CN101812124B - Plant stress-resistance-associated protein TaSnRK2.8, coding genes and application thereof - Google Patents

Abstract

The invention discloses a plant stress-resistance-associated protein TaSnRK2.8, coding genes and application thereof. The protein adopts 1) a protein consisting of an amino acid sequence shown by a sequence 2 in a sequence table; and 2) a protein which is derived from 1), is associated with plant stress resistance and is formed by substitution and/or deletion and/or addition of one or more amino acid residues in an amino acid residue sequence of the sequence 2 in the sequence table. Experiments show that the genes can be introduced into plants cells to improve the plant stress resistance, such as drought resistance and water conservation, salt resistance or cold resistance, so the genes and the application thereof have quite important practical significance for cultivating a new variety with drought resistance and water conservation, salt resistance or cold resistance.

Description

The albumen TaSnRK2.8 of the anti-retrocorrelation of plant and encoding gene and application

Technical field

The present invention relates to biological technical field, particularly a kind of albumen and encoding gene and application of and the anti-retrocorrelation of plant.

Background technology

Drought and water shortage is the serious problems that global agriculture production faces, and also is the important factor of restriction China grain-production development.The cultivation of staple food crop wheat needs a large amount of water, 1 ton of about 500-700m of wheat water requirement of the average every production of China ³Whole world developing country has at least 6,000 ten thousand hectares of wheat cultivations to support the arable land at rain, but its yield level has only the 10%-50% under the irrigation conditions.So development resisting drought saving water wheat breed to improve the water use efficiency of crop, both can increase output, can alleviate the contradiction of shortage of water resources again.

The improvement crop drought resistance is significant for improving agricultural productive force, is subjected to the great attention of countries in the world, and the great special project of genetically modified crops rearing new variety of China's startup in the recent period is exactly best real example.The drought resistance mechanism of research plant, clone's gene related to drought tolerance, be an effective way of cultivating the drought-resistant crops new variety by genetically engineered improvement crop drought resistance.Though the drought resistance hereditary basis complexity of crop, the new variety difficulty that the drought resistance that obtains clone, conversion anti-drought gene obviously improves is bigger, but joint efforts through numerous scientists, obtained certain progress, many successful examples have been emerged in large numbers, as (Molecular Breeding, 2002 such as Cheng, 10:71-82) the lea protein gene of wheat is imported paddy rice, drought resisting, the salt tolerance of transfer-gen plant are significantly improved; WU etc. (ChineseScience Bulletin, 2003,48:2594-2600) δ-OAT gene with Arabidopis thaliana changes overexpression in the paddy rice over to, and proline content obviously increases in the transfer-gen plant, and drought resisting and salt tolerance obviously strengthen; Dubouzet etc. (PlantJ, 2003,33:751-763) with behind the paddy rice transcription activating protein gene OsDRE1A importing Arabidopis thaliana, transfer-gen plant has showed strong drought resistant, anti-salt and cold resistant property.Hu etc. import to the OsNAC1 gene in the paddy rice, and the drought resistance of transgenic progeny is obviously strengthened, and do not influence offspring's output (Hu etc. 2006, Proc Natl Acad Sci USA, 10:71-82).

At present, the gene related to drought tolerance of having cloned mainly wraps two big classes, the first kind is a functional gene, this genoid comprises synthesis related genes such as low molecular weight soluble sugar, amino acid and small protein, and the enzyme of protecting cell to avoid damaging, as the synthetic relative enzyme gene of proline(Pro), comprise pyrroline-5-carboxylic acid synthetase gene P5CS and PVAB2, pyrroles's beautiful jade-5-carboxylate reductase gene P5CR etc.; Late embryo generation Abundant protein (LEA), and wheat lea protein gene (Ingram etc. 1996, Annual Review of Plant Physiology and Plant Molecular Biology, 47:377-403).

Second class is a regulatory gene, comprises the gene that various participation water stress signals transmit, mainly comprise (1) participate in the crucial enzyme of signaling molecule synthetic such as ABA, ethene (Bray 1997, Trends in Plant Science, 2:48-54); (2) transcription factor (Soderman etc. 1996, Plant J, 10:375-381), (Wang etc. 2008, Plant Mol Biol 67:589-602 as DREB; Agarwal etc. 2007, Mol Genet Genomics 277:189-198; Chen etc. 2007, Biochem Biophys Res Commun 353:299-305; Maruyama etc. 2004, Plant J 38:982-993; Dubouzet etc. 2003, Plant J, 33:751-763), (Yu etc. 2008 for NF-YB1, Plaht Cell, 20:1134-1151), (Nelson etc. 2007, Proc NatlAcad Sci USA for HD-ATART, 104:16450-16455), OsNAC1 (Hu etc. 2006, Proc Natl Acad Sci USA, 10:71-82) etc.; (3) phosphoprotein phosphatase, as protein phosphatase 2A and 2C etc., (Kwak etc. 2002, Plant Cell, 14:2849-2861 in the transmission of their participation ABA signals; Leung etc. 1997, Plant Cell, 9:759-771; Merlot etc. 2001, Plant J, 25:295-303; Sheen 1998, Proc Natl Acad SciUSA, 95:975-980).(4) protein phosphatase kinases, vegetable-protein kinases family very, (Knetsch etc. 1996 mainly to comprise mitogen activated protein kinase (MAPK), Plant Cell, 8:1061-1067), (Li etc. 1996 for calcium dependent protein kinase (CDPK), Plant Cell, 8:2359-2368; Sauer etc. 2004, J Exp Bot, 55,181-188; Sheen 1996, Science, 274:1900-1902) (SNF1 (sucrose non-fermenting) related protein kinase, SnRK), wherein SnRK is the protein kinase of the participation of discovery in the recent period to various adverse circumstances reactions with the non-fermentation related protein kinase of sucrose.

SnRK family is very huge, and according to its sequence similarity and structural domain characteristics, SnRK family can be divided into 3 subfamily: SnRK1, SnRK2 and SnRK3, and wherein SnRK1 extensively is present in animals and plants and the microorganism.Studies show that SnRK1 mainly participates in the interior response to nutritive deficiency of organism, and SnRK2 and SnRK3 are the plant specific protein kinases.At present, people are relatively many to the research of SnRK3 subfamily, and are wherein particularly thorough to the SOS2 among SnRK3 member research, SOS2 a kind of Na that encodes ⁺/ H ⁺Translocator, this albumen can be regulated the balance of the inside and outside sodium of vegetable cell, potassium ion, and its overexpression can strengthen the salt tolerance of transfer-gen plant, and (Gong etc. 2002, Plant Physiol, 130:256-264; Kelner etc. 2004, Plant Physiol, 136:3255-3265).In addition, it is found that 4 SOS2 albuminoid kinases, participated in reaction that difference is coerced respectively, (Gong etc. 2002 may to participate in induction to sugar as PKS11, J Biol Chem, 277:28340-28350), (Gong etc. 2002, Plant Physiol for the transmission of PKS6 and PKS18 participation ABA signal, 129:225-34), AtCIPK1/PKS13 regulate tolerance to salt (Kim etc. 2007, Plant J, 52:473-484).Wheat SnRK3 member WPK4 is subjected to light, phytokinin and cryogenic inducing, and (Ikeda etc. 1999, Plant Physiol, 121,813-820 by the sucrose inhibition; Sano etc. 1994, Proc Natl Acad Sci USA, 91:2582-2586).

People start late to SnRK2 family research, are subjected to the osmotic stress abduction delivering but more and more evidences shows the most member of this family, and part member also participates in the transmittance process of ABA signal, and (Boudsocq etc. 2004, J Biol Chem, 279:41758-41766; Boudsocq etc. 2007, Plant Mol Biol, 63:491-503; Kobayashi etc. 2004, Plant Cell, 16:1163-1177).Boudsocq has cloned 10 SnRK2 members in Arabidopis thaliana, find that 9 members wherein are subjected to height to blend inducing of salt stress, 5 participations are to the response of ABA, wherein OST1/SRK2.5 and lineal homologous gene Vicia faba AAPK thereof participate in the regulating and controlling of stomatal closure that ABA is regulated (Li etc. 2000, Science, 287:300-303; Mustilli etc. 2002, Plant Cell, 14:3089-99; Yoshida etc. 2002, Plant Cell Physiol, and 43:1473-1483), overexpression SnRK2.8 and SnRK2.3 can strengthen the drought resistance of transfer-gen plant (Shin etc. 1999, Plant Cell, 11:2393-405; Umezaw etc. 2004, Proc Natl Acad Sci USA, 101:17306-17311).Kobayashi etc. are separated to 10 SnRK2 members in paddy rice, be referred to as to coerce activated protein kinase (Stress Activated Protein Kinase, SAPK), studies show that these 10 members participate in replying osmotic stress, wherein 3 are subjected to ABA to induce that (Boudsocq etc. 2004, Plant Cell, 16:1163-1677).Huai etc. have cloned 9 SnRK2 members in corn, find that different members replys difference (Huai etc., 2008Plant Cell Rep.27:1861-18) to environment stress.This family member SAPK4 of overexpression can obviously strengthen transfer-gen plant salt tolerance (Diedhiou etc. 2008, BMCPlant Biol, 8:49).In soybean, people are separated to 4 SnRK2 members, SPK1, SPK2, SPK3 and SPK4, and its expression is induced by osmotic stress all, and what wherein SPK3 also was subjected to Exogenous ABA induces that (Monks etc. 2001, PlantCell, 13:1205-1219; Yoon etc. 1997, Mol Gen Genet, 255:359-371).Gomez-Cadenas etc. have cloned 1 SnRK2 family member PKABA1 in wheat, this gene be subjected to the inducing of ABA and high osmotic stress (Proc Natl Acad Sci USA, 1999,96:1767-1772), and except that PKABA1, rarely have the report of wheat SnRK2 gene family.

Summary of the invention

The purpose of this invention is to provide a kind of albumen relevant and encoding gene thereof with stress resistance of plant.

The albumen relevant with stress resistance of plant provided by the present invention, called after TaSnRK2.8 derives from common wheat (Triticum aestivum L.), is following 1) or 2) protein:

1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;

2) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with stress resistance of plant by 1) deutero-protein.

Sequence table sequence 2 is the aminoacid sequence of TaSnRK2.8, comprises 366 amino acid, in this protein sequence, hydrophobic amino acid accounts for 116, and hydrophilic amino acid accounts for 84, and basic aminoacids accounts for 39, acidic amino acid accounts for 60, and this proteinic molecular weight is 41.6KD, and iso-electric point is 4.77.This protein is the new protein of not reported in the world.

In order to make 1) in TaSnRK2.8 be convenient to purifying, label as shown in table 1 on proteinic N-terminal that can the aminoacid sequence shown in the sequence 2 is formed in by sequence table or C-terminal connect.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	?RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag?II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned 2) but in the TaSnRK2.8 synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.Above-mentioned 2) encoding gene of the TaSnRK2.8 in can be by lacking sequence in the sequence table 1 codon of one or several amino-acid residue in the dna sequence dna shown in the 5 ' terminal 61-1161 bit base, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Above-mentioned and cDNA gene plant adversity resistance related protein also belongs to protection scope of the present invention.

Specifically can be following 1 with the cDNA gene of plant adversity resistance related protein)-5) in arbitrary described gene:

1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 61st the-the 1161st deoxyribonucleotide;

2) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 11st the-the 1166th deoxyribonucleotide;

3) its nucleotide sequence is the sequence 1 in the sequence table;

4) under the rigorous condition of height with 1) or 2) gene recombination and the described proteic gene of coding claim 1 that limit;

5) with 1) or 2) gene that limits has the homology 90% or more and the described proteic gene of claim 1 of encoding.

Sequence 1 in the sequence table is by 1431 based compositions, comprises the ORF district of 5 ' UTR, 1101bp of 60bp and 3 ' UTR of 270bp; Wherein open reading frame (ORF) is from 5 ' terminal 61-1161 bit base, and this open reading frame is 1101bp, and coding has the TaSnRK2.8 albumen shown in the sequence 2 in the sequence table.

The rigorous condition of above-mentioned height can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized under 65 ℃ and washed film with 0.1 * SSPE in DNA or RNA hybrid experiment.

Contain above-mentioned transgenic cell line, reorganization bacterium or expression cassette and also belong to protection scope of the present invention with the plant adversity resistance related protein encoding gene.

Contain above-mentioned and the recombinant vectors plant adversity resistance related protein encoding gene and also belong to protection scope of the present invention.

Available existing plant expression vector construction contains the recombinant expression vector of gene of the present invention.Described plant expression vector comprises the double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment, as pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN, pPZP211 or other plant expression vector of deriving.

When using the gene constructed recombinant expression vector of TaSnRK2.8, can before its transcription initiation Nucleotide, add any enhancement type, composing type, organizing specific type or inducible promoter, as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin (Ubiquitin) gene promoter (pUbi) etc., they can use separately or be used in combination with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of transgenic plant cells or plant being identified and screening, can process used plant expression vector, as be added in the plant to express and to produce the enzyme of colour-change or the gene of luminophor (gus gene, GFP gene, luciferase genes etc.), have the antibiotic marker thing (gentamicin marker, kantlex marker etc.) of resistance or anti-chemical reagent marker gene (as anti-weedkiller gene) etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.

Described recombinant vectors is the recombinant expression vector that constitutes between the Kpn I of above-mentioned gene insertion binary vector pCH3-GFP and the Sal I site; Described binary vector pCH3-GFP inserts the carrier that constitutes between the Sal I of pCHF3 and Pst I site with Genbank number for the nucleotide sequence of BAG13014; Described pCHF3 inserts the carrier that constitutes between the NcoI of pPZP211 and the EcoR V site with Genbank number nucleotide sequence from shown in 5 ' the end 1035-1815 position for AB303068.

Another object of the present invention provides a kind of method of cultivating the gene plant of anti-the reverse.

The method of the cultivation gene plant of anti-reverse the provided by the present invention is that the encoding gene TaSnRK2.8 with plant adversity resistance related protein is imported the purpose plant, obtains the transgenic plant that resistance of reverse is better than described purpose plant.

Described is to import in the purpose plant by described recombinant vectors with encoding gene TaSnRK2.8 plant adversity resistance related protein.

Conventional biological methods such as the plant expression vector that carries of the present invention and plant adversity resistance related protein encoding gene TaSnRK2.8 can lead by Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity, agriculture bacillus mediated are transformed in vegetable cell or the tissue.By the plant transformed host both can be farm crop such as paddy rice, wheat, soybean, tobacco, corn, rape, Chinese sorghum, cotton, also can be fruits and vegetables flower plants such as herbages such as clover, trifolium, wheatgrass and strawberry, tomato.

The above-mentioned gene plant of anti-the reverse is drought-resistant and/or the salt tolerant transgenic plant.

The inventive method to monocotyledons or dicotyledons all can, monocotyledons specifically can be wheat, dicotyledons specifically can be Arabidopis thaliana.

Experiment showed, in the gene transfered plant of the present invention, improved the resistance of plant, as drought resistance and/or salt resistance, under drought condition, the survival rate that changes the plant of gene of the present invention over to is 10-70%, and does not change all death of wild-type plant of gene of the present invention over to.Gene pairs unifacial leaf of the present invention, dicotyledons all are suitable for simultaneously.Therefore, gene of the present invention and application thereof have great importance to cultivation resisting drought saving water, anti-salt new crop varieties, are suitable for applying.

Description of drawings

Fig. 1 is the expression of TaSnRK2.8 after being subjected to water stress, high salt, low temperature and ABA processing.

Fig. 2 is the expression of TaSnRK2.8 in different wheat organs.

Fig. 3 is for changeing TaSnRK2.8 Arabidopis thaliana positive plant RT-PCR detected result.

Fig. 4 is the drought resisting qualification result of transgenic arabidopsis.

Fig. 5 is the anti-salt qualification result of transgenic arabidopsis.

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

Embodiment 1, TaSnRK2.8 gene

Make up the full-length cDNA library of wheat, according to document (Mao Xinguo etc., 2005, make up with improved Cap-trapper method and to intend this inferior that and take off goatweed full-length cDNA library. Acta Genetica Sinica, 32 (8): method 811-817) is carried out:

1) total RNA extracts and the mRNA purifying, extracts total RNA of wheat (drought is selected No. 10) with TRIZOL, with oligo (dT) Mierocrystalline cellulose separation and purification mRNA.

2) the first chain cDNA's is synthetic: get the mRNA that obtains in the 10ug step 1) and mix with primer I (as shown in table 2), add the first chain cDNA synthetic reagent after the sex change, when temperature is raised to 40 ℃, add ThermoScript II, when proceeding to 40 minutes, reaction adds primer I I (as shown in table 2).For obtaining more full-length cDNAs, when first chain is synthetic, in reaction system, add trehalose and mountain plough sugar alcohol; Be the length of restriction poly (A) tail, so that large scale sequencing substitutes traditional single primer oligo (dT) with mix primer (primer I) ₁₈Reaction finishes the back and removes carbohydrate with the CTAB-UREA method, precipitation cDNA/RNA.

Table 2, the first chain cDNA synthetic primer

3) add sodium periodate solution in reaction tubes sodium periodate oxidation: to above-mentioned steps 2), oxidation RNA uses the glycerine termination reaction.

4) biotin labeling: the centrifugal collection above-mentioned steps 3) cDNA/RNA of meso-periodic acid sodium oxidation, clean, dry again dissolving after, add the Biotin-hydrzide of fresh configuration, 23 ℃ of incubation 14～16h use the Trisodium Citrate termination reaction.

5) RNase I digestion: behind sodium periodate oxidation, mRNA 5 ' and 3 ' holds that adjacent glycol group is oxidized into the dialdehyde group on the last bit base ribose, they can with the vitamin H combination.When the magnetic bead of later-stage utilization Streptavidin bag quilt separated full-length cDNA, the vitamin H of mRNA 3 ' end also can combine with magnetic bead.For obtaining the complete cDNA of 5 ' end, must specifically the vitamin H of 3 ' end mark be removed.Eukaryote mRNA 3 ' end poly (A) length is generally at 100～250bp, when synthesizing the first chain cDNA, with the limitation of length of poly (A) 16 bases, therefore mRNA 3 ' end poly (A) will exist with the form of strand in the cDNA/RNA complex body, therefore can be with RNaseI with its special removing.

6) full-length cDNA catch and strand cDNA discharges: with the tRNA of the no DNA pollution magnetic bead (Dynalbead M-280) of blockading, allow cDNA/RNA and magnetic bead in conjunction with 20min under the room temperature, usefulness NaOH-EDTA wash-out cDNA/RNA earlier.

7) terminal enzyme (DNA) tailing: collect strand cDNA, add terminal transferase reaction reagent after the sex change, 37 ℃ were reacted termination reaction 9 minutes.

8) the second chain cDNA's is synthetic: collect the strand cDNA that obtains in the step 7), with the synthetic second chain cDNA of LA-Taq.After question response finished, electrophoresis reclaimed the cDNA greater than 1kb.

9) enzyme Bsa I belongs to two class restriction enzymes, and its restriction enzyme site just in time is in first base place in recognition site downstream, and enzyme cuts and do not have base specific, but to the cytosine methylation sensitivity of recognition site.The DNA that cuts through the BsaI enzyme will produce the outstanding cohesive terminus of 4 bases.According to these characteristics, when design of primers, introduced Bsa I, EcoR I and Xho I site, wherein in first strand primer Bsa I and Xho I site, in second strand primer Bsa I and EcoRI site.By taking these measures, only cDNA is carried out single enzyme and cut with Bsa I, just can realize the directed cloning of cDNA.

10) connect, pack and insert fragment and detect: the purpose cDNA fragment after the collection classification is dissolved in ddH again ₂Among the O, detect cDNA concentration, determine the concentration of cDNA after, get an amount of cDNA and be connected with carrier Un iZAP II (available from Stratagene) and spend the night.After the packing, infect host bacterium XL1-Blue, detect titre.

11) plasmid extracts and sequencing output, repetitive proteins enzyme K digestion then, and behind step such as the phenol/chloroform extraction amplified library, getting a certain amount of amplification library, to be used for the phasmid ring rapid, at last cDNA placed the ethanol precipitation to spend the night.Cyclisation detects the phasmid titre, and the phasmid of getting at last after an amount of cyclisation infects the SOLR host cell.

12) the host cell spread plate that phasmid was infected, 37 ℃ of overnight incubation.The picking positive colony extracts plasmid, order-checking in 96 well culture plates immediately, makes up the Wheat Full-length cDNA database.

With paddy rice SAPK8 (AB125309) is source sequence, search Wheat Full-length cDNA database, obtain candidate clone, order-checking obtains target clone's full length sequence, its sequence is in the sequence table shown in the sequence 1, and the sequence total length is 1431bp, and it is 5 ' UTR (60bp) from 5 ' terminal 1-60 position Nucleotide, 61-1161 position Nucleotide is open reading frame (1101bp), and 1162-1431 position Nucleotide is 3 ' UTR (270bp).

The abduction delivering analysis of embodiment 2, TaSnRK2.8 gene

One, the situation of replying of the different environment stresses of TaSnRK2.8 gene pairs

(drought is selected No. 10, and the public can obtain from national germplasm storehouse, numbering: ZM9279) be experiment material with the drought resisting wheat.

Select full seed, drought resisting wheat seed of the same size, be placed in the illumination box, 20 ℃, 12h/d cultivation, water planting to a leaf wholeheartedly carries out environment stress then and handles.Water stress: remove the moisture in the culture dish, add PEG-6000 (osmotic potential is-0.5MPa) aqueous solution; High-salt stress: remove the moisture in the culture dish, add the 250mM NaCl aqueous solution; Low temperature stress: directly culture dish is moved to 4 ℃ of illumination boxs and cultivate; Exogenous aba treatment: adopt 50 μ M ABA solution to spray all moistening until blade.Coerce 0,1,3,6,12,24,48 and the 72h collection blade of processing respectively in difference, liquid nitrogen flash freezer ,-70 ℃ of preservations are standby.Contrast adopts deionized water to cultivate always.

Extract the total RNA of wheat with TRIZOL, with the synthetic first chain cDNA (Invitrogen) of MMLV reverse transcription test kit, (Real-time Quantitative PCR, method qRT-PCR) detects the response condition of gene TaSnRK2.8 to various environment stresses to adopt real-time quantitative PCR.With the Tubulin gene of constitutive expression as confidential reference items, the primer (as shown in table 3) of design qRT-PCR.

Table 3, qRT-PCR primer

The formula that proposes according to Livak and Schmittgen calculates: the expression amount of TaSnRK2.8 gene under 4 kinds of processing is N times of contrast, N=2 ^{-△ △ CT}, △ △ CT=(CT _{(Target, Time x)}-CT _{(Tubulin, Time x)})-(CT _{(Target, Time 0)}-CT _{(Tubulin, Time 0)}).

Wherein, the implication of CT value is: the cycle number that the fluorescent signal in each reaction tubes is experienced when arriving the thresholding of setting.When PCR circulates in the cycle number that arrives CT value place, just entered the real index amplification phase (logarithmic phase), this moment, slight error was not amplified as yet, so the circulation ratio of CT value is fabulous, be amplification in same template different time amplification or the same asynchronism(-nization) pipe, the CT value that obtains is a constant.

The treatment time point that time x representative is different; The zero point that time 0 representative is handled; CT _{(Target, Time x)}For handling x during the time, TaSnRK2.8 expression of gene amount in the wheat through coercing; CT _{(Tubulin, Time x)}For handling x during the time, Tubulin expression of gene amount in the wheat through coercing; CT _{(Target, Time 0)}When handling for not beginning to coerce, TaSnRK2.8 expression of gene amount in the wheat; CT _{(Tubulin, Time 0)}When handling for not beginning to coerce, Tubulin expression of gene amount in the wheat.

3 repetitions are established in experiment, and the result takes the mean, and the result is (A is the TaSnRK2.8 gene relative expression quantity of the different time sections of ABA processing among Fig. 1, and B is that NaCl handles, and C is that PEG handles, and D is a subzero treatment) as shown in Figure 1.Relative expression quantity is the N value.The result shows that TaSnRK2.8 participates in replying PEG, NaCl, low temperature and ABA.

Two, the TaSnRK2.8 gene is at the expression amount of wheat different development stage

Selecting No. 10 with drought is experiment material.

Respectively with root, the leaf of water planting seedling, the big Tanaka's normal growth wheat during jointing stage lobus cardiacus and the young fringe at heading stage are material, extract total RNA, with the synthetic first chain cDNA of MMLV reverse transcription test kit, adopt the method for qRT-PCR to detect the expression of TaSnRK2.8 gene in the different tender tissues of different development stage, used primer sequence is consistent with the primer of table 3 in the above-mentioned steps one.

3 repetitions are established in experiment, and the result is (with the benchmark that is expressed as in the seedling phase leaf, other developmental stage and other tissue are relative expression quantity than the expression of gene level in the seedling leaf) as shown in Figure 2.The result shows that than higher, stem takes second place TaSnRK2.8 at the wheat root expression amount, and the expression amount in blade and young fringe is lower.

The preparation and the resistance check and analysis thereof of embodiment 3, commentaries on classics TaSnRK2.8 gene plant

One, changes the acquisition of TaSnRK2.8 gene Arabidopis thaliana

1, preparation contains the recombinant expression vector of TaSnRK2.8 gene

With pPZP211 is initial carrier (GI:506685), between the NcoI of pPZP211 and EcoR V site, insert CaMV 35S promoter (CaMV 35S promoter sequence be Genbank number be 1035-1815 position Nucleotide in the sequence of AB303068), obtain intermediate carrier pCHF3, between the Sal of pCHF3 I and Pst I site, insert the open reading frame of GFP (Genbank number is BAG13014) then, finally obtain binary vector pCH3-GFP.

Design primer according to gene TaSnRK2.8 full length sequence:

Upstream primer F1:gaga GGTACCAGCCCTATCGGCCGCG (underscore partly is Kpn I site),

Downstream primer R1:gaga GTCGACATGGCTCACATCGCATACACG (underscore partly is Sal I site).Wherein downstream primer 3 ' end is positioned at the upstream of gene terminator codon.

Extract the mRNA of wheat (drought is selected No. 10), with above-mentioned primer (upstream primer F1 and downstream primer R1), adopt high-fidelity enzyme Pfu amplification target gene, amplified production is carried out enzyme with restriction enzyme Kpn I and Sal I to be cut, reclaim the target gene fragment, order-checking shows: sequence 1 holds the 11-1166 position from 5 ' in segmental nucleotide sequence of target gene such as the sequence table.Cut binary vector pCH3-GFP with restriction enzyme Kpn I and Sal I enzyme, reclaim the purpose carrier segments; The target gene fragment of above-mentioned recovery is connected with the purpose carrier segments, and screening is through identifying the positive recombinant vectors called after pCH3-TaSnRK2.8/GFP from 5 ' end 11-1166 position Nucleotide that contains sequence 1 in the ordered list that will obtain.Wherein, the albumen shown in the sequence 2 in the Nucleotide codified sequence table shown in 5 ' the end 61-1161 position of sequence 1 in the sequence table is with albumen called after TaSnRK2.8, with the encoding gene called after TaSnRK2.8 of TaSnRK2.8.

2, change the acquisition of TaSnRK2.8 gene Arabidopis thaliana

The positive recombinant vectors pCH3-TaSnRK2.8/GFP that obtains in the above-mentioned steps 1 is utilized agrobacterium mediation method, forward gene TaSnRK2.8 in the Arabidopis thaliana (Clumbia type, the public can buy from Ohio State Univ-Columbus USA's Arabidopis thaliana germplasm resource bank).

With the MS substratum screening transfer-gen plant that is added with kantlex, TaSnRK2.8-GFP Expression of Fusion Protein situation in the observation Arabidopis thaliana young root under fluorescent microscope.

Select numerous kind of the higher transgenic line of fusion protein expression, add generation according to the power of fluorescence, obtain 17 positive transgenic lines, these 17 positive strains systems are detected through RT-PCR (the used primer of the primer and structure conversion carrier is consistent: F1, R1), (M is marker among Fig. 3, and CK+ is a positive plasmid, and CK-is the water contrast for result such as Fig. 3, L1-L17 is that positive strain is) shown in, 17 positive strains are all can amplify the purpose band.

Wherein carrying out following resistance with these 6 positive transgenic lines of L1, L2, L3, L4, L5 and L6 detects.

Two, resistance check and analysis

With the wild-type Arabidopis thaliana (Columbia type) that does not change any carrier over to, the Arabidopis thaliana (Columbia type) that changes empty carrier pCH3-GFP over to is contrast.

1, drought resistance is identified

The cultivating soil (vermiculite and ratio humous are 1: 1) that claims equivalent is in the square plastic alms bowl.Water after saturated, the Arabidopis thaliana seedling (comprise transgenic line, wild-type contrast, change the empty carrier contrast) of 7 ages in days is transplanted in the vinyl disc, the control water planting is supported under 22 ℃, 12h illumination/d, relative humidity 70% condition.Each transgenic line 10 strain.

Control water to the Arabidopis thaliana of wild-type Arabidopis thaliana and commentaries on classics empty carrier is seriously wilted (30 days), and rehydration was taken a picture after the rehydration and the statistics survival rate on the 3rd day then.

Photo as shown in Figure 4, the drought resistance of the Arabidopis thaliana of transgene TaSnRK2.8 is significantly better than wild-type and change pCHF3-GFP carrier Arabidopis thaliana (among Fig. 4, WT represents wild-type, and L1～L6 is 6 changes TaSnRK2.8 gene strain system, and CK is for changeing the contrast of pCHF3-GFP carrier).The 3rd day statistics survival rate after the rehydration, 3 repetitions are established in test, repeat 10 strain seedling at every turn.

The survival rate statistics of table 4. drought resistance experiment

WT

CK

L1

L2

L3

L4

L5

L6

Survival strain number

0

0

1.3±0.6

3.3±0.6

4.7±0.6

6.0±1.0

7.0±1.0

7.3±0.6

Survival rate (%)

0

0

13

33

47

60

70

73

2, salt resistance is identified

The cultivating soil (vermiculite and ratio humous are 1: 1) that claims equivalent is transplanted to the Arabidopis thaliana seedling (comprise transgenic line, wild-type contrast, change the empty carrier contrast) of 7 ages in days in the vinyl disc in the square plastic dish.With the NaCl solution pouring of 300mM, the degeneration-resistant situation of pouring back observation in the 5th day transfer-gen plant is also taken a picture after 3 weeks.The photo result as shown in Figure 5, the salt resistance of the Arabidopis thaliana of transgene TaSnRK2.8 is significantly better than wild-type and change pCHF3-GFP carrier Arabidopis thaliana (among Fig. 4, WT represents wild-type, and L1～L6 is 6 changes TaSnRK2.8 gene strain system, and CK is for changeing the contrast of pCHF3-GFP carrier).3 repetitions are established in test, repeat 10 strain seedling at every turn, the survival rate of statistics transfer-gen plant after 10 days.

The survival rate statistics of table 5. salt resistance experiment

WT

CK

L1

L2

L3

L4

L5

L6

Survival strain number

0.6±0.6

0.3±0.6

8.3±0.6

8.7±0.6

8.0±1.0

8.3±0.6

8.0±1.0

8.7±0.6

Survival rate (%)

6

3

83

87

80

83

80

87

Sequence table

＜110〉Institute of Crop Science, Chinese Academy of Agricultural Science

＜120〉the albumen TaSnRK2.8 of the anti-retrocorrelation of plant and encoding gene and application

 

<130>CGGNARL102145

 

<160>2

 

<210>1

<211>1431

<212>DNA

＜213〉Triticum common wheat (Triticum aestivum L.)

 

<400>1

ggggaaaccg?agccctatcg?gccgcggggc?ccctccatcg?accgccagtc?gccgccggcc 60

atggcagggg?cggcgccgga?tcgggcggcg?ctgacggtcg?gcccgggcat?ggacatgccg 120

atcatgcacg?acagcgaccg?ctacgagctg?gtgcgggaca?tcggctccgg?caacttcggc 180

gtcgcccgac?tcatgcgcga?ccgccgcacc?atggagctcg?tcgccgtcaa?gtacatcgag 240

cgcggggaga?agatagacga?gaatgtccag?cgtgagataa?ttaaccatag?atcactgaaa 300

catcccaaca?tcattaggtt?taaggaggtt?attttaacac?cgacccatct?tgctattgtc 360

atggaatatg?catctggtgg?tgagcttttt?gagagaatat?gtaaaaatat?acgattcagt 420

gaagatgagg?ctcgctactt?cttccagcag?cttatatctg?gagtcagcta?ctgccattcg 480

atgcaagtat?gtcaccgtga?cttgaagctg?gagaacacat?tgctggacgg?tagtcctgct 540

cctcgcttga?agatatgtga?tttcggctat?tctaagtctt?cagttctcca?ttcacaacca 600

aaatcaactg?ttggaacacc?tgcttatatt?gcacctgaag?ttctgttgaa?gaaagaatat 660

gatggcaaga?ttgctgatgt?atggtcctgt?ggtgtgactc?tttatgtcat?ggtagtcggt 720

gcatatcctt?ttgaggatcc?agaagaacct?aaaaactttc?ggaagacaat?tcagcgtatc 780

ttgagtgttc?agtattcaat?tccagataac?gtggacatat?ctccagagtg?caggcaccta 840

atttcgagga?tttttgttgg?ggatcctgcg?ttgaggataa?ccatccctga?aatacggagc 900

cataactggt?tcttaaagaa?ccttcccgct?gatttgatgg?atgatgatag?catgagcagc 960

caatacgagg?agcctgagca?gcgaatgcag?acgatggatg?agatcatgca?aattctaaca 1020

gaggccacca?taccacctgc?ttgttctcgt?ataaaccaca?tcctaactga?tggattcgac 1080

atggatgatg?acatggatga?ccttgaatca?gactcagatc?ttgatatcga?cagcagtgga 1140

gagatcgtgt?atgcgatgtg?agccatctct?gccggcgacc?gtatcgaaac?aaccatagaa 1200

agcagctgaa?gggcacatgg?tgacctgatg?ttgtaccctg?tcaaaagagc?tagcagcact 1260

ttgtgggaaa?caatcgttct?gtgttttgca?agcgaaagtc?cccgtcctgt?tctggttgta 1320

atataatggg?ggttagtccc?tggagaagca?tcctttctgt?tcctgttgtg?ctacatatgt 1380

gcaaatagtt?cgtactcctg?ttgttaatgt?gtgaacctgt?gactgaactt?g 1431

 

<210>2

<211>366

<212>PRT

＜213〉Triticum common wheat (Triticum aestivum L.)

 

<400>2

 

Met?Ala?Gly?Ala?Ala?Pro?Asp?Arg?Ala?Ala?Leu?Thr?Val?Gly?Pro?Gly

1 5 10 15

Met?Asp?Met?Pro?Ile?Met?His?Asp?Ser?Asp?Arg?Tyr?Glu?Leu?Val?Arg

20 25 30

Asp?Ile?Gly?Ser?Gly?Asn?Phe?Gly?Val?Ala?Arg?Leu?Met?Arg?Asp?Arg

35 40 45

Arg?Thr?Met?Glu?Leu?Val?Ala?Val?Lys?Tyr?Ile?Glu?Arg?Gly?Glu?Lys

50 55 60

Ile?Asp?Glu?Asn?Val?Gln?Arg?Glu?Ile?Ile?Asn?His?Arg?Ser?Leu?Lys

65 70 75 80

His?Pro?Asn?Ile?Ile?Arg?Phe?Lys?Glu?Val?Ile?Leu?Thr?Pro?Thr?His

85 90 95

Leu?Ala?Ile?Val?Met?Glu?Tyr?Ala?Ser?Gly?Gly?Glu?Leu?Phe?Glu?Arg

100 105 110

Ile?Cys?Lys?Asn?Ile?Arg?Phe?Ser?Glu?Asp?Glu?Ala?Arg?Tyr?Phe?Phe

115 120 125

Gln?Gln?Leu?Ile?Ser?Gly?Val?Ser?Tyr?Cys?His?Ser?Met?Gln?Val?Cys

130 135 140

His?Arg?Asp?Leu?Lys?Leu?Glu?Asn?Thr?Leu?Leu?Asp?Gly?Ser?Pro?Ala

145 150 155 160

Pro?Arg?Leu?Lys?Ile?Cys?Asp?Phe?Gly?Tyr?Ser?Lys?Ser?Ser?Val?Leu

165 170 175

His?Ser?Gln?Pro?Lys?Ser?Thr?Val?Gly?Thr?Pro?Ala?Tyr?Ile?Ala?Pro

180 185 190

Glu?Val?Leu?Leu?Lys?Lys?Glu?Tyr?Asp?Gly?Lys?Ile?Ala?Asp?Val?Trp

195 200 205

Ser?Cys?Gly?Val?Thr?Leu?Tyr?Val?Met?Val?Val?Gly?Ala?Tyr?Pro?Phe

210 215 220

Glu?Asp?Pro?Glu?Glu?Pro?Lys?Asn?Phe?Arg?Lys?Thr?Ile?Gln?Arg?Ile

225 230 235 240

Leu?Ser?Val?Gln?Tyr?Ser?Ile?Pro?Asp?Asn?Val?Asp?Ile?Ser?Pro?Glu

245 250 255

Cys?Arg?His?Leu?Ile?Ser?Arg?Ile?Phe?Val?Gly?Asp?Pro?Ala?Leu?Arg

260 265 270

Ile?Thr?Ile?Pro?Glu?Ile?Arg?Ser?His?Asn?Trp?Phe?Leu?Lys?Asn?Leu

275 280 285

Pro?Ala?Asp?Leu?Met?Asp?Asp?Asp?Ser?Met?Ser?Ser?Gln?Tyr?Glu?Glu

290 295 300

Pro?Glu?Gln?Arg?Met?Gln?Thr?Met?Asp?Glu?Ile?Met?Gln?Ile?Leu?Thr

305 310 315 320

Glu?Ala?Thr?Ile?Pro?Pro?Ala?Cys?Ser?Arg?Ile?Asn?His?Ile?Leu?Thr

325 330 335

Asp?Gly?Phe?Asp?Met?Asp?Asp?Asp?Met?Asp?Asp?Leu?Glu?Ser?Asp?Ser

340 345 350

Asp?Leu?Asp?Ile?Asp?Ser?Ser?Gly?Glu?Ile?Val?Tyr?Ala?Met

355 360 365

Claims (14)

1. albumen, the protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2.

2. the described proteic encoding gene of claim 1.

3. encoding gene according to claim 2 is characterized in that: described proteic encoding gene is following 1)-3) in arbitrary described gene:

1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 61st the-the 1161st deoxyribonucleotide;

2) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal the 11st the-the 1166th deoxyribonucleotide;

3) its nucleotide sequence is the sequence 1 in the sequence table.

4. the transgenic cell line, reorganization bacterium or the expression cassette that contain claim 2 or 3 described encoding genes.

5. the recombinant vectors that contains claim 2 or 3 described genes.

6. a method of cultivating the gene plant of anti-the reverse is that claim 2 or 3 described genes are imported the purpose plant, obtains the transgenic plant that resistance of reverse is better than described purpose plant.

7. method according to claim 6 is characterized in that: claim 2 or 3 described genes are to import in the purpose plant by the described recombinant vectors of claim 5.

8. according to claim 6 or 7 described methods, it is characterized in that: the described gene plant of anti-the reverse is drought-resistant and/or the salt tolerant transgenic plant.

9. according to claim 6 or 7 described methods, it is characterized in that: described plant is dicotyledons or monocotyledons.

10. method according to claim 9 is characterized in that: described dicotyledons is an Arabidopis thaliana.

11. method according to claim 9 is characterized in that: described monocotyledons is a wheat.

12. method according to claim 8 is characterized in that: described plant is dicotyledons or monocotyledons.

13. method according to claim 12 is characterized in that: described dicotyledons is an Arabidopis thaliana.

14. method according to claim 12 is characterized in that: described monocotyledons is a wheat.

Images