CN113234752A - Method for improving endogenous VC content of wheat plant - Google Patents
Method for improving endogenous VC content of wheat plant Download PDFInfo
- Publication number
- CN113234752A CN113234752A CN202110552456.9A CN202110552456A CN113234752A CN 113234752 A CN113234752 A CN 113234752A CN 202110552456 A CN202110552456 A CN 202110552456A CN 113234752 A CN113234752 A CN 113234752A
- Authority
- CN
- China
- Prior art keywords
- wheat
- screening
- gdp
- callus
- content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
- C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07069—GDP-L-galactose phosphorylase (2.7.7.69)
Abstract
The invention relates to the technical field of plant genetic engineering, and discloses a method for improving the endogenous VC content of a wheat plant. The method has high transgenic efficiency, and can improve the synthesis efficiency of vitamin C in the wheat body, thereby quickly obtaining the transgenic wheat variety with high VC content and enabling the wheat to have higher nutritive value.
Description
Technical Field
The invention relates to the technical field of wheat transgenosis, in particular to a method for improving the endogenous VC content of a wheat plant.
Background
Vitamin C, also known as L-ascorbic acid (ASA), is a vitamin essential for normal physiological metabolism of the human body, and the human body mainly depends on fruits rather than staple food for the intake of vitamin C. Common wheat, whether malt or kernel, has very low vitamin C content, and cannot provide a certain amount of vitamin C for human body while being taken as daily staple food.
Vitamin C is also one of the most important antioxidant substances in plants, and can eliminate active oxygen generated in plants due to various adverse environments, so that plant cells are protected from oxidative stress. The VC content in the wheat body is improved, so that the oxidation resistance of the wheat can be improved, the VC content of the wheat can be improved, and the nutritional value of the wheat is improved. At present, researches on how to improve the endogenous VC content of wheat plants are few, and no effective method is reported at present. If the wheat with high VC content is cultivated by using the traditional crossbreeding method, the method is difficult to obtain a stable wheat variety with high VC content, and the period is very long.
To date, there are four pathways for vitamin C synthesis in plants, the Smirnoff-Wheeler pathway, the galacturonic acid pathway, the gulose pathway, and the inositol pathway. But the most predominant pathway is also the Smirnoff-Wheeler pathway, the L-galactose pathway. The key step in this pathway is the catalytic synthesis of L-galactose-1-phosphate from GDP-L-galactose. The phosphorylation of GDP-L-galactose phosphorylase is required to complete this step, and the gene encoding GDP-L-galactose phosphorylase is the GDP-L-galactose phosphorylase gene, GGP (GDP-L-galactose phosphorylase).
Because the wheat is allohexaploid wheat, the genome is very complex, pure transgenic plants are difficult to obtain by utilizing a transgenic technology, the transgenic efficiency is low, and a large amount of work is required to obtain the positive plants of the wheat.
Disclosure of Invention
The invention aims to provide a technical method for improving the content of endogenous vitamin C in wheat plants, which has the advantages of fast period and good effect.
The technical scheme of the invention is as follows:
the invention provides a method for improving the endogenous VC content of a wheat plant, which comprises the following steps: the GDP-L-galactose phosphorylase gene cloned from tobacco is constructed into an expression vector, and then the obtained recombinant expression vector is transformed into wheat immature embryos to screen positive plants.
In the invention, the sequence of the GDP-L-galactose phosphorylase gene is shown in a sequence table SEQ ID NO 1.
In the present invention, the method for cloning the GDP-L-galactose phosphorylase gene from tobacco comprises: extracting total RNA of Nicotiana benthamiana, carrying out reverse transcription to obtain cDNA, and designing a primer with the cDNA as a template to carry out amplification to obtain the GDP-L-galactose phosphorylase gene.
Preferably, the primer is: ATGATGCTCAAGATTAAGAGG for F and GACGGGAACCATGGTAGCATG for R.
In the invention, the construction method of the recombinant expression vector comprises the following steps: and carrying out double enzyme digestion and purification on the unloaded plasmid to obtain a linearized vector, and connecting the linearized vector with the GDP-L-galactose phosphorylase gene fragment to obtain a recombinant plasmid.
Preferably, the expression vector is pWMB190 or pAHC 25.
As one embodiment, the method for transforming the genetic transformation of wheat mediated by the gene gun.
As an embodiment, the method of converting comprises: pretreating the wheat immature embryo callus in a culture medium containing 0.35-0.4M osmotic pressure for 4-6 h, mixing a recombinant vector and a screening marker, bombarding the mixture by using a gene gun to enter the pretreated immature embryo of the callus, and continuously culturing for 16-18 h; the treated callus was transferred to SD2 or modified MS medium for two weeks of recovery culture.
As an embodiment, the method of screening comprises: transferring the wheat immature embryo callus to 1/2MS differentiation and screening culture medium containing 0.8-1mg/L NAA and 0.8-1mg/L KT, transferring to 1/2MS hormone-free growth and screening culture medium after callus is differentiated to form plantlets, transferring the plantlets obtained after screening for a plurality of times to 1/2MS culture medium containing 0.15-0.2mg/L IAA and 0.4-0.5mg/L paclobutrazol for strengthening seedling treatment, and transplanting and identifying.
In one embodiment, the screening agent of the present invention is bialaphos or glyphosate, and the concentration of the screening agent gradually increases with the increase of the screening times.
The invention has the beneficial effects that:
the invention provides a method for improving the endogenous VC content of a wheat plant, which comprises the steps of constructing a GDP-L-galactose phosphorylase gene cloned from tobacco into an expression vector, then transforming a recombinant expression vector into wheat immature embryos, and screening positive plants. The GDP-L-galactose phosphorylase gene is cloned from tobacco cDNA, transferred into wheat and expressed and translated into GDP-L-galactose phosphorylase, so that the synthesis efficiency of vitamin C in wheat is improved, and the vitamin C content of the whole wheat is increased. The method has high transgenic efficiency, and can quickly obtain a transgenic wheat variety with high VC content, so that the wheat has higher nutritive value.
According to the invention, leaves, stems and grains of positive transgenic wheat plants and common wheat plants in the same growth period are collected, and the content of vitamin C is determined by High Performance Liquid Chromatography (HPLC), and the result shows that the content of VC in GDP-L-galactose phosphorylase gene-transferred positive wheat is remarkably improved compared with that of non-transgenic wild wheat in leaves, stems and grains, and the content of VC in the positive transgenic wheat leaves, stems and grains is respectively improved by 2.8 times, 1.9 times and 1.5 times compared with that in common wheat.
Drawings
FIG. 1: cloning a GDP-L-galactose phosphorylase gene in tobacco;
FIG. 2: detecting and identifying the result of the transgenic wheat RT-PCR;
FIG. 3: and comparing the VC content of the transgenic wheat plants and wild plants in leaves, stalks and grains.
Detailed Description
The invention provides a method for improving the endogenous VC content of a wheat plant, which comprises the steps of constructing a GDP-L-galactose phosphorylase gene cloned from tobacco into an expression vector, then transforming the obtained recombinant expression vector into wheat immature embryos, and screening positive plants. Compared with the common wild wheat plant, the VC content in the leaves, the stems and the grains of the obtained positive transgenic wheat plant is obviously improved. The GDP-L-galactose phosphorylase gene is cloned from tobacco, and the nucleotide sequence of the GDP-L-galactose phosphorylase gene is shown as a sequence table SEQ ID NO. 1. The invention has no special limitation on the type of tobacco, and in the specific embodiment of the invention, the GDP-L-galactose phosphorylase gene is cloned from the Nicotiana benthamiana, and the VC content in the tobacco can be improved by transiently expressing the gene. As an example, the method for cloning the GDP-L-galactose phosphorylase gene from tobacco comprises: extracting total RNA of Nicotiana benthamiana, carrying out reverse transcription to obtain cDNA, and designing a primer with the cDNA as a template to carry out amplification to obtain the GDP-L-galactose phosphorylase gene. As an example, the total RNA extraction method of the present invention employs Trizol. The reverse transcription method of the present invention is not particularly limited, and reverse transcription of RNA is carried out by a method or a kit known in the art. The present invention is not particularly limited in the manner of amplification, and amplification methods known in the art are used. As an example, the primers for amplification are: ATGATGCTCAAGATTAAGAGG for F and GACGGGAACCATGGTAGCATG for R. The PCR amplification procedure was: 95 deg.C for 5 min; 95 ℃ for 30 s; at 58 ℃ for 30 s; 72 ℃ for 1 min; 72 deg.C, 10 min.
The GDP-L-galactose phosphorylase gene is constructed into an expression vector to obtain a recombinant expression vector. Designing a primer of a sequence according to the gene sequence of GDP-L-galactose phosphorylase, respectively adding homologous arm sequences at the front end and the rear end of the primer, and constructing the primer to an expression vector in a homologous recombination connection mode. As an example, forward and reverse primers are F: CGACTCTAGAGGATCCATGATGCTCAAGATTAAGAGG; GAGCTCTCTAGACTAGT GACGGGAACCATGGTAGCATG is added. The construction method of the recombinant expression vector comprises the following steps: and carrying out double enzyme digestion and purification on the idle-load plasmid to obtain a linearized vector, and connecting the linearized vector with the viscous tail end of the GDP-L-galactose phosphorylase gene fragment to obtain a recombinant plasmid. As an example, the expression vector of the present invention may be pWMB190 or pAHC 25. As an example, the double cleavage sites are BamH1 and Spe 1.
As one example, the present invention uses a particle gun-mediated method for genetic transformation of wheat. The method for transformation comprises the following steps: pretreating the wheat immature embryo callus in a culture medium containing 0.35-0.4M osmotic pressure for 4-6 h, mixing a recombinant vector and a screening marker, bombarding the mixture by using a gene gun to enter the pretreated immature embryo of the callus, and continuously culturing for 16-18 h; the treated callus was transferred to SD2 or modified MS medium for two weeks of recovery culture. The preferred screening marker in the invention contains a resistance gene containing glufosinate-ammonium or bialaphos resistance, and is co-transferred to the wheat immature embryo callus together with the recombinant expression vector, and screening is carried out under the environment containing the screening agent, so as to obtain the positive expression transgenic wheat. As an example, the selection marker was the pAHC20 empty plasmid.
As an example, the culture mode of the wheat immature embryo callus is as follows: collecting immature seeds 11-15 days after pollination, taking out young embryos after aseptic disinfection, inoculating the young embryos to an MS culture medium, and culturing in the dark at 24-26 ℃. And selecting the young embryo callus with better growth vigor after 7-8 days of dark culture, and carrying out gene gun transformation.
As an embodiment, the method of screening comprises: transferring the wheat immature embryo callus to 1/2MS differentiation and screening culture medium containing 0.8-1mg/L NAA and 0.8-1mg/L KT, transferring to 1/2MS hormone-free growth and screening culture medium after callus is differentiated to form plantlets, transferring the plantlets obtained after screening for a plurality of times to 1/2MS culture medium containing 0.15-0.2mg/L IAA and 0.4-0.5mg/L paclobutrazol for strengthening seedling treatment, and transplanting and identifying. Wherein the screening agent is bialaphos or glyphosate, and the concentration of the screening agent is gradually increased along with the increase of the screening times. For example, from 2 to 3ppm to 4 to 5 ppm. And selecting proper temperature, humidity and illumination environment in the screening process to improve the survival rate of the transgenic plants.
And (3) carrying out RT-PCR detection and identification and VC content determination on the positive transgenic plants obtained by screening. The VC content of the obtained transgenic wheat plant is obviously improved in leaves, stalks or grains compared with that of non-transgenic wild wheat.
The present invention will be described in detail with reference to examples for better understanding the objects, technical solutions and advantages of the present invention, but they should not be construed as limiting the scope of the present invention.
Unless otherwise specified, reference methods and corresponding molecular biological basic procedures used herein are not conventionally known in the art. The reagents used are all commercially available.
Example 1:
extraction of GDP-L-galactose phosphorylase gene
Total RNA of Nicotiana benthamiana was extracted by Trizol method, and then reverse transcription was performed on the extracted total RNA using First Strand cDNA Synthesis Kit ReverTra Ace (TOYOBO) reverse transcription Kit. The amount of RNA was quantified to 1ug/20ul and the reaction was as follows:
| random primer | 1ul |
| Total RNA | x ul(1ug) |
| RNase Free H2O | 11-x ul |
Immediately after 5 minutes at 65 ℃ on ice.
| First step RNA solution | 12ul |
| 5×RT Buffer | 4ul |
| dNTP Mixture | 2ul |
| RNase Inhibitor | 1ul |
| ReverTra Ace | 1ul |
The reaction procedure is as follows: 30 ℃ for 10 min; 42 ℃ for 20 min; 99 deg.C for 5 min; 4 ℃ for 5 min. And (4) performing instant centrifugation after the reaction is finished to obtain the reverse transcription finished Nicotiana benthamiana cDNA.
The reverse transcription was performed to amplify the GDP-L-galactose phosphorylase gene. Designing a primer according to the cDNA of Nicotiana benthamiana:
F:ATGATGCTCAAGATTAAGAGG；
R:GACGGGAACCATGGTAGCATG。
a key gene GDP-L-galactose phosphorylase gene for the synthesis of tobacco vitamin C was subcloned from the reverse-transcribed cDNA using KOD FX (TOYOBO) Hi-Fidelity enzyme.
The PCR procedure was: 95 deg.C for 5 min; 95 ℃ for 30 s; at 58 ℃ for 30 s; 72 ℃ for 1 min; 72 deg.C, 10 min.
The cloning results are shown in FIG. 1.
Example 2:
construction of recombinant expression vectors
The GDP-L-galactose phosphorylase gene cloned in example 1 was PCR-amplified using the following primers and KOD FX enzyme to obtain a GDP-L-galactose phosphorylase amplified fragment.
F:CGACTCTAGAGGATCCATGATGCTCAAGATTAAGAGG；
R:GAGCTCTCTAGACTAGT GACGGGAACCATGGTAGCATG。
The Pwmb190 empty plasmid was double digested with BamH1 (upstream) and spe1 (downstream) and purified to give a linearized vector.
The linearized vector and the amplified fragment were ligated by using Clonexpress II One Step Cloning Kit of Nanjing Novozan to obtain the recombinant plasmid pWMB 190-GGP. The system program is as follows:
37℃，30min。
the plasmid is used after sequencing is successful.
Example 3:
rifle-mediated genetic transformation of wheat
The pWMB190-GGP vector containing GDP-L-galactose phosphorylase gene sequence is transformed into wheat immature embryos by the following brief steps:
(1) collecting immature seeds 11-15 days after pollination (the diameter of a scutellum is about 1cm, the seeds just turn white and have green color, and the embryo part is slightly formed and slightly protruded), carrying out sterile sterilization by using a 10% NaClO solution, taking out immature embryos, inoculating the immature embryos to an MS culture medium, and carrying out dark culture at 24-26 ℃;
(2) selecting young embryo callus with good swelling potential after culturing for 7-8 days in the dark, fixing the young embryo callus at the center of a culture dish containing 0.4M osmotic pressure culture medium, placing about 30-40 young embryos in a circle with the diameter of about 2.5cm, and carrying out osmotic pressure pretreatment for 4-6 hours;
(3) mixing the pWMB190-GGP recombinant plasmid with the pAHC20 no-load plasmid, and wrapping the mixed plasmid with gold powder to prepare a particle bullet;
(4) bombarding the gold powder-coated plasmid into the callus immature embryo pretreated by osmotic pressure by using a PDS 1000/He gene gun (BIA-RAD company), wherein the bombardment condition is as follows: psi 1100, Hg 27.5. Culturing the bombarded callus on an osmotic pressure culture medium for 16-18 h;
(4) transferring the treated callus to SD2 or improved MS culture medium for recovery culture for two weeks;
(5) transferring the callus after recovery culture to 1/2MS differentiation and screening culture medium containing 1mg/L NAA and 1mg/L KT, wherein the concentration of a screening agent PPT (glufosinate-ammonium, Phosphonothricin) is 2-3 ppm, and performing illumination culture at 24-26 ℃;
(6) transferring the callus to 1/2MS hormone-free growth screening culture medium after the callus is differentiated to form seedlings, wherein the concentration of the screening agent PPT is 4-5 ppm, and culturing the seedlings under illumination at 24-26 ℃;
(7) transferring the plantlets obtained after 2-3 times of screening to a 1/2MS (adding 0.2mg/L IAA and 0.5mg/L paclobutrazol) culture medium for strengthening seedlings, and transplanting the plantlets after the seedlings grow to 7-8 cm high and have developed root systems;
(8) placing the transplanted tissue culture seedlings in a low-temperature high-humidity incubator, controlling the temperature at 15-17 ℃ and the humidity at 80% for culturing for a week to improve the transplanting survival rate, and transferring the seedlings to a greenhouse for culturing after the seedlings are returned;
(9)T0collecting leaves after the generation transformation plants grow up, storing at-80 ℃, extracting DNA and RNA of some leaves, storing at-80 ℃ and performing subsequent molecular detection;
(10) total RNA of transgenic wheat is extracted by a Trizol method, and then a common RT-PCR detection and identification mode (primers are F: AACAGGCTCTAGGGGAGGTC; R: CAGGAGAACCTTCAGTGGCA) is carried out to determine transgenic positive plants (figure 2).
Example 4:
VC content determination in positive plants
Collecting leaves, stems and grains of the positive wheat plants and the common wheat plants in the same growth period, and determining and comparing the content of the vitamin C by High Performance Liquid Chromatography (HPLC).
As shown in Table 1 and FIG. 3, the VC content of the positive wheat with NbGGP2 gene is obviously improved compared with the wild wheat without transgene in leaves, stalks or grains. The VC content in the positive transgenic wheat leaves, stems and grains is respectively improved by 2.8 times, 1.9 times and 1.5 times compared with that in common wheat.
TABLE 1 measurement results of VC content in different parts of wheat
| VC content (μ g/g) | Blade | Stalks | Grain |
| Positive transgenic wheat | 12.97±0.93 | 6.15±0.03 | 1.59±0.058 |
| Common wheat | 3.42±0.33 | 2.85±0.026 | 0.64±0.023 |
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Ningbo university
<120> method for improving endogenous VC content of wheat plants
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1311
<212> DNA
<213> Nicotiana benthamiana
<400> 1
atgatgctca agattaagag ggttcctaca cttgtttcca acttccaaaa agaagaggct 60
gaagaaactc ttgctcgtgg tgctggctgt ggccgcaatt gcctccgata ctgctgcctt 120
ccagggtcaa agctgccgct gtatgcttcc aagaatttga gaaagggcaa gtctgttgcc 180
gatgaaacca aggaacctcc tgttgacttc ttggaatccc tccttcttgg ggaatgggag 240
gatcgtcagc agaaaggtct ctttcgctat gatgtcactg cttgcgaaac caaggttatt 300
cctggagaat atggtttcat tgctcaactg aatgagggaa ggcacctcaa gaagaggcca 360
actgagtttc gcgttgataa ggtgctgcag ccttttgatg gaagcaagtt caacttcacc 420
aaagttggtc aggaggagtt gctctttcag tttgaagcaa gtgaggacaa cgatgtccaa 480
ttctttccaa atgcgcccat tgatgccgag aaatctccaa gtgttgttgc catcaatgtc 540
agtcccattg agtacggaca cgtgcttttg atccctaagg tccttgaatg ccttccccag 600
aggatcgaca gggacagctt attgcttgca ctgcaaatgg ctgccgaagc agcaaaccca 660
tacttccgat tgggttataa cagcttgggt gcatttgcta ctatcaacca tcttcacttt 720
caggcttatt acctggctgt gccattcccc atggagaagg cccccactcg gaagattacc 780
tttgctgatg ctggggtgaa gatatctgag atgctgaatt atccagttcg aggccttgtc 840
tttgagggtg gaaatacttt ggaggatttg gccaatgttg tctctggttc ctgcgttttc 900
ctgcaagaga ataacattcc ctacaatgtt ctaatctctg attcggcaaa aagggtattc 960
cttctcccac agtgctatgc agagaaacag gctctagggg aggtcagctc tgaactgctt 1020
gacactcaag tcaatcctgc agtttgggag attagtggac acatggtctt gaagaggaag 1080
gaggattacg agggtgcaac cgaggcaaat gcttggaggc ttctcgctga ggtctcactt 1140
tctgaagcga ggttccaaga agtgacggct ctcatctttg aagccattga ttgcagtgtt 1200
gaggagaatg agaatgccac tgaaggttct cctgagaagc cagatgttgc acctcagcct 1260
atggaggaaa ttgatgctct caacacccat gctaccatgg ttcccgtcta g 1311
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 2
atgatgctca agattaagag g 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 3
gacgggaacc atggtagcat g 21
<210> 4
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 4
cgactctaga ggatccatga tgctcaagat taagagg 37
<210> 5
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 5
gagctctcta gactagtgac gggaaccatg gtagcatg 38
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
aacaggctct aggggaggtc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 7
Claims (10)
1. A method for improving the endogenous VC content of wheat plants is characterized by comprising the following steps: the GDP-L-galactose phosphorylase gene cloned from tobacco is constructed into an expression vector, and then the obtained recombinant expression vector is transformed into wheat immature embryos to screen positive plants.
2. The method of claim 1, wherein: the sequence of the GDP-L-galactose phosphorylase gene is shown in a sequence table SEQ ID NO 1.
3. The method of claim 1, wherein: the method for cloning the GDP-L-galactose phosphorylase gene from the tobacco comprises the following steps: extracting total RNA of Nicotiana benthamiana, carrying out reverse transcription to obtain cDNA, and designing a primer with the cDNA as a template to carry out amplification to obtain the GDP-L-galactose phosphorylase gene.
4. The method of claim 3, wherein: the primer is as follows: ATGATGCTCAAGATTAAGAGG for F and GACGGGAACCATGGTAGCATG for R.
5. The method of claim 1, wherein: the construction method of the recombinant expression vector comprises the following steps: and carrying out double enzyme digestion and purification on the unloaded plasmid to obtain a linearized vector, and connecting the linearized vector with the GDP-L-galactose phosphorylase gene fragment to obtain a recombinant plasmid.
6. The method of claim 1, wherein: the expression vector is pWMB190 or pAHC 25.
7. The method of claim 1, wherein: the transformation is a genetic transformation method of wheat mediated by a gene gun.
8. The method according to claim 1 or 7, characterized in that: the method for transformation comprises the following steps: pretreating the wheat immature embryo callus in a culture medium containing 0.35-0.4M osmotic pressure for 4-6 h, mixing a recombinant vector and a screening marker, bombarding the mixture by using a gene gun to enter the pretreated immature embryo of the callus, and continuously culturing for 16-18 h; the treated callus was transferred to SD2 or modified MS medium for two weeks of recovery culture.
9. The method of claim 1, wherein: the screening method comprises the following steps: transferring the wheat immature embryo callus to 1/2MS differentiation and screening culture medium containing 0.8-1mg/L NAA and 0.8-1mg/L KT, transferring to 1/2MS hormone-free growth and screening culture medium after callus is differentiated to form plantlets, transferring the plantlets obtained after screening for a plurality of times to 1/2MS culture medium containing 0.15-0.2mg/L IAA and 0.4-0.5mg/L paclobutrazol for strengthening seedling treatment, and transplanting and identifying.
10. The method of claim 9, wherein: the screening agent is bialaphos or glyphosate, and the concentration of the screening agent is gradually increased along with the increase of the screening times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110552456.9A CN113234752A (en) | 2021-05-20 | 2021-05-20 | Method for improving endogenous VC content of wheat plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110552456.9A CN113234752A (en) | 2021-05-20 | 2021-05-20 | Method for improving endogenous VC content of wheat plant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113234752A true CN113234752A (en) | 2021-08-10 |
Family
ID=77137905
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110552456.9A Pending CN113234752A (en) | 2021-05-20 | 2021-05-20 | Method for improving endogenous VC content of wheat plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113234752A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100077503A1 (en) * | 2007-03-08 | 2010-03-25 | The New Zealand Institute For Plant And Food Research Limited | Transferases, Epimerases, Polynucleotides Encoding These and Uses Thereof |
| CN103249836A (en) * | 2010-09-24 | 2013-08-14 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-elated traits and method for making the same |
| CN107164291A (en) * | 2017-06-24 | 2017-09-15 | 上海市农业科学院 | A kind of method that utilization plant vitamin C route of synthesis builds production vitamin C coli strain |
-
2021
- 2021-05-20 CN CN202110552456.9A patent/CN113234752A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100077503A1 (en) * | 2007-03-08 | 2010-03-25 | The New Zealand Institute For Plant And Food Research Limited | Transferases, Epimerases, Polynucleotides Encoding These and Uses Thereof |
| CN103249836A (en) * | 2010-09-24 | 2013-08-14 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-elated traits and method for making the same |
| CN107164291A (en) * | 2017-06-24 | 2017-09-15 | 上海市农业科学院 | A kind of method that utilization plant vitamin C route of synthesis builds production vitamin C coli strain |
Non-Patent Citations (7)
| Title |
|---|
| ADEBANJO A. BADEJO: "Genetic Manipulation for Enhancing Vitamin C Content in Tobacco Expressing Acerola (Malpighia glabra) GDP-L-galactose phosphorylase Gene", 《HORTICULTURE ENVIRONMENT AND BIOTECHNOLOGY》 * |
| RONAN C. BROAD: "Genome-wide identification and characterization of the GDP-L-galactose phosphorylase gene family in bread wheat", 《BMC PLANT BIOLOGY》 * |
| 佚名: "LOCUS XM_016651960", 《NCBI GENBANK》 * |
| 张书轩: "三种植物生长调节剂对刺梨果实维生素C积累及其代谢基因表达的影响", 《农业生物技术学报》 * |
| 李巧峡: "《发育生物学实验指导》", 31 August 2019, 甘肃科学技术出版社 * |
| 禄亚洲等: "棉花GhGGPase2基因克隆、功能序列分析、原核表达及烟草的遗传转化", 《江苏农业科学》 * |
| 郭新波等: "高等植物维生素C和维生素E代谢调控", 《植物生理学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hao et al. | Transformation of a marker-free and vector-free antisense ACC oxidase gene cassette into melon via the pollen-tube pathway | |
| CN101812124B (en) | Plant stress-resistance-associated protein TaSnRK2.8, coding genes and application thereof | |
| CN112301036B (en) | Gene OsABCG38 for regulating and controlling rice cadmium accumulation and encoding protein and application thereof | |
| CN102220297B (en) | Stress resistance associated protein TaSnRK2.3 and coding gene and use thereof | |
| CN110872598A (en) | Cotton drought-resistant related gene GhDT1 and application thereof | |
| CN111187778A (en) | Wheat salt-tolerant gene TaFLZ2 and application thereof | |
| CN109762828B (en) | Apple fruit hexose transporter gene MdHT2.2 and application thereof | |
| CN112280786A (en) | Herbicide-tolerant corn with HH2823 transformation event with high nutrient utilization efficiency and specificity identification method and application thereof | |
| CN101492498B (en) | Plant stress-resistant associated protein, encoding gene TaERECTA and uses | |
| US20130174299A1 (en) | Method for production of stolon-forming plant having improved tuber production ability or stolon production ability compared with wild type, and stolon-forming plant produced by the method | |
| CN113234752A (en) | Method for improving endogenous VC content of wheat plant | |
| NL2027897B1 (en) | Use of gmaap protein and gmaap gene in breeding soybeans | |
| CN103911386A (en) | Artificial fusion gene for improving stress tolerance of plants | |
| CN106520723A (en) | Protein VvMas and encoding gene, and application thereof in improvement of salt tolerance of plants | |
| CN115011630B (en) | Application of tomato SlGID1L2 gene in regulation and control of drought tolerance of tomatoes and cultivation of drought tolerance tomatoes | |
| CN113337527B (en) | Wheat grinding synthetase THI1 gene and application thereof in plant resistance to Chinese wheat mosaic virus | |
| CN113604475B (en) | Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN112251439B (en) | Arabidopsis thaliana high-temperature induction promoter pHTG1 and recombinant vector thereof | |
| CN110760522B (en) | AK209 gene and its coded protein and application in resisting stress and increasing yield | |
| CN112521470B (en) | Plant starch synthesis related protein OsFLO18, and coding gene and application thereof | |
| CN111235167B (en) | Gene for coding spatholobus stem anthocyanin reductase and application thereof | |
| Wang et al. | The β-1, 4-glucanase gene EuEG1 overexpression improve in vitro micrografting of Eucommia ulmoides | |
| CN116200413A (en) | Soybean low phosphorus resistance related gene GmACP17a, encoding protein and application thereof | |
| CN106191106B (en) | VvSUC27 gene is promoting the application in the extraneous sucrose of plant intake |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |