CN115322990A - Polynucleotides having promoter activity and use thereof for producing target compounds - Google Patents

Polynucleotides having promoter activity and use thereof for producing target compounds Download PDF

Info

Publication number
CN115322990A
CN115322990A CN202110505665.8A CN202110505665A CN115322990A CN 115322990 A CN115322990 A CN 115322990A CN 202110505665 A CN202110505665 A CN 202110505665A CN 115322990 A CN115322990 A CN 115322990A
Authority
CN
China
Prior art keywords
acid
seq
polynucleotide
sequence
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110505665.8A
Other languages
Chinese (zh)
Inventor
孙际宾
陈久洲
黄婧文
郑平
周文娟
刘娇
马延和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN202110505665.8A priority Critical patent/CN115322990A/en
Publication of CN115322990A publication Critical patent/CN115322990A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present disclosure belongs to the field of biotechnology and genetic engineering technology, and in particular relates to a polynucleotide having promoter activity, a transcription expression cassette comprising the polynucleotide having promoter activity, a recombinant expression vector, a recombinant host cell, a method for regulating transcription of a target gene, a method for preparing a protein, and a method for producing a target compound. The polynucleotide having promoter activity provided by the present disclosure is a polynucleotide comprising a sequence as set forth in SEQ ID NO:2-4, the mutant has significantly improved promoter activity compared to the wild-type promoter. The mutant is applied to the production of target compounds, the conversion rate of the target compounds can be obviously improved, and a strong constitutive promoter with great application potential is provided for industrial fermentation of the target compounds such as amino acid, organic acid and the like.

Description

Polynucleotides having promoter activity and use thereof for producing target compounds
Technical Field
The present disclosure belongs to the field of biotechnology and genetic engineering technology, and specifically relates to a polynucleotide having promoter activity, a transcription expression cassette comprising the polynucleotide having promoter activity, a recombinant expression vector, a recombinant host cell, a method for regulating transcription of a target gene, a method for preparing a protein, and a method for producing a target compound.
Background
The microbial fermentation method can produce various target compounds, such as amino acid, organic acid, bio-based material, pharmaceutical compound and the like, and the target compounds can be widely applied to the fields of medicine, health, food, animal feed, cosmetics and the like and have great economic value. In recent years, with increasing market demands for amino acids, organic acids, biobased materials, raw materials, drugs, and the like, how to increase the yield of a target compound and realize industrial mass production of the target compound is an important problem which needs to be solved at present.
The breeding of high-yield fermentation microorganisms is an important means for improving the industrial yield of target compounds, and compared with the traditional mutation breeding technology, the genetic engineering breeding technology has the advantages of strong pertinence, high stability, high efficiency and the like. The key genes in the microbial metabolic pathway are modified by a genetic engineering method, and the method is an important method for improving the fermentation yield of a target compound. Factors affecting gene expression include promoter activity, gene translation efficiency, gene copy number, and the like. However, increasing the copy number of a gene decreases the stability of the genome of a strain, and increasing the expression efficiency of a gene by increasing the promoter activity is an important means for modifying a key gene.
The identification of strong promoters or constitutive promoters can provide efficient gene expression elements for the genetic engineering breeding of fermentation microorganisms. Wherein, the strong promoter has higher affinity to the transcriptases and can efficiently start the transcription of target genes. The constitutive promoter is that the target protein can be expressed continuously without any inducer. The strong promoter or the constitutive promoter is used for modifying key genes in a metabolic pathway, so that the expression level of the key genes can be effectively increased, and the metabolic flux is increased.
Therefore, the development of a strong promoter or a constitutive promoter with high activity to enhance the expression of a key gene in a target compound synthesis pathway, improve the yield of a target compound and improve the potential of industrial application is an important problem to be solved in the field of microbial fermentation.
Disclosure of Invention
Problems to be solved by the invention
In view of the technical problems in the prior art, for example, it is necessary to develop more strong or constitutive promoters with high activity to increase the expression of key genes in the synthetic pathway of a target compound. To this end, the present disclosure provides a polynucleotide having promoter activity comprising a sequence as set forth in SEQ ID NO:2-4, compared with a wild promoter, the promoter activity of the mutant provided by the disclosure is obviously improved, and the mutant is not induced by an inducer any more, and is a novel strong constitutive promoter. The mutant is operably connected with the target gene, so that the expression of the target gene can be effectively improved, and the yield of the target compound can be effectively improved under the condition of keeping the stability of the genome.
Means for solving the problems
The present disclosure provides a polynucleotide having promoter activity, wherein the polynucleotide is selected from any one of the following groups (i) to (vi):
(i) Comprises a nucleotide sequence as set forth in SEQ ID NO:2, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:2 at one or more of positions 204-211 of the sequence set forth in seq id No. 2; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:2, and the mutant has a promoter activity in the polynucleotide of the sequence shown in SEQ ID NO:2 is not CCACAATG at positions 204-211 of the sequence set forth in seq id no;
(ii) Comprises the amino acid sequence shown as SEQ ID NO:3, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:3 at one or more of positions 164-171 of the sequence set forth in seq id no; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:3, and the mutant has a promoter activity in the polynucleotide of the sequence shown in SEQ ID NO:3 the nucleotide sequence in positions 164-171 of the sequence shown in is not CCACAATG;
(iii) Comprises the amino acid sequence shown as SEQ ID NO:4, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:4 at one or more of positions 106-113 of the sequence set forth in seq id No. 4; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:4, and the mutant has a promoter activity in the polynucleotide of the sequence shown in SEQ ID NO:4 is not CCACAATG at positions 106-113;
(iv) (iv) a polynucleotide comprising a reverse complement of the nucleotide sequence set forth in any one of (i) to (iii);
(v) (iv) a polynucleotide comprising a sequence that is the reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (i) to (iii) under high stringency hybridization conditions or very high stringency hybridization conditions;
(vi) (iv) a polynucleotide comprising a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence set forth in any one of (i) to (iii).
In some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the mutant has a mutation in a sequence comprising the amino acid sequence as set forth in SEQ ID NO:2-4 has a promoter activity 5-13 times or more higher than that of the polynucleotide having the sequence shown in FIGS.
In some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the mutant corresponds to SEQ ID NO:2, or a sequence corresponding to SEQ ID NO:3, or a sequence corresponding to SEQ ID NO:4 is selected from the group consisting of (p) 1 )-(p 18 ) Any one of the group consisting of:
(p 1 )ACTGTAGG，
(p 2 )TATTATGG，
(p 3 )AATTGGGG，
(p 4 )TATGGTTG，
(p 5 )TAGGGTAG，
(p 6 )AATGGAAT，
(p 7 )TAGACTTC，
(p 8 )AATGGGTA，
(p 9 )TACCATTA，
(p 10 )ACTGAGGG，
(p 11 )ACTAGAAG，
(p 12 )AATTAGTG，
(p 13 )AATAGGGT，
(p 14 )TAGTATTG，
(p 15 )ACTGGACT，
(p 16 )TAACATGG，
(p 17 )ACTAGGGG，
(p 18 )TATAAGTT。
in some embodiments, the polynucleotide having promoter activity according to the present disclosure, wherein the nucleotide sequence of the mutant is selected from the group consisting of SEQ ID NO: 5-22.
The present disclosure provides a transcriptional expression cassette, wherein the transcriptional expression cassette comprises a polynucleotide having promoter activity according to the present disclosure; optionally, the transcription expression cassette further comprises a gene of interest operably linked to the polynucleotide having promoter activity; preferably, the target gene is a protein-encoding gene.
The present disclosure provides a recombinant expression vector, wherein the recombinant expression vector comprises a polynucleotide having promoter activity according to the present disclosure, or a transcriptional expression cassette according to the present disclosure.
The present disclosure provides a recombinant host cell, wherein the recombinant host cell comprises a transcriptional expression cassette according to the present disclosure, or a recombinant expression vector according to the present disclosure.
In some embodiments, the recombinant host cell according to the present disclosure, wherein the host cell is derived from corynebacterium, brevibacterium, arthrobacter, microbacterium, or escherichia; preferably, the host cell is corynebacterium glutamicum or escherichia coli; more preferably, the host cell is Corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, or Corynebacterium glutamicum ATCC 14067.
The present disclosure provides a polynucleotide having promoter activity according to the present disclosure, a transcription expression cassette according to the present disclosure, a recombinant expression vector according to the present disclosure, use of a recombinant host cell according to the present disclosure in at least one of:
(a) Regulating the transcription level of a gene, or preparing a reagent or a kit for regulating the transcription level of a gene;
(b) Preparing a protein, or preparing a reagent or kit for preparing a protein;
(c) Producing a compound of interest, or preparing a reagent or kit for producing a compound of interest.
In some embodiments, the use according to the present disclosure, wherein the protein is selected from a gene expression regulatory protein or a protein involved in the synthesis of a target compound.
In some embodiments, the use according to the present disclosure, wherein the target compound comprises at least one of an amino acid, an organic acid; optionally, the amino acid comprises at least one of proline, lysine, glutamic acid, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, and the organic acid comprises at least one of citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, valeric acid, malic acid.
The present disclosure provides a method of regulating transcription of a target gene, wherein the method comprises the step of operably linking a polynucleotide having promoter activity according to the present disclosure to the target gene.
The present disclosure provides a method of producing a protein, wherein the method comprises the step of expressing the protein using a transcription expression cassette according to the present disclosure, a recombinant expression vector according to the present disclosure, or a recombinant host cell according to the present disclosure; optionally, the protein is a protein associated with synthesis of a target compound or a gene expression regulatory protein;
optionally, the method further comprises the step of isolating or purifying the protein.
The present disclosure provides a method for producing a target compound, wherein the method comprises a step of expressing a protein involved in synthesis of the target compound or a gene expression regulatory protein using the transcription expression cassette according to the present disclosure, the recombinant expression vector according to the present disclosure, or the recombinant host cell according to the present disclosure, and producing the target compound in the presence of the protein involved in synthesis of the target compound or the gene expression regulatory protein;
optionally, the target compound comprises at least one of an amino acid, an organic acid; optionally, the amino acid comprises at least one of lysine, glutamic acid, threonine, proline, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, and the organic acid comprises at least one of citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, valeric acid, malic acid;
optionally, the protein involved in the synthesis of the target compound is a protein involved in the synthesis of an L-amino acid; optionally, the protein involved in L-amino acid synthesis comprises one or a combination of two or more of pyruvate carboxylase, phosphoenolpyruvate carboxylase, γ -glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydropicolinate reductase, succinyldiaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyldiaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, transketolase, diaminopimelate dehydrogenase, and carboxylase;
optionally, the method further comprises the step of isolating or purifying the target compound.
ADVANTAGEOUS EFFECTS OF INVENTION
In some embodiments, the polynucleotide having promoter activity provided by the present disclosure is a polynucleotide comprising a sequence as set forth in SEQ ID NO:2-4, and a polynucleotide comprising a sequence as set forth in any one of SEQ ID NOs: 2-4, the activity of the mutant promoter is obviously improved. After the mutant is operably connected with the target gene, the expression efficiency of the target gene can be obviously improved, the stable and efficient expression of the target gene can be realized without any induction condition, and an expression element with high application potential is provided for the transformation of key genes in the synthesis path of a target compound. The mutant is applied to the production of target compounds, can obviously improve the conversion rate of the target compounds, and provides a strong constitutive promoter with great application potential for the industrial fermentation of the target compounds such as amino acid, organic acid and the like.
In some embodiments, the disclosure provides polynucleotides having promoter activity with 5-13 fold or more increased promoter activity compared to the wild-type promoter, and the promoter activity of the mutants in the disclosure is higher than the promoter activity of the endogenous strong promoter tuf of c.
In some more specific embodiments, the present disclosure provides polynucleotides having promoter activity that has 5.89-12.61 fold increased promoter activity as compared to a wild-type promoter.
In some embodiments, the present disclosure provides transcriptional expression cassettes, recombinant expression vectors, recombinant host cells comprising the polynucleotides having promoter activity described above. In a transcription expression cassette, a recombinant expression vector and a recombinant host cell, the polynucleotide with promoter activity is operably connected with a target gene, and the high-efficiency expression of key genes in a target compound synthesis pathway can be realized.
In some embodiments, the present disclosure provides a method for preparing a protein, which can increase the expression amount of a protein or a gene expression regulatory protein involved in the synthesis of amino acids, organic acids, etc., thereby achieving efficient production of a target compound.
In some embodiments, the present disclosure provides a method for producing a target compound, which can improve the expression efficiency of a protein involved in the synthesis of the target compound using the polynucleotide having promoter activity, thereby stably and efficiently producing the target compound and realizing large-scale industrial production of the target compound.
Drawings
FIG. 1 shows the results of comparing the activities of NCgl1418 promoters of different lengths.
Detailed Description
The terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification can mean "one," but can also mean "one or more," at least one, "and" one or more than one.
As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.
Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.
When used in the claims or specification, the term "range of values" is selected/preferred to include both the end points of the range and all natural numbers subsumed within the middle of the end points of the range with respect to the aforementioned end points of values.
As used in this disclosure, the term "polynucleotide" refers to a polymer composed of nucleotides. Polynucleotides may be in the form of individual fragments, or may be a component of a larger nucleotide sequence structure, derived from nucleotide sequences that have been isolated at least once in quantity or concentration, and which are capable of being recognized, manipulated, and recovered in sequence, and their component nucleotide sequences, by standard molecular biology methods (e.g., using cloning vectors). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T". In other words, a "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (either individually or as a whole) or may be an integral part or component of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.
As used in this disclosure, the term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, can be isolated from a source in nature, and is not intentionally modified by man in the laboratory, is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonyms. In some embodiments, the wild-type promoter in the present disclosure refers to the promoter of the wild-type NCgl1418 gene, i.e. as shown in SEQ ID NO:2, or a polynucleotide having the sequence shown in figure 2.
As used in this disclosure, the term "mutant" refers to a polynucleotide that comprises alterations (i.e., substitutions, insertions, and/or deletions) at one or more (e.g., several) positions relative to a "wild-type", or "comparable" polynucleotide or polypeptide, wherein a substitution refers to the substitution of a nucleotide occupying one position with a different nucleotide.
In some embodiments, a "mutation" of the present disclosure is a "substitution", which is a mutation caused by the substitution of a base in one or more nucleotides with another, different base, also referred to as a base substitution mutation (mutation) or a point mutation (point mutation).
Specifically, SEQ ID NO:1 is the core region sequence of NCgl1418 gene promoter, including-35 region and-10 region main sequences. The mutant in the disclosure is nucleotide with mutation introduced at the position of-10 region, and the promoter activity of the mutant is obviously enhanced after the mutation is introduced at the position, so that a novel strong constitutive promoter is obtained, and the promoter activity is higher than that of endogenous strong promoter tuf of corynebacterium glutamicum.
In some embodiments, a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:2, refers to a polynucleotide comprising a sequence as set forth in SEQ ID NO:2, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:2, and does not comprise a nucleotide having a mutation at one or more of positions 204-211 of the sequence set forth in SEQ ID NO:2 to the nucleotide sequence of which the 204 th to the 211 th positions are mutated into CCACAATG. And a polypeptide comprising SEQ ID NO:2, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 2.
In some embodiments, a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:3, refers to a mutant of a polynucleotide comprising a sequence as set forth in SEQ ID NO:3, which mutant is represented by SEQ ID NO:3 and does not comprise a nucleotide having a mutation at one or more of positions 164-171 of the sequence set forth in SEQ ID NO:3, and the 164 th to 171 th mutation of the sequence is a polynucleotide of CCACAATG. And a polypeptide comprising SEQ ID NO:3, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 3.
In some embodiments, a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:4, refers to a mutant of a polynucleotide comprising a sequence as set forth in SEQ ID NO:4, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:4, and does not comprise a nucleotide having a mutation at one or more of positions 106-113 of the sequence set forth in SEQ ID NO:4, 106-113 th mutation of the sequence shown in 4 into CCACAATG. And a polypeptide comprising SEQ ID NO:4, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in seq id no.
In some embodiments, the nucleic acid sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence set forth in SEQ ID NO:2, has a promoter activity 5-13 times or more increased as compared with the polynucleotide having the sequence shown in 2.
Further, the mutant has a higher affinity for a polypeptide comprising SEQ ID NO:2, 8.31, 12.18, 8.93, 8.07, 7.63, 10.31, 5.89, 5.92, 6.49, 7.66, 8.63, 8.41, 10.21, 9.52, 9.91, 8.52, 12.61 and 9.16 times of the promoter activity.
As used in this disclosure, the term "promoter" refers to a nucleic acid molecule, typically located upstream of the coding sequence of a target gene, that provides a recognition site for RNA polymerase and is located upstream in the 5' direction of the mRNA transcription start site. It is an untranslated nucleic acid sequence to which RNA polymerase binds to initiate transcription of a target gene. In ribonucleic acid (RNA) synthesis, a promoter may interact with transcription factors that regulate gene transcription, controlling the initiation time and extent of gene expression (transcription), including the core promoter region and regulatory regions, like a "switch," which determines the activity of the gene and, in turn, which protein the cell begins to produce.
As used in this disclosure, the term "promoter core region" refers to a nucleic acid sequence located in a promoter region of a prokaryote, which is a core sequence region functioning as a promoter, mainly including a region between-35 region, -10 region, -35 region and-10 region, and a transcription initiation site, -35 region is a recognition site for RNA polymerase, and-10 region is a binding site for RNA polymerase. In some embodiments, the polynucleotide having promoter activity of the present disclosure is a mutant comprising a promoter core region of NCgl1418 gene, and introducing a mutation in-10 region of the promoter core region to obtain significantly increased promoter activity compared to the promoter of NCgl1418 gene.
As used in this disclosure, the terms "sequence identity" and "percent identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides containing the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides containing different nucleotide or amino acid residues. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or deleted nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). Polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.
In some embodiments, two or more sequences or subsequences have "sequence identity" or "percent identity" of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleotides when compared and aligned for maximum correspondence as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both of the biopolymers (e.g., polynucleotides) being compared.
As used in this disclosure, the term "complementary" refers to hybridization or base pairing between nucleotides, such as between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide being sequenced or amplified, and the like.
As used in this disclosure, the term "high stringency conditions" means prehybridization and hybridization at 42 ℃ in 5X SSPE (saline sodium phosphate EDTA), 0.3% sds, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide for 12 to 24 hours, following standard southern blotting procedures for probes of at least 100 nucleotides in length. Finally, the carrier material is washed three times, each for 15 minutes, at 65 ℃ using 2 XSSC, 0.2% SDS.
As used in this disclosure, the term "very high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 ℃ in 5X SSPE (saline sodium phosphate EDTA), 0.3% sds, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard southern blotting procedures for 12 to 24 hours. Finally, the carrier material is washed three times, each for 15 minutes, at 70 ℃ using 2 XSSC, 0.2% SDS.
In some specific embodiments, a polynucleotide having promoter activity in the present disclosure can be used to initiate expression of a protein-encoding gene. In some other embodiments, the polynucleotides of the present disclosure having promoter activity can be used to initiate expression of a non-coding gene.
As used in this disclosure, the term "expression" includes any step involving RNA production and protein production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
As used in this disclosure, the term "transcriptional expression cassette" is a recombinant expression element comprising a polynucleotide having promoter activity. In some embodiments, the polynucleotide having promoter activity is a polynucleotide comprising a sequence as set forth in SEQ ID NO:2 at nucleotide numbers 204-211. In some embodiments, the polynucleotide having promoter activity is a polynucleotide comprising a sequence as set forth in SEQ ID NO:3, from nucleotide 164 to nucleotide 171. In some embodiments, the polynucleotide having promoter activity is a polynucleotide comprising a sequence as set forth in SEQ ID NO:4 from nucleotide 106 to nucleotide 113. In some more specific embodiments, the transcription expression cassette includes a target gene operably linked to a mutant, and the mutant having increased promoter activity of the present disclosure is used to regulate the expression of the target gene. In some embodiments, the transcriptional regulatory element that regulates the target gene may include an enhancer, a silencer, an insulator, and the like, in addition to the mutant having promoter activity. In some embodiments, the target gene in the present disclosure is specifically a protein-encoding gene. "operably linked" with a polynucleotide having promoter activity means that the polynucleotide having promoter activity is functionally linked with the target gene to initiate and mediate transcription of the target gene in any manner described by one skilled in the art.
As used in this disclosure, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to suitable control sequences for the expression of a gene of interest in a suitable host. "recombinant expression vector" refers to a DNA construct used to express, for example, a polynucleotide encoding a desired polypeptide. Recombinant expression vectors can include, for example, a collection comprising i) genetic elements that have a regulatory effect on gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) transcriptional subunits of appropriate transcriptional and translational initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not critical and any vector may be used, including plasmids, viruses, phages and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40 and pseudorabies. In the present disclosure, "recombinant expression vector" and "recombinant vector" may be used interchangeably.
As used in this disclosure, the term "target gene" refers to any gene linked to a polynucleotide having promoter activity in this disclosure to regulate its transcription level.
In some embodiments, the target gene refers to a gene encoding a target protein in a microorganism. The target gene is exemplified by a gene encoding an enzyme involved in biosynthesis of a target compound, a gene encoding an enzyme involved in reducing power, a gene encoding an enzyme involved in glycolysis or TCA cycle, or a gene encoding an enzyme involved in release of a target compound, and the like.
As used in this disclosure, the term "target compound" may be selected from amino acids, organic acids, and also from other classes of compounds that are available in the art, possibly by biosynthesis.
In some embodiments, the compound of interest is an "amino acid" or an "L-amino acid". "amino acid" or "L-amino acid" generally refers to the basic building block of a protein in which an amino group and a carboxyl group are bound to the same carbon atom. Illustratively, the amino acid is selected from one or a combination of two or more of glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, or other types of amino acids known in the art.
In some embodiments, the target compound is an organic acid. The organic acid may be an organic compound having acidity, for example, those including a carboxyl group and a sulfonic acid group. Exemplary organic acids include one or a combination of two or more of lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, citric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, valeric acid, malic acid, or other types of organic acids known in the art.
The term "protein-encoding gene" in the present disclosure refers to a synthetic DNA molecule capable of directing protein synthesis by a certain rule, and the process of directing protein synthesis by a protein-encoding gene generally includes a transcription process using double-stranded DNA as a template and a translation process using mRNA as a template. The protein-encoding gene contains a CDS Sequence (Coding Sequence) that directs the production of mRNA encoding the protein.
Illustratively, protein-encoding genes include, but are not limited to, genes encoding proteins involved in the synthesis of the target compound, and in some embodiments, the protein-encoding genes are involved in encoding proteins involved in the synthesis of the L-amino acid. Exemplary, proteins involved in the synthesis of L-amino acids include, but are not limited to, pyruvate carboxylase, phosphoenolpyruvate carboxylase, gamma-glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, or combinations of two or more thereof. In some embodiments, the protein involved in the synthesis of L-amino acids is a protein involved in the synthesis of L-lysine, and for the protein involved in the synthesis of L-lysine, one or a combination of two or more of aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydropicolinate reductase, succinyldiaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyldiaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, lysine transporter, transketolase, diaminopimelate dehydrogenase, and pyruvate carboxylase is included.
In some embodiments, the protein-encoding gene is directed to encoding a protein associated with synthetic organic acids, illustratively, the protein-encoding gene is directed to encoding a protein associated with synthetic citric acid or is directed to encoding a protein associated with synthetic succinic acid. In some embodiments, the protein-encoding gene is involved in a protein involved in gene editing, such as a Cpf1 protein.
The term "gene expression regulatory protein" of the present disclosure includes, but is not limited to, exogenous gene expression regulatory tool proteins, such as dCas9 protein, dCpf1 protein, hfq protein, etc., required for CRISPRi regulation, and endogenous or exogenous transcriptional regulatory factors, which in turn regulate the expression of key genes in metabolic pathways.
The term "host cell" in the present disclosure means any cell type that is susceptible to transformation, transfection, transduction, and the like with a transcription initiation element or expression vector comprising a polynucleotide of the present disclosure. The term "recombinant host cell" encompasses host cells which differ from the parent cell after introduction of a transcription initiation element or a recombinant expression vector, the recombinant host cell being specifically achieved by transformation.
The term "transformation" in the present disclosure has the meaning commonly understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The method of transformation includes any method of introducing a nucleic acid into a cell, including, but not limited to, electroporation, calcium phosphate precipitation, calcium chloride (CaCl) 2 ) Precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposome, and lithium acetate-DMSO.
The host cell of the present disclosure may be a prokaryotic cell or a eukaryotic cell, as long as the polynucleotide having promoter activity of the present disclosure can be introduced into the cell. In some embodiments, the host cell refers to a prokaryotic cell, in particular, the host cell is derived from a microorganism suitable for the fermentative production of amino acids, organic acids, such as Corynebacterium, brevibacterium, arthrobacter, microbacterium or Escherichia. Preferably, the host cell is Corynebacterium glutamicum derived from the genus Corynebacterium. Wherein the Corynebacterium glutamicum can be Corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, corynebacterium glutamicum ATCC 14067 and the like.
The cultivation of the host cell of the present disclosure may be performed according to a conventional method in the art, including, but not limited to, a well plate culture, a shake flask culture, a batch culture, a continuous culture, a fed-batch culture, and the like, and various culture conditions such as temperature, time, pH of a medium, and the like may be appropriately adjusted according to actual circumstances.
Unless otherwise defined in the present disclosure or clearly indicated by the background, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Mutant comprising promoter core region of NCgl1418 gene
The present disclosure utilizes the promoter core region sequence of the NCgl1418 gene to introduce mutation in the promoter-10 region of the NCgl1418 gene to obtain mutant of the promoter core region of the NCgl1418 gene containing the-10 region mutation.
The polynucleotide having promoter activity of the present disclosure, by mutating the promoter core region of NCgl1418 gene, specifically introducing mutation in-10 region (CCACAATG) of the promoter core region of NCgl1418 gene, has significantly improved promoter activity compared to wild type promoter comprising promoter core region of NCgl1418 gene, is a novel strong constitutive promoter; when applied to the fermentation of the target compound, the mutant shows higher conversion rate of the target compound compared with the wild-type promoter.
In addition, by truncating the promoter with different lengths, NCgl1418 promoter fragments with 203bp (SEQ ID NO: 3) and 145bp (SEQ ID NO: 4) are respectively obtained, both the fragments have the core region of the NCgl1418 promoter, and can also show obviously enhanced promoter activity under the environment with increased salt concentration and osmotic pressure. Then, the promoter engineering method in the above example was used, i.e., the promoter of SEQ ID NO:3, or at one or more of positions 164-171 of the sequence shown in SEQ ID NO:4 at one or more of positions 106-113, a strong constitutive promoter mutant will be obtained.
In some embodiments, a mutant of the present disclosure refers to a mutant comprising an amino acid sequence as set forth in SEQ ID NO:2, refers to a polynucleotide comprising a sequence as set forth in SEQ ID NO:2, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:2 and does not comprise a nucleotide having a mutation at one or more of positions 204-211 of the sequence set forth in SEQ ID NO:2, and the 204 th-211 th position of the sequence is mutated into a polynucleotide of CCACAATG. And a polypeptide comprising SEQ ID NO:2, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 2.
In some embodiments, the mutant has a mutation in a nucleotide sequence corresponding to SEQ ID NO:2 at positions 1, 2, 3, 4, 5, 6, 7 or 8 of the sequence set forth in seq id No. 2.
In some embodiments, a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:3, refers to a mutant of a polynucleotide comprising a sequence as set forth in SEQ ID NO:3, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:3 and does not comprise a nucleotide having a mutation at one or more of positions 164-171 of the sequence set forth in SEQ ID NO:3, and the 164 th to 171 th mutation of the sequence is a polynucleotide of CCACAATG. And a polypeptide comprising SEQ ID NO:3, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 3.
In some embodiments, the mutant has a mutation in a nucleotide sequence corresponding to SEQ ID NO:3 at position 1, 2, 3, 4, 5, 6, 7 or 8 of the sequence shown in seq id No. 3.
In some embodiments, a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:4, refers to a polynucleotide comprising a sequence as set forth in SEQ ID NO:4, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:4 having a mutated nucleotide at one or more of positions 106-113 of the sequence set forth in SEQ ID NO:4 to 106-113 of the sequence shown in the sequence into ACACCGAGTG. And a polypeptide comprising SEQ ID NO:4, the mutant has increased promoter activity compared to the polynucleotide having the sequence shown in figure 4. In some embodiments, the mutant has a mutation in a nucleotide sequence corresponding to SEQ ID NO:4 at position 1, 2, 3, 4, 5, 6, 7 or 8 of the sequence indicated in position 106 to 113.
In some embodiments, the polynucleotides of the present disclosure having promoter activity further comprise a nucleotide sequence substantially identical to SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO:4 in the sequence direction of the mutant shown in the sequence table.
In some embodiments, the polynucleotides having promoter activity in the present disclosure further comprise a promoter that hybridizes under high stringency hybridization conditions or very high stringency hybridization conditions to SEQ ID NO: 2. SEQ ID NO: 3. SEQ ID NO:4 or a polynucleotide which is the reverse complement of the hybrid sequence. And said polynucleotide is represented in a sequence corresponding to SEQ ID NO:2 is not CCACAATG and is substituted at a position corresponding to SEQ ID NO:3 is not CCACAATG, and the nucleotide sequence in positions 164-171 of the sequence shown in SEQ ID NO:4 is not CCACAATG at positions 106-113.
In some embodiments, a polynucleotide having promoter activity in the present disclosure is a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity (including all ranges and percentages between these values) to a polynucleotide sequence described above. And said polynucleotide is encoded in a polynucleotide corresponding to SEQ ID NO:2 is not CCACAATG and is substituted at a position corresponding to SEQ ID NO:3 is not CCACAATG, and the nucleotide sequence in positions 164-171 of the sequence shown in SEQ ID NO:4 is not CCACAATG at positions 106-113.
In some embodiments, the mutant corresponds to SEQ ID NO:2, or a nucleotide sequence corresponding to positions 204-211 of the sequence set forth in SEQ ID NO:3, or a nucleotide sequence corresponding to positions 164-171 of the sequence set forth in SEQ ID NO:4 is selected from the group consisting of (p) a nucleotide sequence in positions 106 to 113 of the sequence shown in SEQ ID NO (4) 1 )-(p 18 ) Any one of the group consisting of: (p) 1 )ACTGTAGG，(p 2 )TATTATGG，(p 3 )AATTGGGG，(p 4 )TATGGTTG，(p 5 )TAGGGTAG，(p 6 )AATGGAAT，(p 7 )TAGACTTC，(p 8 )AATGGGTA，(p 9 )TACCATTA，(p 10 )ACTGAGGG，(p 11 )ACTAGAAG，(p 12 )AATTAGTG，(p 13 )AATAGGGT，(p 14 )TAGTATTG，(p 15 )ACTGGACT，(p 16 )TAACATGG，(p 17 )ACTAGGGG，(p 18 )TATAAGTT。
In some embodiments, the nucleotide sequence of the mutant is selected from the group consisting of SEQ ID NO: 5-22.
In some embodiments, the polynucleotide having promoter activity of the present disclosure is substantially identical to the polynucleotide of SEQ ID NO:2, has a promoter activity 5-13 times or more increased as compared with the polynucleotide having the sequence shown in 2. Further, a polypeptide comprising SEQ ID NO:2, has 8.31, 12.18, 8.93, 8.07, 7.63, 10.31, 5.89, 5.92, 6.49, 7.66, 8.63, 8.41, 10.21, 9.52, 9.91, 8.52, 12.61 and 9.16 times of increased promoter activity.
Recombinant expression vectors and recombinant host cells
In some embodiments, the disclosure uses ATCC13032 genome (Corynebacterium glutamicum ATCC13032, NC 003450.3)) as a template, 1418-F and 1418-R as primers, and amplifies to obtain a DNA fragment of NCgl1418 gene promoter; taking pXM-gfp plasmid as a template, and using pGFP-F and pGFP-R primers to amplify and remove a vector fragment of the lacI gene and the tac promoter; mixing the aboveThe fragments are recombined and connected to obtain a recombined expression vector pXM-P NCgl1418 -gfp。
In some embodiments, the disclosure provides a pXM-P NCgl1418 Gfp as template, with 1418mutant-F and 1418mutant-R primer pair pXM-P NCgl1418 -gfp carrying out reverse PCR amplification to obtain linearized plasmid fragments; and (3) phosphorylating and connecting the linearized plasmid fragments, and collecting resistant clones to obtain a promoter mutant library of the NCgl1418 gene.
In some embodiments, the disclosure relates to a library of promoter mutants of NCgl1418 gene and pXM-Con, pXM-P NCgl1418 And-gfp into Corynebacterium glutamicum ATCC13032, respectively, to obtain recombinant host cells. Screening of mutants with increased promoter strength was performed by screening the fluorescence intensity of recombinant host cells after plating.
In some specific embodiments, the present disclosure obtains the promoter sequence of NCgl1418 gene and the DNA sequence of lysE gene by PCR amplification using primers 1418-L-F and 1418-L-R, and primers lysE-F and lysE-R, respectively, with ATCC13032 genome as a template. Using pEC-XK99E as a template, obtaining a vector fragment by PCR amplification by using primers pEC-F and pEC-R, recovering the three fragments, and then carrying out recombination connection to obtain a recombinant expression vector pEC-P NCgl1418 -lysE。
In some specific embodiments, the present disclosure provides pXM-P tuf Gfp as template, the promoter sequence of the tuf gene comprising the RBS region of NCgl1418 gene was amplified using primers tuf-lysE-F and tuf-lysE-F. At the same time, using pXM-P NCgl1418 A vector fragment containing the lysE gene was obtained by PCR amplification using the primers tuf-pEC-F and tuf-pEC-R as a template. Recovering the two fragments and then carrying out recombination connection to obtain a recombinant expression vector pEC-P tuf -lysE。
In some specific embodiments, the present disclosure provides pXM-P NCgl1418 Gfp as a template, using primers 10P2-pEC-F and 10P2-pEC-R, obtaining a vector fragment containing a mutant promoter 10P2 and comprising a lysE gene by PCR amplification, then phosphorylating the vector fragment using T4 PNK, and constructing by self-cyclization to obtain pEC-P 10P2 -lysE。
In some specific embodiments, the present disclosure provides pXM-P NCgl1418 Using gfp as a template, using primers 10P17-pEC-F and 10P2-pEC-R, obtaining a vector fragment containing a mutant promoter 10P17 and a lysE gene by PCR amplification, then phosphorylating the linearized vector fragment, and constructing by self-cyclization to obtain pEC-P 10P17 -lysE。
In other embodiments, the present disclosure may also use promoter sequences of 10P1, 10P3, 10P4, 10P5, 10P6, 10P7, 10P8, 10P9, 10P10, 10P11, 10P12, 10P13, 10P14, 10P15, 10P16, 10P18 to construct desired recombinant vectors according to specific cloning requirements.
In some embodiments, the corynebacterium glutamicum SCgL30 strain of the present disclosure was constructed such that the threonine at position 311 of aspartokinase (encoded by lysC gene) on the genome of corynebacterium glutamicum ATCC13032 was mutated to isoleucine to obtain a strain SCgL30 having a certain lysine synthesis ability.
In some embodiments, the disclosure will pEC-P 10P2 Transforming the SCgL30 recombinant strain with lysE to obtain a recombinant host cell. In some embodiments, the disclosure relates to pEC-P 10P17 Transforming the SCgL30 recombinant strain with lysE to obtain a recombinant host cell. In some other embodiments, the present disclosure may further transform the recombinant vector comprising the promoter sequence of 10P1, 10P3, 10P4, 10P5, 10P6, 10P7, 10P8, 10P9, 10P10, 10P11, 10P12, 10P13, 10P14, 10P15, 10P16, 10P18 into the SCgL30 recombinant strain to obtain a recombinant host cell, respectively.
Process for producing target compound
(1) The polynucleotide with promoter activity is operably connected with a protein coding gene or a gene expression regulatory protein coding gene related to the synthesis of a target compound to obtain a recombinant expression vector of the protein or the gene expression regulatory protein related to the synthesis of the target compound, and the recombinant expression vector is utilized to transform a host cell to obtain the recombinant host cell.
(2) And (3) carrying out fermentation culture on the recombinant host cells, and collecting the target compound from the recombinant host cells or a culture solution of the recombinant host cells to finish the production process of the target compound.
In the production process, because the polynucleotide has improved promoter activity, in the recombinant host cell, the transcription activity of the protein related to the synthesis of the target compound or the coding gene of the gene expression regulatory protein is improved, the expression level of the protein related to the synthesis of the target compound or the gene expression regulatory protein is improved, and further the yield of the target compound is obviously improved.
In some particular embodiments, the present disclosure employs steps of a method of making an amino acid without the addition of an inducer. In a specific embodiment, the present disclosure employs no addition of IPTG in the steps of the method of preparing an amino acid.
In some embodiments, the compound of interest is an amino acid and the gene encoding a protein involved in the synthesis of the compound of interest refers to a gene encoding a protein involved in the synthesis of an amino acid. In some embodiments, the compound of interest is an L-amino acid and the protein-encoding gene associated with a synthetic amino acid refers to a protein-encoding gene associated with a synthetic L-amino acid. In some embodiments, the L-amino acid is L-lysine, and the protein involved in amino acid synthesis is lysine transporter LysE, such that the polynucleotide having promoter activity increases the expression of LysE, which promotes extracellular discharge and accumulation of lysine.
In some specific embodiments, the host cell is Corynebacterium glutamicum (Corynebacterium glutamicum), the Corynebacterium glutamicum is an important strain for producing L-lysine, and the polynucleotide, the transcription expression cassette or the recombinant expression vector with strong constitutive promoter activity is used for modifying the Corynebacterium glutamicum, so that the expression amount of proteins related to lysine synthesis in the Corynebacterium glutamicum is remarkably increased, and the L-lysine accumulation capacity of the Corynebacterium glutamicum due to long-time fermentation is greatly improved.
In some embodiments, the host cell is a corynebacterium glutamicum strain modified as follows: the threonine at position 311 of the aspartokinase (encoded by the lysC gene) in the genome of Corynebacterium glutamicum ATCC13032 was mutated to isoleucine.
In some specific embodiments, the recombinant host cell is cultured under conditions selected from the group consisting of: inoculating recombinant host cells into a TSB culture medium containing corresponding antibiotics, carrying out overnight culture at 30 ℃ and 220r/min, respectively transferring the recombinant host cells into a fermentation culture medium according to initial OD 0.3, wherein the culture system is 1mL of 24-pore plate liquid, the culture system is carried out at 30 ℃ and 800r/min for 24h, then terminating fermentation, and detecting the content and OD (oxygen demand) of residual glucose 600 And lysine production.
For the lysine fermentation medium, the formula is as follows: 80g/L glucose, 8g/L yeast powder, 9g/L urea and K 2 HPO 4 1.5g/L、MOPS 42g/L、FeSO 4 0.01g/L、MnSO 4 0.01g/L、MgSO 4 0.6g/L, a final chloramphenicol concentration of 5. Mu.g/mL, and/or a final kanamycin concentration of 25. Mu.g/mL.
In some specific embodiments, the compound of interest is recovered from the recombinant host cell or the culture broth of the recombinant cell by methods commonly used in the art, including, but not limited to: filtration, anion exchange chromatography, crystallization or HPLC.
Methods for manipulating microorganisms are known in the art, such as modern methods in molecular biology (Online ISBN:9780471142720, john Wiley and sons, inc.), (metabolic engineering of microorganisms: methods and protocols (Qiong Cheng ed., springer) and "engineering of systemic metabolism: methods and protocols (Hal s. Alper ed., springer) etc. publications.
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The experimental techniques and experimental procedures used in this example are, unless otherwise specified, conventional techniques, e.g., those in the following examples, in which specific conditions are not specified, and generally according to conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The materials, reagents and the like used in the examples are commercially available from normal sources unless otherwise specified.
The sequences of the primers used for plasmid construction in the examples of Table 1 are shown below:
Figure BDA0003058328710000121
example 1 characterization plasmid construction comprising NCgl1418 Gene promoter sequences
We first cultured Corynebacterium glutamicum ATCC13032 strain in CGXII medium with and without 0.6M NaCl or lysine sulphate and determined the promoter of the NCgl1418 gene to be a high-salt hyperosmotic inducible promoter by transcriptome sequencing analysis. In addition, by truncating the promoter in different lengths, NCgl1418 promoter fragments with 203bp (SEQ ID NO: 3), 145bp (SEQ ID NO: 4) and 94bp, respectively, were obtained, respectively, at higher intensities than the NCgl1418 promoters of different lengths under higher salt (0.6M sodium sulfate addition) and normal medium conditions. As a result, as shown in FIG. 1, the data show that the 94 bp-long NCgl1418 promoter basically lost the normal function of the promoter although it contained the core sequence (-35 region and-10 region); the induction intensity of the 145bp promoter is reduced under the condition of high salt, but the activity of the 243bp promoter can still reach more than 74 percent; the promoter with the length of 203bp basically keeps the activity of a 243bp promoter under the condition of high salt osmotic pressure, and is 94 percent of the activity of the 243bp promoter; the above results indicate that the promoter activity of NCgl1418 promoter and the activity under high salt osmotic pressure conditions need to include at least 145bp long DNA sequence as shown in SEQ ID NO 3.
Primers 1418-F (SEQ ID NO: 24)/1418-R (SEQ ID NO: 25) were designed based on the genomic sequence (NC-003450.3) of Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 published by NCBI. NCgl1 was obtained by PCR amplification using ATCC13032 genome as template418 gene (SEQ ID NO: 2). Meanwhile, the pXM-gfp reported in literature is taken as a template [1] The vector fragment from which the lacI gene and the tac promoter were removed was obtained by PCR amplification using the primers pGFP-F (SEQ ID NO: 26) and pGFP-R (SEQ ID NO: 27). After the two fragments are recovered, the recombinant vector pXM-P is obtained by recombinant ligation using a Vazyme Clon Express multiple one-step recombinant kit NCgl1418 -gfp. Meanwhile, the vector fragment was phosphorylated using T4 PNK, and a control vector pXM-con was constructed by self-cyclization. The recombinant vector was transformed into Corynebacterium glutamicum ATCC13032 to obtain a recombinant strain.
Example 2 construction of a control plasmid containing tuf promoter sequences
At present, the known universal endogenous strong constitutive promoter of Corynebacterium glutamicum is P tuf Thus, the present disclosure constructs plasmids with this promoter as a control to characterize the relative strength of the NCgl1418 mutant promoter.
Primers tuf-F (SEQ ID NO: 28) and tuf-R (SEQ ID NO: 29) were designed based on the genomic sequence (NC-003450.3) of Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 published by NCBI. A promoter sequence (SEQ ID NO: 23) having the tuf gene was obtained by PCR amplification using the ATCC13032 genome as a template. At the same time, using pXM-P NCgl1418 Gfp as template, a vector fragment containing the RBS region of NCgl1418 gene was obtained by PCR amplification using primers tuf-pGFP-F (SEQ ID NO: 30) and tuf-pGFP-R (SEQ ID NO: 31). Recovering the fragments, performing recombinant ligation by using a Vazyme Clon Express multiple recombinant kit, transforming the ligation product into Trans T1 competent cells, coating a chloramphenicol resistant plate for overnight culture, selecting positive clones for colony PCR verification, performing sequencing confirmation on correct transformants, and obtaining a recombinant vector named as pXM-P tuf -gfp. The recombinant vector was transformed into Corynebacterium glutamicum ATCC13032 to obtain a recombinant strain.
Example 3 NCgl1418 Gene promoter mutation library construction
In view of the fact that the promoter-10 region may have an important regulatory effect on the strength and properties of the promoter, this example randomly mutates the-10 region of the promoter core region (SEQ ID NO: 1) of NCgl1418 gene, which is underlined the main sequences of promoter-35 region and-10 region, respectively:
TATTAAAGATCACACCGAGTGGTGGAATTTCCTCAAGTGATTTACCCACAATGGACTTTG；
the specific mutation sequences are:
TATTAAAGATCACACCGAGTGGTGGAATTTCCTCAAGTGATTTACNNNNNNNNGACTTTG。
pXM-P using 1418mutant-F/R primers (SEQ ID NO:38 and SEQ ID NO: 39) NCgl1418 And-gfp reverse PCR amplification, transforming escherichia coli T1 competent cells by phosphorylating and ligating the obtained linearized plasmid fragment, obtaining resistant clones. All the obtained clones were subjected to cell collection and plasmid extraction to obtain a mutant library of the NCgl1418 gene promoter.
Example 4 screening of mutant libraries and characterization of mutant promoters from NCgl1418 Gene promoters
The promoter mutant library was transformed into Corynebacterium glutamicum ATCC13032 using the strains ATCC13032 (pXM-Con) and ATCC13032 (pXM-P) NCgl1418 -gfp) as an empty vector and a wild type control, inoculating the above strain in a TSB medium containing 5. Mu.g/mL chloramphenicol, culturing at 30 ℃ at 220r/min for 8-10 h, and adding 0.6M Na according to the initial OD1 2 SO 4 The culture system of the CGXIIY medium is 1mL in 24-well plate liquid, cultured at 30 ℃ and 800r/min for 6h, the obtained bacterial liquid is diluted by 50 times with PBS buffer solution, then treated by ultrasonic for 6min, and then subjected to fluorescence sorting by a flow cytometer (top 0.01%).
The strains obtained by the above sorting and wild-type NCgl1418 promoter, tuf promoter and promoterless control strains were inoculated with TSB medium containing 5. Mu.g/mL chloramphenicol, respectively, and cultured overnight at 30 ℃ at 220 r/min. Wherein the TSB liquid culture medium comprises the following components (g/L): glucose, 5g/L; 5g/L of yeast powder; soybean peptone, 9g/L; 3g/L of urea; succinic acid, 0.5g/L; k is 2 HPO 4 ·3H 2 O，1g/L；MgSO 4 ·7H 2 O,0.1g/L; biotin, 0.01mg/L; vitamin B1,0.1mg/L; MOPS,20g/L.
Switching according to initial OD 0.5With or without 0.6M Na 2 SO 4 The CGXIIY culture medium has a culture system of 1mL of 24-pore plate liquid, is cultured at 30 ℃ at 800r/min for 24 hours, and then GFP fluorescence intensity and OD of different strains are detected 600 The relative intensities of the mutant promoters under different conditions were characterized by the fluorescence intensity of the unit cell (minus the fluorescence intensity of the unit cell of the control strain under the same conditions). Wherein the formula of the CGXIIY culture medium is as follows: glucose 50g/L, NH 4 Cl 16.5g/L, urea 5g/L, KH 2 PO 4 1g/L、K 2 HPO 4 1g/L、MOPS 42g/L、MgSO 4 0.25g/L、FeSO 4 ·7H 2 O 0.01g/L、MnSO 4 ·H 2 O 0.01g/L、ZnSO 4 ·7H 2 O 0.001g/L、CuSO 4 0.2mg/L、NiCl·6H 2 O 0.02mg/L、CaCl 2 0.01g/L, 0.03g/L protocatechuic acid, 0.2mg/L biotin, 0.1mg/L vitamin B, and a final concentration of chloramphenicol of 5. Mu.g/mL. Screening 18 strong constitutive mutant promoters with the intensity higher than that of endogenous strong constitutive promoter P of Corynebacterium glutamicum according to the detected fluorescence intensity tuf And is substantially no longer induced by hypertonic salt (table 2).
TABLE 2
Figure BDA0003058328710000141
Figure BDA0003058328710000151
a Fluorescence intensity of each promoter/fluorescence intensity of wild-type NCgl1418 Gene promoter (No Na addition) 2 SO 4 )
b Adding Na 2 SO 4 Fluorescence intensity of (1)/not adding Na 2 SO 4 Intensity of fluorescence of
Example 5 use of mutant promoters to regulate LysE expression in lysine Synthesis
The genomic sequence of Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 published according to NCBI(NC-003450.3), primers 1418-L-F (SEQ ID NO: 32) and 1418-L-R (SEQ ID NO: 33), lysE-F (SEQ ID NO: 34) and lysE-R (SEQ ID NO: 35) were designed, respectively. The promoter sequence of NCgl1418 gene and the DNA sequence of lysE gene were obtained by PCR amplification using ATCC13032 genome as a template, respectively. Meanwhile, pEC-XK99E reported in literature is taken as a template [2] The vector fragment was obtained by PCR amplification using the primers pEC-F (SEQ ID NO: 36) and pEC-R (SEQ ID NO: 37). Recovering the three fragments, carrying out recombination connection by using a Vazyme Clon Express multiple one-step recombination kit, transforming the connection product into Trans T1 competent cells, coating a kanamycin resistant plate for overnight culture, selecting positive clones for colony PCR verification, carrying out sequencing confirmation on correct transformants, and obtaining a recombinant vector named as pEC-P NCgl1418 -lysE。
With pXM-P tuf Gfp as template, the promoter sequence (SEQ ID NO: 47) of the tuf gene comprising the RBS region of NCgl1418 gene was amplified using primers tuf-lysE-F (SEQ ID NO: 40) and tuf-lysE-R (SEQ ID NO: 41). At the same time, using pXM-P NCgl1418 With lysE as a template, a vector fragment containing the lysE gene was obtained by PCR amplification using primers tuf-pEC-F (SEQ ID NO: 42) and tuf-pEC-R (SEQ ID NO: 43). Recovering the two fragments, performing recombinant connection by using a Vazyme Clon Express II recombinant kit, transforming the connection product into a Trans T1 competent cell, coating a kanamycin resistant plate for overnight culture, selecting a positive clone for colony PCR verification, performing sequencing confirmation on a correct transformant, and obtaining a recombinant vector named as pEC-P tuf -lysE。
With pXM-P NCgl1418 lysE as a template, and 10P2-pEC-F (SEQ ID NO: 44), 10P17-pEC-F (SEQ ID NO: 45) and 10P2-pEC-R (SEQ ID NO: 46), respectively, were used to obtain a vector fragment containing the lysE gene with mutant promoters 10P2 and 10P17 by PCR amplification. Then, the vector fragment is phosphorylated by utilizing T4 PNK, and pEC-P is obtained through self-cyclization construction 10P2 lysE and pEC-P 10P17 -lysE。
The recombinant vector pEC-P is prepared NCgl1418 -lysE、pEC-P tuf -lysE、pEC-P 10P2 -lysE、pEC-P 10P17 lysE and pEC-XK99E were transformed into C.glutamicum ScgL30, respectively, to obtain a recombinant strain and a control strain. Respectively inoculating the above strains into TSB culture medium containing 25 μ g/mL kanamycin, culturing at 30 deg.C and 220r/min overnight, respectively transferring to fermentation culture medium according to initial OD 0.3, culturing in 24-well plate at 30 deg.C and 800r/min for 24 hr, terminating fermentation, and detecting residual glucose content and OD 600 And lysine production. Wherein the lysine fermentation medium formula is as follows: 80g/L glucose, 8g/L yeast powder, 9g/L urea and K 2 HPO 4 1.5g/L、MOPS 42g/L、FeSO 4 0.01g/L、MnSO 4 0.01g/L、MgSO 4 0.6g/L, kanamycin to 25 u g/mL final concentration. The results are shown in Table 3, and the data show that P is used tuf When LysE is over-expressed, the yield of lysine and the conversion rate of glucose are respectively increased by 31 percent and 32 percent compared with those of a control strain, while when the LysE is over-expressed by using a wild type NCgl1418 gene promoter, the yield of lysine and the conversion rate of glucose are only increased by 16 percent and 15 percent due to weaker promoter strength under hypotonic condition, while when LysE is over-expressed by using strong constitutive promoters 10P2 and 10P17 obtained by mutation screening, the yield of lysine is respectively increased by 38 percent and 69 percent, while the conversion rate of glucose is respectively increased by 45 percent and 88 percent compared with that of the control strain, and the yield and the conversion rate of glucose are both far higher than those of the wild type NCgl1418 promoter and an endogenous strong promoter P tuf And the method has good application prospect.
TABLE 3 application effect of constitutive strong promoter to regulation of LysE expression in lysine synthesis
Figure BDA0003058328710000161
In addition, the disclosure in fig. 1 demonstrates that the 145bp length promoter can reach over 74% of the 243bp promoter activity under high salt osmotic pressure conditions; the promoter with the length of 203bp basically keeps the activity of the 243bp promoter under the condition of high salt osmotic pressure, and is 94 percent of the activity of the 243bp promoter; illustrating the sequence of the amino acid sequence due to SEQ ID NO:3 and SEQ ID NO:4 comprises the core region of the promoter of NCgl1418 gene, SEQ ID NO:3 and SEQ ID NO:4 can also show obviously enhanced promoter activity under the environment with increased salt concentration and osmotic pressure. Thus, the method of modifying the promoter core region in the above example was used to modify the promoter sequence of SEQ ID NO:3, or at one or more of positions 164-171 of the sequence shown in SEQ ID NO:4 in any one or more of positions 106-113, and strong constitutive promoter mutants can also be obtained.
Cited documents:
[1]Sun DH et al.,Journal of Industrial Microbiology&Biotechnology 2019,46(2):203-208.
[2]O Kirchner,et al.Journal of Biotechnology,2003,104:287-299.
all technical features disclosed in the present specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.
Furthermore, from the foregoing description, one skilled in the art can readily appreciate the key features of the disclosure from the present disclosure, that numerous modifications can be made to adapt the invention to various usages and conditions without departing from the spirit and scope of the disclosure, and therefore, such modifications are intended to fall within the scope of the appended claims.
Sequence listing
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> polynucleotide having promoter activity and use thereof for producing objective compound
<130> 6A17-2133227I
<160> 47
<170> SIPOSequenceListing 1.0
<210> 1
<211> 60
<212> DNA
<213> Corynebacterium glutamicum
<400> 1
tattaaagat cacaccgagt ggtggaattt cctcaagtga tttacccaca atggactttg 60
<210> 2
<211> 243
<212> DNA
<213> Corynebacterium glutamicum
<400> 2
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacccacaat ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 3
<211> 203
<212> DNA
<213> Corynebacterium glutamicum
<400> 3
gacacctgtg agtttcaaac tccccattat cgccttagtc aggcggtagt ggggagtttt 60
tgtttatgca ggtggcgcga ttcttagatt tcataagggt aacagatctg tttctatgta 120
ttaaagatca caccgagtgg tggaatttcc tcaagtgatt tacccacaat ggactttgtt 180
gatacccaat tcgagaaagg cca 203
<210> 4
<211> 145
<212> DNA
<213> Corynebacterium glutamicum
<400> 4
tttgtttatg caggtggcgc gattcttaga tttcataagg gtaacagatc tgtttctatg 60
tattaaagat cacaccgagt ggtggaattt cctcaagtga tttacccaca atggactttg 120
ttgataccca attcgagaaa ggcca 145
<210> 5
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P1
<400> 5
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacactgtag ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 6
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P2
<400> 6
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactattatg ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 7
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P3
<400> 7
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacaattggg ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 8
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P4
<400> 8
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactatggtt ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 9
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P5
<400> 9
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactagggta ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 10
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P6
<400> 10
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacaatggaa tgactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 11
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P7
<400> 11
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactagactt cgactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 12
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P8
<400> 12
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacaatgggt agactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 13
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P9
<400> 13
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactaccatt agactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 14
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P10
<400> 14
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacactgagg ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 15
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P11
<400> 15
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacactagaa ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 16
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P12
<400> 16
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacaattagt ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 17
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P13
<400> 17
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacaataggg tgactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 18
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P14
<400> 18
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactagtatt ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 19
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P15
<400> 19
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacactggac tgactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 20
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P16
<400> 20
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactaacatg ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 21
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P17
<400> 21
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tacactaggg ggactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 22
<211> 243
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P18
<400> 22
taaaactcgc gatgaagtag aaaaacaacg caacacttaa gacacctgtg agtttcaaac 60
tccccattat cgccttagtc aggcggtagt ggggagtttt tgtttatgca ggtggcgcga 120
ttcttagatt tcataagggt aacagatctg tttctatgta ttaaagatca caccgagtgg 180
tggaatttcc tcaagtgatt tactataagt tgactttgtt gatacccaat tcgagaaagg 240
cca 243
<210> 23
<211> 349
<212> DNA
<213> Artificial Sequence
<220>
<223> Ptuf
<400> 23
agatcgttta gatccgaagg aaaacgtcga aaagcaattt gcttttcgac gccccacccc 60
gcgcgtttta gcgtgtcagt aggcgcgtag ggtaagtggg gtagcggctt gttagatatc 120
ttgaaatcgg ctttcaacag cattgatttc gatgtattta gctggccgtt accctgcgaa 180
tgtccacagg gtagctggta gtttgaaaat caacgccgtt gcccttagga ttcagtaact 240
ggcacatttt gtaatgcgct agatctgtgt gctcagtctt ccaggctgct tatcacagtg 300
aaagcaaaac caattcgtgg ctgcgaaagt cgtagccacc acgaagtcc 349
<210> 24
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418-F
<400> 24
cttttcacca gtgagacggg taaaactcgc gatgaagtag 40
<210> 25
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418-R
<400> 25
gttcttctcc tttactcatc attggccttt ctcgaattgg g 41
<210> 26
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> pGFP-F
<400> 26
atgagtaaag gagaagaact tttcac 26
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> pGFP-R
<400> 27
cccgtctcac tggtgaaaag 20
<210> 28
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-F
<400> 28
caccagtgag acgggagatc gtttagatcc gaaggaaaa 39
<210> 29
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-R
<400> 29
ctcgaattgg gtatcaacgg acttcgtggt ggctacga 38
<210> 30
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-pGFP-F
<400> 30
gttgataccc aattcgagaa agg 23
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-pGFP-R
<400> 31
cccgtctcac tggtgaaaag 20
<210> 32
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418-L-F
<400> 32
agcggcatgc atttacgttt aaaactcgcg atgaagtag 39
<210> 33
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418-L-R
<400> 33
agatttccat gatcaccatc attggccttt ctcgaattgg g 41
<210> 34
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> lysE-F
<400> 34
atggtgatca tggaaatctt cattac 26
<210> 35
<211> 44
<212> DNA
<213> Artificial Sequence
<220>
<223> lysE-R
<400> 35
gtctgtttcc tgtgtgaaac taacccatca acatcagttt gatg 44
<210> 36
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> pEC-F
<400> 36
tttcacacag gaaacagacc atg 23
<210> 37
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> pEC-R
<400> 37
aacgtaaatg catgccgctt c 21
<210> 38
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418mutant-F
<400> 38
nnnnnnnnga ctttgttgat acccaattcg ag 32
<210> 39
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> 1418mutant-R
<400> 39
gtaaatcact tgaggaaatt ccacc 25
<210> 40
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-lysE-F
<400> 40
agcggcatgc atttacgtta gatcgtttag atccgaagga aaacg 45
<210> 41
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-lysE-R
<400> 41
agatttccat gatcaccatc attggccttt ctcgaattgg g 41
<210> 42
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-pEC-F
<400> 42
atggtgatca tggaaatctt cattac 26
<210> 43
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> tuf-pEC-R
<400> 43
aacgtaaatg catgccgctt c 21
<210> 44
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P2-pEC-F
<400> 44
tattatggga ctttgttgat acccaattcg ag 32
<210> 45
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P17-pEC-F
<400> 45
actaggggga ctttgttgat acccaattcg ag 32
<210> 46
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> 10P2-pEC-R
<400> 46
gtaaatcact tgaggaaatt ccacc 25
<210> 47
<211> 375
<212> DNA
<213> Artificial Sequence
<220>
<223> promoter sequence of tuf Gene comprising RBS region
<400> 47
agatcgttta gatccgaagg aaaacgtcga aaagcaattt gcttttcgac gccccacccc 60
gcgcgtttta gcgtgtcagt aggcgcgtag ggtaagtggg gtagcggctt gttagatatc 120
ttgaaatcgg ctttcaacag cattgatttc gatgtattta gctggccgtt accctgcgaa 180
tgtccacagg gtagctggta gtttgaaaat caacgccgtt gcccttagga ttcagtaact 240
ggcacatttt gtaatgcgct agatctgtgt gctcagtctt ccaggctgct tatcacagtg 300
aaagcaaaac caattcgtgg ctgcgaaagt cgtagccacc acgaagtccg ttgataccca 360
attcgagaaa ggcca 375

Claims (14)

1. A polynucleotide having promoter activity, wherein the polynucleotide is selected from any one of the following groups (i) to (vi):
(i) Comprises the amino acid sequence shown as SEQ ID NO:2, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:2 at one or more of positions 204-211 of the sequence set forth in seq id No. 2; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:2, and the mutant has a promoter activity in the polynucleotide of the sequence shown in SEQ ID NO:2 is not CCACAATG at positions 204-211;
(ii) Comprises a nucleotide sequence as set forth in SEQ ID NO:3, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:3 at one or more of positions 164-171 of the sequence set forth in seq id no; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:3, and said mutant has a promoter activity in the polynucleotide having a sequence shown in SEQ ID NO:3 the nucleotide sequence in positions 164-171 of the sequence shown in is not CCACAATG;
(iii) Comprises the amino acid sequence shown as SEQ ID NO:4, which mutant is a variant of a polynucleotide having the sequence shown in SEQ ID NO:4 at one or more of positions 106-113 of the sequence set forth in seq id No. 4; the mutant has higher activity than the mutant containing the amino acid sequence shown as SEQ ID NO:4, and said mutant has a promoter activity in the polynucleotide having a sequence as set forth in SEQ ID NO:4 is not CCACAATG at positions 106-113;
(iv) (iv) a polynucleotide comprising a sequence that is the reverse complement of the nucleotide sequence set forth in any one of (i) to (iii);
(v) (iv) a polynucleotide comprising a sequence that is the reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (i) to (iii) under high stringency hybridization conditions or very high stringency hybridization conditions;
(vi) (iv) a polynucleotide comprising a sequence which has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence set forth in any one of (i) to (iii).
2. The polynucleotide having promoter activity according to claim 1, wherein the mutant has a mutation in comparison with a polynucleotide comprising the sequence as set forth in SEQ ID NO:2-4 has a promoter activity 5-13 times or more higher than that of the polynucleotide having the sequence shown in FIGS.
3. The polynucleotide having promoter activity according to any one of claims 1 to 2, wherein the mutant corresponds to the polynucleotide of SEQ ID NO:2, or a sequence corresponding to SEQ ID NO:3, or a sequence corresponding to SEQ ID NO:4 is selected from the group consisting of (p) 1 )-(p 18 ) Any one of the group consisting of:
(p 1 )ACTGTAGG，
(p 2 )TATTATGG，
(p 3 )AATTGGGG，
(p 4 )TATGGTTG，
(p 5 )TAGGGTAG，
(p 6 )AATGGAAT，
(p 7 )TAGACTTC，
(p 8 )AATGGGTA，
(p 9 )TACCATTA，
(p 10 )ACTGAGGG，
(p 11 )ACTAGAAG，
(p 12 )AATTAGTG，
(p 13 )AATAGGGT，
(p 14 )TAGTATTG，
(p 15 )ACTGGACT，
(p 16 )TAACATGG，
(p 17 )ACTAGGGG，
(p 18 )TATAAGTT。
4. the polynucleotide having promoter activity according to any one of claims 1 to 3, wherein the nucleotide sequence of the mutant is selected from the group consisting of SEQ ID NO: 5-22.
5. A transcription expression cassette, wherein the transcription expression cassette comprises a polynucleotide having promoter activity according to any one of claims 1 to 4; optionally, the transcription expression cassette further comprises a gene of interest operably linked to the polynucleotide having promoter activity; preferably, the target gene is a protein-encoding gene.
6. A recombinant expression vector comprising the polynucleotide having promoter activity according to any one of claims 1 to 4, or the transcription expression cassette according to claim 5.
7. A recombinant host cell comprising the transcription expression cassette of claim 5, or the recombinant expression vector of claim 6.
8. The recombinant host cell according to claim 7, wherein said host cell is derived from Corynebacterium, brevibacterium, arthrobacter, microbacterium, or Escherichia; preferably, the host cell is corynebacterium glutamicum or escherichia coli; more preferably, the host cell is corynebacterium glutamicum ATCC13032, corynebacterium glutamicum ATCC13869, or corynebacterium glutamicum ATCC 14067.
9. Use of a polynucleotide having promoter activity according to any one of claims 1-4, a transcription cassette according to claim 5, a recombinant expression vector according to claim 6, a recombinant host cell according to claim 7 or 8 in at least one of:
(a) Regulating the transcription level of a gene, or preparing a reagent or a kit for regulating the transcription level of a gene;
(b) Preparing a protein, or preparing a reagent or kit for preparing a protein;
(c) Producing a compound of interest, or preparing a reagent or kit for producing a compound of interest.
10. The use according to claim 9, wherein the protein is selected from a gene expression regulatory protein or a protein associated with synthesis of a target compound.
11. The use of claim 9 or 10, wherein the target compound comprises at least one of an amino acid, an organic acid; optionally, the amino acid comprises at least one of proline, lysine, glutamic acid, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, and the organic acid comprises at least one of citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, valeric acid, malic acid.
12. A method for controlling transcription of a target gene, wherein the method comprises the step of operably linking the polynucleotide having promoter activity according to any one of claims 1 to 4 to the target gene.
13. A method for producing a protein, wherein the method comprises the step of expressing the protein using the transcription expression cassette of claim 5, the recombinant expression vector of claim 6, or the recombinant host cell of any one of claims 7 to 8; optionally, the protein is a protein associated with synthesis of a target compound or a gene expression regulatory protein;
optionally, the method further comprises the step of isolating or purifying the protein.
14. A method for producing a target compound, wherein the method comprises the step of expressing a protein involved in the synthesis of the target compound or a gene expression regulatory protein using the transcription expression cassette according to claim 5, the recombinant expression vector according to claim 6, or the recombinant host cell according to any one of claims 7 to 8, and producing the target compound in the presence of the protein involved in the synthesis of the target compound or the gene expression regulatory protein;
optionally, the target compound comprises at least one of an amino acid, an organic acid; optionally, the amino acid comprises at least one of lysine, glutamic acid, threonine, proline, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, and the organic acid comprises at least one of citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, valeric acid, malic acid;
optionally, the protein involved in the synthesis of the target compound is a protein involved in the synthesis of an L-amino acid; optionally, the protein involved in L-amino acid synthesis comprises one or a combination of two or more of pyruvate carboxylase, phosphoenolpyruvate carboxylase, γ -glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transporter, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetate decarboxylase, glucorepressor, glucose dehydrogenase, aspartokinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydropicolinate reductase, succinyldiaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyldiaminopimelate deacylase, diaminopimelate epimerase, diaminopimelate deacylase, glyceraldehyde-3-phosphate dehydrogenase, transketolase, diaminopimelate dehydrogenase, and carboxylase;
optionally, the method further comprises the step of isolating or purifying the target compound.
CN202110505665.8A 2021-05-10 2021-05-10 Polynucleotides having promoter activity and use thereof for producing target compounds Pending CN115322990A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110505665.8A CN115322990A (en) 2021-05-10 2021-05-10 Polynucleotides having promoter activity and use thereof for producing target compounds

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110505665.8A CN115322990A (en) 2021-05-10 2021-05-10 Polynucleotides having promoter activity and use thereof for producing target compounds

Publications (1)

Publication Number Publication Date
CN115322990A true CN115322990A (en) 2022-11-11

Family

ID=83912585

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110505665.8A Pending CN115322990A (en) 2021-05-10 2021-05-10 Polynucleotides having promoter activity and use thereof for producing target compounds

Country Status (1)

Country Link
CN (1) CN115322990A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1582300A (en) * 2001-11-05 2005-02-16 巴斯福股份公司 Gene which codes for novel proteins
US20080268502A1 (en) * 2004-12-22 2008-10-30 Stefan Haefner Multiple Promoters and the Use Thereof For Gene Expression
CN103635578A (en) * 2011-06-28 2014-03-12 赢创德固赛有限公司 Variants of the promoter of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase
CN112695036A (en) * 2021-03-23 2021-04-23 中国科学院天津工业生物技术研究所 Aspartokinase gene expression regulatory sequence and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1582300A (en) * 2001-11-05 2005-02-16 巴斯福股份公司 Gene which codes for novel proteins
US20080268502A1 (en) * 2004-12-22 2008-10-30 Stefan Haefner Multiple Promoters and the Use Thereof For Gene Expression
CN103635578A (en) * 2011-06-28 2014-03-12 赢创德固赛有限公司 Variants of the promoter of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase
CN112695036A (en) * 2021-03-23 2021-04-23 中国科学院天津工业生物技术研究所 Aspartokinase gene expression regulatory sequence and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
王迎春等: "基于时间序列转录组筛选谷氨酸棒杆菌内源高效组成型启动子", 生物工程学报, no. 11, 25 November 2018 (2018-11-25), pages 45 - 56 *

Similar Documents

Publication Publication Date Title
CN112175895B (en) Modified polypeptides having reduced citrate synthase activity and methods of producing L-amino acids using the same
AU2018293281B2 (en) Novel aspartokinase mutant and method for production of L-amino acid using same
CN112695036B (en) Aspartokinase gene expression regulatory sequence and application thereof
WO2022017221A1 (en) Mutant of glutamate dehydrogenase gene promoter and application thereof
EP4202046A1 (en) Polynucleotide having promoter activity and application of polynucleotide in producing amino acid
CN108795912B (en) Lysine decarboxylase mutant and application thereof
CN111411092B (en) Corynebacterium glutamicum for high yield of L-lysine and application thereof
WO2022017223A1 (en) Mutant of pyruvate carboxylase gene promoter and use thereof
CN114729338B (en) Variant dihydropyridine dicarboxylic acid reductase polypeptides and methods of producing L-threonine using the same
CN113201538B (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN113278620B (en) Mutant hypertonic inducible promoter Pprox and application thereof
CN113201539B (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN115322990A (en) Polynucleotides having promoter activity and use thereof for producing target compounds
CN115500080A (en) Novel bifunctional methylenetetrahydrofolate dehydrogenase/methylenetetrahydrofolate cyclohydrolase variants and methods of producing XMP or GMP using the same
CN115449519B (en) Polynucleotide having promoter activity based on dapB gene and use thereof
CN115322989A (en) Polynucleotide having promoter activity, use thereof, and method for producing target compound
CN115449518B (en) Polynucleotide with promoter activity based on mdh gene and application thereof
WO2022152036A1 (en) Polynucleotide having promoter activity and use thereof in production of traget compounds
CN115506035B (en) Construction method of promoter mutant library and promoter mutant library
CN115490761B (en) Recombinant microorganism constructed based on lysine efflux protein and method for producing lysine
RU2812048C9 (en) Pyruvate carboxylase gene promoter mutant and its application
RU2812048C1 (en) Pyruvate carboxylase gene promoter mutant and its application
CN116891868A (en) Osmotic pressure tolerance functional gene identification method and application of functional gene
CN115806962A (en) Phosphoenolpyruvate carboxylase mutant and application thereof
CN115746110A (en) Mutant of transcriptional regulatory factor LysG and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination