by inactivation of O-acetylhomoserine (thiol) -lyase. In other embodiments, the host cell producing O-acetylhomoserine can also be other kinds of strains having O-acetylhomoserine producing ability.
Illustratively, the host cell is a host cell that produces methionine. In some embodiments, the methionine producing host cell is a strain that produces methionine by inactivating the transcriptional regulators of methionine and cysteine. In other embodiments, the methionine-producing host cell may be other species of strain having methionine-producing ability.
The cultivation of the host cell of the present disclosure may be performed according to a conventional method in the art, including, but not limited to, a well plate culture, a shake flask culture, a batch culture, a continuous culture, a fed-batch culture, and the like, and various culture conditions such as temperature, time, pH of a medium, and the like may be appropriately adjusted according to actual circumstances.
Unless otherwise defined in the present disclosure or clearly indicated by the background, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Mutant of promoter core region of dapB Gene
The present disclosure uses a promoter core region sequence of dapB gene to introduce a mutation near the promoter-10 region position of dapB gene (region-10 and the first 16bp of region-10) to obtain a mutant of the promoter core region of dapB gene comprising the mutation of region-10.
The polynucleotide having promoter activity of the present disclosure, which has significantly improved promoter activity as compared to a wild-type promoter comprising a promoter core region of dapB gene by mutating the promoter core region of dapB gene, particularly by introducing a mutation near the position of-10 (TCTGAACGGGGTACGTCTAGAC) of the promoter core region of dapB gene, is a novel strong promoter; when applied to fermentation of a target compound, the mutant shows higher conversion rate and yield of the target compound compared with a wild-type promoter.
In some embodiments, the polynucleotide having promoter activity in the present disclosure is a polynucleotide having the sequence set forth in SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides having a mutation at position 75-95. And has a sequence identical to SEQ ID NO:1 has an increased promoter activity as compared with the promoter of the wild-type dapB gene.
In some embodiments, the polynucleotides of the present disclosure having promoter activity further comprise a nucleotide sequence substantially identical to SEQ ID NO:1, and a mutant of the dapB gene promoter having the nucleotide sequence reverse-complementary thereto. And has a sequence identical to SEQ ID NO:1, has an increased promoter activity compared to the promoter of the wild-type dapB gene.
In some embodiments, the polynucleotides having promoter activity in the present disclosure further comprise a promoter sequence that hybridizes under high stringency hybridization conditions or very high stringency hybridization conditions to SEQ ID NO:1, and a polynucleotide which is reverse-complementary to a sequence hybridizing with the nucleotide sequence of the mutant of the dapB gene promoter shown in 1. And said polynucleotide is encoded in a polynucleotide corresponding to SEQ ID NO:1 is not TCTGAACGGGTACGTCTAGAC. And has a sequence identical to SEQ ID NO:1, the polynucleotide has an increased promoter activity as compared to the promoter of the wild-type dapB gene.
In some embodiments, a polynucleotide having promoter activity in the present disclosure is a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity (including all ranges and percentages between these values) to a polynucleotide sequence described above. And said polynucleotide is encoded in a polynucleotide corresponding to SEQ ID NO:1 is not TCTGAACGGGTACGTCTAGAC. And has a sequence identical to SEQ ID NO:1, has an increased promoter activity compared to the promoter of the wild-type dapB gene.
In some embodiments, the mutant corresponds to SEQ ID NO:1 is selected from the group consisting of (P) dapB -1)-(P dapB -3) any one of the group consisting of:
(P dapB -1)CTCTGATGTGATAGTATAATT；
(P dapB -2)ATCATTTGGTGTATACTAAAT；
(P dapB -3)GTCCTGTGGTAAACTTTAGCG。
in some embodiments, the nucleotide sequence of the mutant is selected from the group consisting of SEQ ID NO: 2-4.
In some embodiments, the polynucleotide having promoter activity of the present disclosure is substantially identical to the polynucleotide of SEQ ID NO:1, has a promoter activity which is increased by 3 to 12 times or more as compared with the polynucleotide having the sequence shown in 1. Further, a polypeptide comprising SEQ ID NO:1, has 3.7, 3.8 and 11.2 times higher promoter activity than the polynucleotide having the sequence shown in 1.
Recombinant expression vectors and recombinant host cells
In some embodiments, the present disclosure obtains a DNA fragment of the promoter of dapB Gene and an N-terminal 180bp fragment of dapB Gene by amplification using ATCC13032 genome (Corynebacterium glutamicum ATCC13032, gene ID: 2830649) as a template and dapB-1 and dapB-2 as primers; pEC-XK99E-rfp plasmid is taken as a template [2] pEC-XK99E plasmid skeleton is amplified by taking pEC-1 and pEC-2 as primers; and amplifying a red fluorescent protein gene DNA fragment containing connecting peptide by using RFP-1/2 as a primer and pEC-XK99E-RFP plasmid as a template. The dapB gene promoter fragment, the N-end 180bp fragment, the red fluorescent protein gene DNA fragment containing the connecting peptide and the pEC-XK99E plasmid skeleton are recombined and connected to obtain a recombined expression vector pEC-XK99E-P dapB -rfp。
In some embodiments, the disclosure provides pEC-XK99E-P dapB -rfp is taken as a template, a PdapB-1 primer and a pEC-3 primer are used for amplifying a fragment containing a mutation region, a pEC-4 primer and a pEC-5 primer are used for amplifying a plasmid skeleton fragment, the two fragments are recombined and connected to obtain a recombinant vector pEC-XK99E-P dapB -1-rfp。
In some embodiments, the disclosure provides pEC-XK99E-P dapB Amplifying a fragment containing a mutation region by using a PdapB-2 primer and a pEC-3 primer and using a pEC-4 primer as a template by using rfpAmplifying plasmid skeleton segment with pEC-5 primer, recombining and connecting the two segments to obtain recombinant vector pEC-XK99E-P dapB -2-rfp。
In some embodiments, the disclosure provides pEC-XK99E-P dapB -rfp is taken as a template, a fragment containing a mutation region is amplified by a PdapB-3 primer and a pEC-3 primer, a plasmid skeleton fragment is amplified by a pEC-4 primer and a pEC-5 primer, and the two fragments are recombined and connected to obtain a recombinant vector pEC-XK99E-P dapB -3-rfp。
In other embodiments, the present disclosure may also utilize (P) according to specific cloning requirements dapB -1)～(P dapB -3) constructing a desired recombinant vector from the promoter mutant represented by any one of the above.
In some embodiments, the disclosure provides pEC-XK99E-P dapB -rfp、pEC-XK99E-P dapB -1-rfp、pEC-XK99E-P dapB -2-rfp、pEC-XK99E-P dapB -3-rfp to transform Corynebacterium glutamicum ATCC13032, respectively, to obtain recombinant host cells.
In some embodiments, the present disclosure provides a promoter mutant fragment of each dapB gene amplified using a library plasmid of promoter mutants of the dapB gene as a template and dapB-P1 and dapB-P2 as primers; amplifying a ppc gene fragment by using the genome of Corynebacterium glutamicum ATCC13032 as a template and ppc-1/ppc-2 as primers; plasmid backbone was amplified using pEC-XK99E plasmid as template and PEC-1/PEC-2 primers. And (3) recombining and connecting each promoter mutant fragment with the ppc gene fragment and the plasmid framework respectively to obtain a promoter mutant plasmid of the dapB gene.
In some embodiments, the promoter mutant plasmid of the dapB gene comprises any one of the following: pEC-P dapB -1-ppc、pEC-P dapB -2-ppc、pEC-P dapB-3 -ppc。
In some embodiments, the corynebacterium glutamicum SCgL30 strain of the present disclosure was constructed such that the threonine at position 311 of aspartokinase (encoded by lysC gene) on the genome of corynebacterium glutamicum ATCC13032 was mutated to isoleucine to obtain a strain SCgL30 having a certain lysine synthesis ability.
In some embodiments, the disclosure relates to pEC-P dapB-1 -ppc～pEC-P dapB-3 -transforming the SCgL30 strain with a recombinant expression vector as defined in any of ppc to obtain a recombinant host cell. In some other specific embodiments, the present disclosure may further comprise (P) dapB-1 )～(P dapB-3 ) Any recombinant vector of the promoter mutant is transformed into SCgL30 strain to obtain recombinant host cell.
Process for producing target compound
(1) The polynucleotide with promoter activity is operably connected with a protein coding gene or a gene expression regulatory protein coding gene related to the synthesis of a target compound to obtain a recombinant expression vector of the protein or the gene expression regulatory protein related to the synthesis of the target compound, and the recombinant expression vector is used for transforming a host cell to obtain the recombinant host cell.
(2) And (3) carrying out fermentation culture on the recombinant host cells, and collecting the target compound from the recombinant host cells or a culture solution of the recombinant host cells to finish the production process of the target compound.
In the production process, because the polynucleotide has improved promoter activity, in the recombinant host cell, the transcription activity of the protein related to the synthesis of the target compound or the coding gene of the gene expression regulatory protein is improved, the expression level of the protein related to the synthesis of the target compound or the gene expression regulatory protein is improved, and the yield of the target compound is obviously improved.
In some embodiments, the compound of interest is an amino acid and the gene encoding a protein involved in the synthesis of the compound of interest refers to a gene encoding a protein involved in the synthesis of an amino acid. In some embodiments, the compound of interest is an L-amino acid and the protein-encoding gene associated with a synthetic amino acid refers to a protein-encoding gene associated with a synthetic L-amino acid.
In some embodiments, the protein involved in amino acid synthesis is phosphoenolpyruvate carboxylase, and increasing ppc expression with a polynucleotide having promoter activity can enhance synthesis from phosphoenolpyruvate (PEP) to oxaloacetate, thereby facilitating production of a compound of interest depending on the supply of oxaloacetate precursors, including aspartate family amino acids (lysine, threonine, isoleucine, methionine), glutamate family amino acids (glutamate, proline, hydroxyproline, arginine, glutamate amide), and the like.
In some embodiments, the host cell is Corynebacterium glutamicum (Corynebacterium glutamicum), which is an important strain for producing target compounds such as amino acids and organic acids. After the corynebacterium glutamicum is modified by the polynucleotide, the transcription expression cassette or the recombinant expression vector with strong constitutive promoter activity, the expression amount of proteins related to synthesis of a target compound in the corynebacterium glutamicum is remarkably improved, and further, the capacity of the corynebacterium glutamicum for accumulating the target compound by long-time fermentation is greatly improved.
In some embodiments, the host cell is corynebacterium glutamicum modified as follows: the threonine at position 311 of the aspartokinase (encoded by the lysC gene) in the genome of Corynebacterium glutamicum ATCC13032 was mutated to isoleucine.
In some embodiments, the recombinant host cell is cultured under conditions selected from the group consisting of: inoculating the recombinant host cells into a TSB liquid culture medium for culture, inoculating the culture as seeds into a 24-well plate containing a fermentation culture medium in each well, culturing for 18h at 30 ℃, and detecting the yield of L-lysine after the fermentation is finished, wherein the rotating speed of a plate shaker is 800 rpm.
For the lysine fermentation medium, the formula is as follows: glucose, 80g/L; 1g/L of yeast powder; soybean peptone, 1g/L; naCl,1g/L; ammonium sulfate, 1g/L; 10g/L of urea; k is 2 HPO 4 ·3H 2 O，1g/L；MgSO 4 ·7H 2 O，0.45g/L；FeSO 4 ·7H 2 O,0.05g/L; biotin, 0.4mg/L; vitamin B1,0.1mg/L; MOPS,40g/L; initial pH7.2. The medium was supplemented with 25. Mu.g/mL kanamycin.
In some embodiments, the compound of interest is recovered from the recombinant host cell or the culture broth of the recombinant cell by methods commonly used in the art, including, but not limited to: filtration, anion exchange chromatography, crystallization or HPLC.
Methods for manipulating microorganisms are known in the art, such as modern methods in molecular biology (Online ISBN:9780471142720, john Wiley and sons, inc.), [ metabolic engineering of microorganisms: methods and protocols (Qiong Cheng ed., springer) and "systemic metabolic engineering: methods and protocols (Hal s. Alper ed., springer) etc. publications.
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The experimental techniques and experimental procedures used in this example are, unless otherwise specified, conventional techniques, e.g., those in the following examples, in which specific conditions are not specified, and generally according to conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The materials, reagents and the like used in the examples are commercially available from normal sources unless otherwise specified.
Example 1 construction of plasmid for characterization of the promoter Strength of the dapB Gene of Corynebacterium glutamicum
The promoter of Corynebacterium glutamicum dihydropyridine dicarboxylate reductase dapB (dihydrodipicolinate reductase) gene is selected for strength characterization, and specific region mutation is further introduced to enhance the activity of the promoter, so that a promoter mutant with enhanced expression strength is obtained. In bacteria, the expression regulatory sequences and the N-terminal coding region of a gene are key regions that influence gene expression. The method adopts a dapB gene upstream promoter, a dapB gene N-terminal 180bp coding region, a flexible connecting peptide linker and a red fluorescent protein gene rfp for sequential connection, and characterizes the expression intensity of a target promoter based on fluorescence intensity.
This example first constructs a vector characterizing the dapB gene promoter of C.glutamicum. On the basis of pEC-XK99E plasmid skeleton, the expression regulation region containing promoter at the upstream of gene expresses 60 amino acids, one connecting peptide and red fluorescent protein gene at the N end of the selected gene. The concrete construction is as follows:
(1) Amplification of promoter and N-terminal sequence fragments
Amplification primers were designed based on the published genomic sequence of Corynebacterium glutamicum ATCC13032 (Corynebacterium glutamicum ATCC13032, gene ID 2830649) and the annotation information for the Corynebacterium glutamicum dapB gene. A fragment having the wild-type promoter (sequence shown in SEQ ID NO: 1) and an N-terminal 180bp sequence of dapB was amplified using dapB-1/2 as a primer and ATCC13032 genome as a template.
(2) Amplification of plasmid backbone and rfp fragments
pEC-XK99E-rfp plasmid reported in literature [2] Using pEC-1/2 as a primer to amplify pEC-XK99E plasmid skeleton and RFP-1/2 as a primer to amplify red fluorescent protein gene DNA fragment containing connecting peptide, wherein the DNA sequence is as follows: GGCGGTGGCTCTCTGGAGGTGGTGGGTCCGGCGGTGGCTCT.
The dapB gene promoter and the N-terminal 180bp fragment obtained in the above are respectively connected with a red fluorescent protein gene DNA fragment containing connecting peptide and a pEC-XK99E plasmid skeleton through a one-step recombination kit clone of Novozam to obtain pEC-XK99E-P dapB Rfp characterization vector, plasmid map as shown in FIG. 1, and the sequences of the primers used above as shown in Table 1.
TABLE 1
Figure BDA0003106779680000131
Example 2 modification of the promoter of dapB Gene to enhance the expression Strength
(1) Construction of mutant plasmid of dapB Gene promoter
This example is for pEC-XK99E-P dapB -dapB promoter core region in rfp plasmid (SEQ ID NO:1) and the sequence from position 75 to 95 of the wild-type dapB promoter core region is as follows, wherein the bold TAGACT is the main sequence of the-10 region of the promoter:
ACGGTCAGTTAGGTATGGATATCAGCACCTTCTGAACGGGTACGTCTAGACT GGTGGGCG
the core region of the wild-type dapB promoter is respectively modified into the following sequences:
ACGGTCAGTTAGGTATGGATATCAGCACCTCTCTGATGTGATAGTATAATTTG
GTGGGCG
ACGGTCAGTTAGGTATGGATATCAGCACCTATCATTTGGTGTATACTAAATTG
GTGGGCG
ACGGTCAGTTAGGTATGGATATCAGCACCTGTCCTGTGGTAAACTTTAGCGTGGTGGGCG
the polynucleotide sequences with promoter activity obtained after modification are respectively shown as sequences SEQ ID NO: 2. SEQ ID NO: 3. and SEQ ID NO:4, respectively. The concrete construction is as follows: with pEC-XK99E-P dapB And-rfp plasmid is used as a template, pdapB-1/pEC-3, pdapB-2/pEC-3 and PdapB-3/pEC-3 are used as primers, and 3 fragments comprising 3 types of modified regions are amplified respectively. The plasmid skeleton is amplified by taking pEC-XK99E-rfp-2 plasmid as a template and pEC-4/5 as a primer. The 3 fragments comprising the modified regions are respectively cloned and connected with the plasmid skeleton fragment through a one-step recombination kit of nunoprazan to respectively obtain pEC-XK99E-P dapB-1 -rfp、pEC-XK99E-P dapB-2 Rfp and pEC-XK99E-P dapB-3 Rfp characterizes the vector. Sequencing verification is carried out on the obtained plasmid, and pEC-XK99E-P is confirmed dapB-1 -rfp、pEC-XK99E-P dapB-2 Rfp and pEC-XK99E-P dapB-3 The promoter in the rfp-characterized vector has been successfully replaced with SEQ ID NO: 2. the amino acid sequence of SEQ ID NO: 3. and SEQ ID NO:4, or a promoter of the sequence shown in figure 4. The primer sequences used in this example are shown in Table 2.
TABLE 2
Figure BDA0003106779680000141
(2) Strength characterization of promoter mutants of dapB Gene
To characterize SEQ ID NO: 2. SEQ ID NO: 3. and SEQ ID NO:4 enhancing the expression intensity of pEC-XK99E-P dapB-1 -rfp、pEC-XK99E-P dapB-2 -rfp and pEC-XK99E-P dapB-3 Plasmid rfp and control plasmid pEC-XK99E-P dapB Transformation of rfp into Corynebacterium glutamicum ATCC13032 to obtain ATCC13032 (pEC-XK 99E-P) dapB-1 -rfp)、ATCC13032(pEC-XK99E-P dapB-2 -rfp)、ATCC13032(pEC-XK99E-P dapB-3 Rfp) and ATCC13032 (pEC-XK 99E-P dapB -rfp) strain. The fluorescence intensity was measured for each of the above strains and the control strain.
The components of the liquid culture medium of the TSB culture medium are measured as follows (g/L): glucose, 5g/L; 5g/L of yeast powder; soy peptone, 9g/L; 3g/L of urea; succinic acid, 0.5g/L; k 2 HPO 4 ·3H 2 O，1g/L；MgSO 4 ·7H 2 O,0.1g/L; biotin, 0.01mg/L; vitamin B1,0.1mg/L; MOPS,20g/L. Kanamycin (25. Mu.g/mL) was added to the medium. The plate activated strains are respectively inoculated into a 96-well plate containing 200 mu L of TSB liquid culture medium in each well by toothpicks, 3 strains are parallel, the rotation speed of a well plate shaker is 800rpm, after 24h of culture at 30 ℃, the fluorescence intensity of the strains is detected by an enzyme-labeling instrument. The fluorescence measurement excitation wavelength is 560nm, and the emission wavelength is 607nm; simultaneous determination of OD of bacterial liquid 600 And calculating the fluorescence intensity of the strain. The results are shown in Table 3, ATCC13032 (pEC-XK 99E-P) dapB-1 -rfp)、ATCC13032(pEC-XK99E-P dapB-2 Rfp) and ATCC13032 (pEC-XK 99E-P dapB-3 -rfp) of the strain is increased by 3.7 times, 3.8 times, 11.2 times as compared with the control, respectively, indicating that modification of the core region of the promoter can further enhance the activity of the dapB gene promoter, and can be used to enhance the expression of dapB gene.
TABLE 3
Figure BDA0003106779680000151
Example 3 application of Corynebacterium glutamicum dapB Gene promoter mutant to L-lysine production
(1) Strain construction of application of dapB gene promoter mutant to L-lysine production
The disclosure firstly introduces a T311I point mutation into an aspartokinase gene lysC of a Corynebacterium glutamicum ATCC13032 strain, and the codon is mutated from ACC to ATC to obtain an SCgL30 strain. The present disclosure further employed a dapB gene promoter mutant to overexpress phosphoenolpyruvate carboxylase (PPC, NCBI-GeneID:1019553, NCBI-ProteinID: NP-600799), which was tested for its effect on L-lysine production.
P is adopted on the basis of pEC-XK99E plasmid skeleton dapB The-3 promoter mutant overexpresses ppc gene, and the construction process of the overexpression plasmid is as follows: using the plasmid corresponding to the promoter mutant selected in example 2 as a template, amplifying the fragments of the promoter mutant with dapB-P1/dapB-P2 primers of the corresponding gene, respectively; amplifying a ppc gene fragment by using the genome of Corynebacterium glutamicum ATCC13032 as a template and ppc-1/ppc-2 as primers; plasmid backbone was amplified using pEC-XK99E plasmid as template and PEC-1/2 primer. The promoter mutant fragment, the ppc gene fragment and the plasmid skeleton fragment obtained above are cloned and connected by a one-step recombination kit of nunoprazan to obtain pEC-P dapB-3 -ppc plasmid. Respectively transforming pEC-XK99E control plasmid and the above plasmids into SCgL30 strain to obtain control strain and mutant promoter overexpression strains SCgL30 (pEC-XK 99E) and SCgL30 (pEC-P) dapB-3 -ppc). The primer sequences used above are shown in Table 4.
TABLE 4
Figure BDA0003106779680000152
(2) Evaluation of L-lysine-producing ability of promoter mutant overexpression Strain
For testing the use of P in Corynebacterium glutamicum dapB 3 Effect of the ppc Gene overexpression of the promoter mutant on L-lysine production by the Strain on SCgL30 (pEC-XK 99E) and SCgL30 (pEC-P), respectively dapB-3 Ppc) fermentation tests were carried out. The fermentation medium comprises the following components: glucose, 80g/L; 1g/L of yeast powder; soybean peptone, 1g/L; naCl,1g/L; ammonium sulfate, 1g/L; 10g/L of urea; k 2 HPO 4 ·3H 2 O，1g/L；MgSO 4 ·7H 2 O，0.45g/L；FeSO 4 ·7H 2 O,0.05g/L; biotin, 0.4mg/L; vitamin B1,0.1mg/L; MOPS,40g/L; initial pH7.2. The medium was supplemented with 25. Mu.g/mL kanamycin. Firstly, inoculating strains into a TSB liquid culture medium for culturing for 8 hours, inoculating the culture as seeds into a 24-pore plate containing 800 mul of fermentation culture medium in each pore, wherein the inoculation amount is 12 mul, culturing is carried out for 18 hours at 30 ℃, the rotating speed of a pore plate shaker is 800rpm,3 strains are parallel, detecting the yield of L-lysine by adopting an SBA biosensing analyzer after the fermentation is finished, and determining OD (OD) by adopting an enzyme labeling instrument 600 . The results are shown in Table 5, P dapB The L-lysine yield of the-3 promoter mutant overexpression strain is improved by 30 percent. The above results indicate that the promoter mutant of the present disclosure can be used to enhance the expression of PPC gene and applied to L-lysine production.
TABLE 5
Strain of bacillus OD 600 L-lysine yield (g/L)
SCgL30(pEC-XK99E) 17.7±1.2 4.50±0.0
SCgL30(pEC-P dapB-3 -ppc) 17.2±1.7 5.83±0.3
The above results illustrate that: the promoter mutant of dapB gene of the present disclosure can be used for enhancing the expression of PPC in Corynebacterium glutamicum, and thus enhancing the synthesis of oxaloacetate from phosphoenolpyruvate (PEP), and can be applied to the production of target products depending on the supply of oxaloacetate precursors, including the biological production of amino acids of the aspartate family (lysine, threonine, isoleucine, methionine), the glutamate family (glutamate, proline, hydroxyproline, arginine, glutamine), and 5-aminolevulinic acid, which are important metabolic precursors of oxaloacetate.
Can be used for improving the yield of target compounds such as 5-aminolevulinic acid and the like due to the enhancement of the expression and activity of PPC [1] However, the dapB gene promoter mutants of the present disclosure can be used to enhance the expression and activity of PPC, and thus, the promoter mutants of the present disclosure can also be used for 5-aminolevulinic acid production.
The disclosed promoter mutant has been confirmed to express fusion protein between the N-terminus of dapB and RFP, and can be used to improve the expression of PPC, and the disclosed promoter mutant of dapB gene can also be used to express other genes, and can be applied to the production of various products.
The cited documents are:
[1]CN103981203A
[2] wangyingchun, etc. based on time sequence transcriptome to screen endogenous high-efficiency constitutive promoter [ J ] of corynebacterium glutamicum, 2018, 34 (11): 1760-1771.
All technical features disclosed in the present specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.
Furthermore, from the foregoing description, one skilled in the art can readily appreciate from the disclosure that the key features of the disclosure are susceptible to numerous modifications without departing from the spirit and scope of the disclosure to adapt it to various usages and conditions, and such modifications are therefore intended to fall within the scope of the appended claims.
Sequence listing
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> dapB Gene-based Polynucleotide having promoter Activity and use thereof
<130> 6A17-2143181I
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 143
<212> DNA
<213> Corynebacterium glutamicum
<400> 1
gaacggaaca aactgatgaa caatcgttaa caacacagac caaaacggtc agttaggtat 60
ggatatcagc accttctgaa cgggtacgtc tagactggtg ggcgtttgaa aaactcttcg 120
ccccacgaaa atgaaggagc ata 143
<210> 2
<211> 143
<212> DNA
<213> Artificial Sequence
<220>
<223> promoter mutant sequence
<400> 2
gaacggaaca aactgatgaa caatcgttaa caacacagac caaaacggtc agttaggtat 60
ggatatcagc acctctctga tgtgatagta taatttggtg ggcgtttgaa aaactcttcg 120
ccccacgaaa atgaaggagc ata 143
<210> 3
<211> 143
<212> DNA
<213> Artificial Sequence
<220>
<223> promoter mutant sequence
<400> 3
gaacggaaca aactgatgaa caatcgttaa caacacagac caaaacggtc agttaggtat 60
ggatatcagc acctatcatt tggtgtatac taaattggtg ggcgtttgaa aaactcttcg 120
ccccacgaaa atgaaggagc ata 143
<210> 4
<211> 143
<212> DNA
<213> Artificial Sequence
<220>
<223> promoter mutant sequence
<400> 4
gaacggaaca aactgatgaa caatcgttaa caacacagac caaaacggtc agttaggtat 60
ggatatcagc acctgtcctg tggtaaactt tagcgtggtg ggcgtttgaa aaactcttcg 120
ccccacgaaa atgaaggagc ata 143
<210> 5
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 5
cctgatgcgg tattttctcc gaacggaaca aactgatgaa caatc 45
<210> 6
<211> 44
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 6
ccacctccag agccaccgcc cacagcgtta ggagtggtga agtc 44
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 7
ctgcaggcat gcaagcttgg 20
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 8
ggagaaaata ccgcatcagg c 21
<210> 9
<211> 64
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 9
ggcggtggct ctggaggtgg tgggtccggc ggtggctctg cttcctccga agacgttatc 60
aaag 64
<210> 10
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 10
ccaagcttgc atgcctgcag ttaagcaccg gtggagtgac gac 43
<210> 11
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 11
aggtatggat atcagcacct ctctgatgtg atagtataat ttggtgggcg tttgaaaaac 60
tcttc 65
<210> 12
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 12
aggtatggat atcagcacct atcatttggt gtatactaaa ttggtgggcg tttgaaaaac 60
tcttc 65
<210> 13
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 13
aggtatggat atcagcacct gtcctgtggt aaactttagc gtggtgggcg tttgaaaaac 60
tcttc 65
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 14
aaccttccat acgaactttg aaacg 25
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 15
caaagttcgt atggaaggtt ccg 23
<210> 16
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 16
aggtgctgat atccatacct aactgac 27
<210> 17
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 17
cctgatgcgg tattttctcc gaacggaaca aactgatgaa caatc 45
<210> 18
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 18
tcgcgtaaaa aatcagtcat tatgctcctt cattttcgtg ggg 43
<210> 19
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 19
atgactgatt ttttacgcga tgac 24
<210> 20
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> primer sequences
<400> 20
ccaagcttgc atgcctgcag ctagccggag ttgcgcagc 39

Claims (27)

1. A polynucleotide having promoter activity, wherein the nucleotide sequence of the polynucleotide is selected from the group consisting of SEQ ID NO: 2-4.
2. A transcription expression cassette comprising the polynucleotide having promoter activity according to claim 1.
3. The transcriptional expression cassette of claim 2, further comprising a gene of interest operably linked to the polynucleotide having promoter activity.
4. The transcriptional expression cassette of claim 3, wherein said gene of interest is a protein-encoding gene.
5. A recombinant expression vector comprising the polynucleotide having promoter activity of claim 1, or the transcription expression cassette of any one of claims 2 to 4.
6. A recombinant host cell comprising the transcription expression cassette of any one of claims 2-4, or the recombinant expression vector of claim 5.
7. The recombinant host cell according to claim 6, wherein said host cell is derived from Corynebacterium, brevibacterium, arthrobacter, microbacterium, or Escherichia.
8. The recombinant host cell according to claim 7, wherein said host cell is Corynebacterium glutamicum or Escherichia coli.
9. The recombinant host cell according to claim 7 or 8, wherein the host cell is Corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, corynebacterium glutamicum ATCC 14067 or a strain derived from Corynebacterium glutamicum.
10. A polynucleotide having promoter activity according to claim 1, a transcription cassette according to any one of claims 2-4, a recombinant expression vector according to claim 5, the use of a recombinant host cell according to any one of claims 6-9 in at least one of:
(a) Enhancing the transcription level of a gene, or preparing a reagent or a kit for enhancing the transcription level of a gene;
(b) Preparing a protein, or preparing a reagent or kit for preparing a protein;
(c) Producing a compound of interest, or preparing a reagent or kit for producing a compound of interest.
11. The use according to claim 10, wherein the protein is selected from a gene expression regulatory protein, a protein associated with synthesis of a compound of interest, or a protein associated with membrane transport.
12. The use according to claim 10 or 11, wherein the target compound comprises at least one of an amino acid, an organic acid.
13. The use of claim 12, wherein the amino acid comprises one or a combination of two or more of: proline, hydroxyproline, lysine, glutamic acid, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or a derivative of any of the above amino acids.
14. The use according to claim 12, wherein the organic acid comprises one or a combination of two or more of: citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, pentanoic acid, malic acid or derivatives of any of the above organic acids.
15. A method for regulating transcription, wherein the method comprises the step of operably linking the polynucleotide having promoter activity according to claim 1 to a target RNA or a target gene.
16. The method of claim 15, wherein the target RNA comprises at least one of tRNA, sRNA, and the target gene comprises at least one of a gene encoding a protein involved in synthesis of a target compound, a gene encoding a gene expression control protein, and a gene encoding a protein involved in membrane transport.
17. The method of claim 15 or 16, wherein the target gene comprises at least one of: pyruvate carboxylase gene, phosphoenolpyruvate carboxylase gene, γ -glutamyl kinase gene, glutamate semialdehyde dehydrogenase gene, pyrroline-5-carboxylate reductase gene, amino acid transporter gene, ptsG system-related gene, pyruvate dehydrogenase gene, homoserine dehydrogenase gene, oxaloacetate decarboxylase gene, glucorepressor gene, glucose dehydrogenase gene, aspartokinase gene, aspartate semialdehyde dehydrogenase gene, aspartate ammonia lyase gene, dihydrodipicolinate synthase gene, dihydropicolinate reductase gene, succinyldiaminopimelate aminotransferase gene, tetrahydropyridinedicarboxylate succinylase gene, succinyldiaminopimelate deacylase gene, diaminopimelate epimerase gene, diaminopimelate deacylase gene, glyceraldehyde-3-phosphate dehydrogenase gene, transketolase gene, diaminopimelate dehydrogenase gene.
18. A method for producing a protein, wherein the method comprises the step of expressing the protein using the transcription expression cassette of any one of claims 2 to 4, the recombinant expression vector of claim 5, or the recombinant host cell of any one of claims 6 to 9.
19. The method according to claim 18, wherein the protein is a protein involved in synthesis of a target compound, a protein involved in membrane transport, or a gene expression regulatory protein.
20. The method of claim 18 or 19, wherein the method further comprises the step of isolating or purifying the protein.
21. A method for producing a target compound, wherein the method comprises the step of expressing a protein involved in synthesis of the target compound, a protein involved in membrane transport or a gene expression regulatory protein using the transcription expression cassette according to any one of claims 2 to 4, the recombinant expression vector according to claim 5 or the recombinant host cell according to any one of claims 6 to 9, and producing the target compound in the presence of the protein involved in synthesis of the target compound, the protein involved in membrane transport or the gene expression regulatory protein.
22. The method of claim 21, wherein the target compound comprises at least one of an amino acid, an organic acid.
23. The method of claim 22, wherein the amino acid comprises one or a combination of two or more of: lysine, glutamic acid, threonine, proline, hydroxyproline, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or a derivative of any of the above amino acids.
24. The method of claim 22, wherein the organic acid comprises one or a combination of two or more of: citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, pentanoic acid, malic acid or derivatives of any of the above organic acids.
25. The method according to any one of claims 21 to 24, wherein the protein involved in the synthesis of the target compound is a protein involved in the synthesis of an L-amino acid.
26. The method of claim 25, wherein the protein involved in L-amino acid synthesis comprises one or a combination of two or more of pyruvate carboxylase, phosphoenolpyruvate carboxylase, γ -glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydrodipicolinate reductase, dihydropicolinate reductase, succinyldiaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyldiaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, transketolase, diaminopimelate dehydrogenase.
27. The method of any one of claims 21-24, wherein the method further comprises the step of isolating or purifying the target compound.
CN202110638508.4A 2021-06-08 2021-06-08 Polynucleotide having promoter activity based on dapB gene and use thereof Active CN115449519B (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202110638508.4A CN115449519B (en) 2021-06-08 2021-06-08 Polynucleotide having promoter activity based on dapB gene and use thereof
PCT/CN2022/094734 WO2022257757A1 (en) 2021-06-08 2022-05-24 Dapb gene-based polynucleotide having promoter activity and use thereof
ES202390215A ES2958335A2 (en) 2021-06-08 2022-05-24 Polynucleotide based on the dapB gene that has promoter activity and use thereof
BR112023024799A BR112023024799A2 (en) 2021-06-08 2022-05-24 POLYNUCLEOTIDE WITH PROMOTER ACTIVITY, TRANSCRIPTION EXPRESSION CASSETTE, RECOMBINANT EXPRESSION VECTOR, RECOMBINANT HOST CELL, USE OF POLYNUCLEOTIDE WITH PROMOTER ACTIVITY, METHOD OF CONSTRUCTING A MUTANT PROMOTER, METHOD FOR REGULATING TRANSCRIPTION, METHOD FOR PREPARING A PROTEIN AND TO PRODUCE A TARGET COMPOUND

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110638508.4A CN115449519B (en) 2021-06-08 2021-06-08 Polynucleotide having promoter activity based on dapB gene and use thereof

Publications (2)

Publication Number Publication Date
CN115449519A CN115449519A (en) 2022-12-09
CN115449519B true CN115449519B (en) 2023-04-07

Family

ID=84294633

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110638508.4A Active CN115449519B (en) 2021-06-08 2021-06-08 Polynucleotide having promoter activity based on dapB gene and use thereof

Country Status (4)

Country Link
CN (1) CN115449519B (en)
BR (1) BR112023024799A2 (en)
ES (1) ES2958335A2 (en)
WO (1) WO2022257757A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1847389A (en) * 1999-07-07 2006-10-18 德古萨股份公司 L-lysine producing coryneform bacteria and methods for the production of L-lysine
CN103981203A (en) * 2013-02-07 2014-08-13 中国科学院天津工业生物技术研究所 5-amino levulinic acid (ALA) high-yield strain and preparation method and application thereof
CN111850010A (en) * 2020-06-08 2020-10-30 黑龙江伊品生物科技有限公司 dapB gene modified recombinant strain and construction method and application thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101226384B1 (en) * 2010-03-05 2013-01-25 씨제이제일제당 (주) Enhanced promoter and method for producing L-lysine using the same
CA3007635A1 (en) * 2015-12-07 2017-06-15 Zymergen Inc. Promoters from corynebacterium glutamicum
CN109750069A (en) * 2017-11-01 2019-05-14 北京中科伊品生物科技有限公司 Produce the recombinant bacterium of L-lysine, the production method of its construction method and L-lysine
CN110846312B (en) * 2019-09-29 2020-11-10 黑龙江伊品生物科技有限公司 Promoter nucleic acid sequence of sdaA gene, recombinant strain containing nucleic acid sequence and application of recombinant strain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1847389A (en) * 1999-07-07 2006-10-18 德古萨股份公司 L-lysine producing coryneform bacteria and methods for the production of L-lysine
CN103981203A (en) * 2013-02-07 2014-08-13 中国科学院天津工业生物技术研究所 5-amino levulinic acid (ALA) high-yield strain and preparation method and application thereof
CN111850010A (en) * 2020-06-08 2020-10-30 黑龙江伊品生物科技有限公司 dapB gene modified recombinant strain and construction method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
王迎春等.基于时间序列转录组筛选谷氨酸棒杆菌内源高效组成型启动子.《生物工程学报》.2018,第34卷(第11期),第1760-1771页. *

Also Published As

Publication number Publication date
WO2022257757A1 (en) 2022-12-15
ES2958335A2 (en) 2024-02-07
BR112023024799A2 (en) 2024-02-15
CN115449519A (en) 2022-12-09

Similar Documents

Publication Publication Date Title
WO2022199460A1 (en) Aspartate kinase gene expression regulatory sequence and use thereof
WO2022017221A1 (en) Mutant of glutamate dehydrogenase gene promoter and application thereof
WO2022037338A1 (en) Polynucleotide having promoter activity and application of polynucleotide in producing amino acid
CN111411092B (en) Corynebacterium glutamicum for high yield of L-lysine and application thereof
WO2011129293A1 (en) Method for producing 1,5-pentanediamine
WO2022017223A1 (en) Mutant of pyruvate carboxylase gene promoter and use thereof
CN113278620B (en) Mutant hypertonic inducible promoter Pprox and application thereof
CN115449519B (en) Polynucleotide having promoter activity based on dapB gene and use thereof
CN115449518B (en) Polynucleotide with promoter activity based on mdh gene and application thereof
CN113201539B (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN113201538A (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN115506035B (en) Construction method of promoter mutant library and promoter mutant library
RU2812048C1 (en) Pyruvate carboxylase gene promoter mutant and its application
RU2812048C9 (en) Pyruvate carboxylase gene promoter mutant and its application
JP2022547466A (en) Novel promoter and target substance production method using the same
EP4293115A1 (en) Polynucleotide having promoter activity and use thereof in production of traget compounds
CN115490761B (en) Recombinant microorganism constructed based on lysine efflux protein and method for producing lysine
CN114478724B (en) ramB mutant and method for constructing lysine production strain by using same
CN115322990A (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN115322989A (en) Polynucleotide having promoter activity, use thereof, and method for producing target compound
CN116334112A (en) Construction method and application of amino acid production strain
CN116891868A (en) Osmotic pressure tolerance functional gene identification method and application of functional gene
EP4375369A1 (en) Novel acetohydroxy acid synthase subunit variant and method for producing l-valine using same
CN115948396A (en) Glutamate dehydrogenase promoter mutant and application thereof
CN115746111A (en) Mutant of transcription regulatory factor LysG and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant