CN113201597B - InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof - Google Patents
InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof Download PDFInfo
- Publication number
- CN113201597B CN113201597B CN202110040133.1A CN202110040133A CN113201597B CN 113201597 B CN113201597 B CN 113201597B CN 202110040133 A CN202110040133 A CN 202110040133A CN 113201597 B CN113201597 B CN 113201597B
- Authority
- CN
- China
- Prior art keywords
- clubroot
- molecular marker
- resistant
- cabbage
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to an InDel molecular marker primer identified by a clubroot-resistant gene PbBa8.1 of cruciferous plants and application thereof, wherein the molecular marker primer is F: ATTCAAATCAACCAAACTGAATTCG and R: TGTTGGAGCTCTAGTTGTCTG is added. The developed molecular marker has stronger specificity, and the detection of the disease-sensitive material as disease resistance does not occur when the molecular marker is compared with the disclosed molecular marker and when the molecular marker is tested in 96 disease-sensitive germplasm resources, thereby showing stronger specificity. Meanwhile, the gene can be used in combination with other clubroot-resistant gene molecular markers as screening work in clubroot-resistant identification or breeding.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an I nDel molecular marker primer identified by a clubroot-resistant gene PbBa8.1 of cruciferous plants and application thereof.
Background
Clubroot is a soil-borne disease which seriously damages cruciferous crops and is caused by infection of Plasmodiophora brassicae. The root of the plant is infected by plasmodiophora brassicae, the root is deformed and swollen to form a tumor after 40-60 days, normal water and nutrient transportation of the plant is blocked, the plant grows slowly, and finally the root is rotten and leaves are yellow and withered. Clubroot causes serious harm to a large number of cruciferous crops and vegetables such as rape (Brassica napus), Chinese cabbage (B.rapa ssp. pekinensis), cabbage (B.oleracea var. capitata) and the like worldwide (2012, such as Lemna hexandra and the like). Wuta-tsai (b.rapassp. naprinosa), pakchoi (b.rapasp. chinensis var. purpurea), brassica alba (b.rapasp. chinensis var. tai-tsai), brassica napus (b.rapasp. parachinesis) belong to different subspecies or varieties under brassica alba (B.r apa), and are very important vegetable varieties with different geographical features in China, such as anhui yellow heart wuta-tsai, shanghai pakchoi, wuhan hong mountain brassica campestris, and the like.
When a breeder utilizes the disease-resistant genes to cultivate disease-resistant varieties, a molecular marker which is simple and convenient to operate, stable in effect and high in accuracy is of great importance, and the accurate and stable molecular marker detection result can feed back reliable information to the breeder in the breeding process. At present, clubroot-resistant genes (jiahao 2018) are found only in part of European turnip (B.rapasp.rapa, a subspecies of the Chinese cabbage) in Chinese cabbage species, and breeders have introduced the clubroot-resistant genes from the European turnip into Chinese cabbage and rape varieties by means of cross breeding. PbBa8.1 is an anti-clubroot gene which is identified from European turnip strain ECD04(Chenet al 2013) and is positioned on A08 chromosome, a molecular marker caps _134 is developed aiming at PbBa8.1 by Zhan, and PbBa8.1 is further successfully introduced into brassica napus by utilizing the molecular marker, so that an anti-clubroot rape variety Huashuang5R is cultivated, and caps _134 can be used in rape breeding as the molecular marker of PbBa8.1 (Zhan et al 2020).
In plant breeding, when a disease-resistant gene is introduced into a variety from a wild species of the variety or other varieties that are distant from the wild species, the introduced disease-resistant gene is usually present in a recipient variety in the form of a large chromosome fragment, i.e., a region closely linked to the disease-resistant gene (Lin et al 2014). Due to the principle of linkage disequilibrium, DNA variation sites such as Indel and SNP existing in the disease-resistant gene and on the upstream and downstream chromosome fragments thereof are closely related to the disease-resistant gene and can be converted into molecular markers for detecting whether a variety carries the disease-resistant gene. However, the genotypes of these mutation sites and disease-resistant genes sometimes produce a large number of unreal associations in some types of susceptible varieties, and the recombination exchange which breaks linkage disequilibrium in the breeding process is low in probability, so that the unreal association which often occurs in the molecular marker detection can be called as a false positive problem. This is related to the source of disease-resistant genes, and taking the molecular marker of tomato late blight-resistant gene Ph-3 as an example, some of the reported Ph-3 molecular markers are more likely to produce false positive results in cherry tomatoes than in large fruit cultivated tomatoes, because the source variety L3708 of P h-3 belongs to the currant tomato, which is a wild ancestral species of modern large fruit cultivated tomatoes, and the cherry tomatoes are intermediate species in the evolution process from the currant tomatoes to the large fruit cultivated tomatoes, so the cherry tomato genome contains more DNA variations than the large fruit tomato genome, and the Ph-3 molecular markers developed by using these variations are more likely to produce false positives in the cherry tomato variety (Ren et al 2019).
A disease-resistant gene is always developed with a plurality of corresponding molecular markers continuously, as a breeder often finds that the published molecular markers have false positive in the practical process, when the breeder verifies the 6 published CRb molecular markers in 3 Chinese cabbage varieties with known disease resistance and 24 germplasm resources, the breeder finds that only the detection result of the marker TCR05 in the 6 CRb molecular markers is accurate and stable (2016, et al). Shenshu in order to find a clubroot-resistant molecular marker suitable for self-breeding materials, 43 clubroot-resistant molecular markers of the published clubroot genes were screened and verified by using a known resistant brassica rapa pekinensis variety, and only one molecular marker consistent with the disease resistance of the variety was obtained (shenshu 2019). Although a lot of clubroot-resistant molecular markers are published and some of the clubroot-resistant molecular markers are applied to breeding of rape and Chinese cabbage, the breeding application effect on wider variety of Chinese cabbage subspecies and varieties is not tested, and whether the genetic marker can be applied to the clubroot-resistant breeding of the Chinese cabbage subspecies and varieties is unknown.
Therefore, the development of universal molecular markers for identifying clubroot is very important for breeding clubroot resistance of various cabbage subspecies and varieties.
Disclosure of Invention
The invention aims to provide an InDel molecular marker primer identified by a crucifer clubroot-resistant gene PbBa8.1, wherein the primer sequence of the molecular marker PbBa8.1-sepcific-InDel is F: ATTCAAATCAACCAAA CTGAATTCG and R: TGTTGGAGCTCTAGTTGTCTG are provided.
The invention also aims to provide the application of the InDel molecular marker primer identified by the crucifer clubroot resistant gene PbBa8.1, and the primer can be used for breeding clubroot resistant varieties including crucifers, particularly various cabbage subspecies and varieties or identifying clubroot resistant varieties.
In order to achieve the purpose, the invention adopts the following technical measures:
obtaining molecular marker primers for identifying clubroot of cruciferous plants:
1. the whole genome re-sequencing data is obtained by using a second-generation sequencing technology for pure-line brassica napus Bing409R (carrying CRb) (plum, etc. 2020), Huas huang5R (carrying PbBa8.1) (Zhan et al2020) and clubroot-resistant brassica chinensis GJ3 (carrying clubroot-resistant genes in De Gao CR 117) (Nie, et al, 2018) carrying clubroot-resistant genes. Meanwhile, 199 parts of second-generation sequencing data containing various cabbage subspecies and varieties such as Chinese cabbage, pakchoi, Wuta-tsai, turnip, cabbage heart, red-cabbage sprout, cabbage moss and the like are downloaded from the NCBI database (NCBI accession number: SRP 066057).
2. And (2) analyzing the second-generation sequencing data obtained in the step (1) on a biological information high-performance computing cluster of a national key laboratory for crop genetic improvement of university of agriculture in Huazhong by using a GATK algorithm (realized by using sentieon software) to obtain genotype data (VCF files) of InDel and SNP. Wherein, for 199 parts of subspecies and varieties of Chinese cabbage species and the red bolting GJ3, the genotype is calculated by taking a Chinese cabbage reference genome Chiifu-401-42(V3.0 version, Zhangetal 2018) as a reference genome; the genome of the cabbage type rape is composed of a cabbage genome (A genome) and a cabbage genome (C genome), and for two cabbage type rape B ing409R and Huashuang5R, because CRb and PbBa8.1 are positioned on chromosomes A03 and A08, in order to keep the InDel and SNP physical coordinates calculated on corresponding chromosomes of the two cabbage type rape consistent with the cabbage species, the genotypes are calculated by replacing A03 and A08 chromosomes of a cabbage type rape reference genome ZS11(song et al2020) with A03 and A08 chromosomes of Chiifu-401-42 and then using the chromosomes as reference genomes.
3. 199 parts of SNP genotypes of various cabbage subspecies and varieties in a 1Mb linkage interval of the disease-resistant genes of the inbred line carrying the three clubroot-resistant genes are clustered (the 1Mb linkage interval of the CRb is A03: 24250902-. InDel (>40bp, to ensure sufficient resolution in agarose gel electrophoresis) that was different in both disease and disease-resistant groups was sought within 1 Mb.
4. Designing a primer aiming at the InDel screened in the step 3, and firstly verifying the InDel authenticity and the primer detection effect in known strains with pure resistance, heterozygosity and pure feeling of the disease-resistant genes;
5. after the authenticity and the primer detection effect of InDel are determined, the detection effect of InDel is compared with that of the existing molecular marker, and the detection effect is verified in more germplasm resources, so that the use effect of the newly developed molecular marker is evaluated; finally, the molecular markers of 3 disease-resistant genes CRb, PbBa8.1 and CRzi8 are respectively obtained as follows: CRb-sepcific-InDel, PbBa8.1-sepcific-InDel and CRzi8-sepcific-InDel, and the primers designed aiming at the three molecular markers are as follows:
CRb-sepcific-InDel: f: ATTAATTGAAGTATTAAAGTGGATAGCGA and R: TCGATGC AGTGTGTTGTAATGAT, respectively; the disease-resistant strip is 160 bp; the susceptible band is 225 bp.
PbBa8.1-sepcific-InDel: f: ATTCAAATCAACCAAACTGAATTCG and R: TGTTGGAG CTCTAGTTGTCTG; a disease-resistant band is 257 bp; the susceptible band is 299 bp.
CRzi 8-sepcific-InDel: f: GGTCCACTTGTGTAAGATCCC and R: TGCATGCTCGATCT AGACGAT, respectively; a disease-resistant band is 237 bp; the susceptible band is 306 bp.
An application of an InDel molecular marker primer identified by crucifer clubroot-resistant genes PbBa8.1 comprises the steps of identifying clubroot resistance of crucifers, particularly Chinese cabbages or subspecies and varieties thereof, or breeding clubroot resistance by singly or jointly utilizing the molecular marker primer;
in the above applications, preferably, when used in combination, the combination of the molecular marker primers is:
PbBa8.1-sepcific-InDel: f: ATTCAAATCAACCAAACTGAATTCG, R: TGTTGGAGC TCTAGTTGTCTG, respectively; and CRzi 8-sepcific-InDel: f: GGTCCACTTGTGTAAGATCCC, R: TGC ATGCTCGATCTAGACGAT are provided.
Compared with the prior art, the invention has the following advantages:
the applicant verifies that the molecular markers of the existing three clubroot-resistant genes have false positive, namely, the disease-sensitive material is identified as disease-resistant; the developed molecular marker has stronger specificity, and the disease-resistant material is not detected to be disease-resistant when the molecular marker is compared with the disclosed molecular marker and when the molecular marker is tested in 96 susceptible germplasm resources. The anti-clubroot molecular marker developed by the invention shows stronger specificity when the anti-clubroot gene is detected.
Drawings
FIG. 1 is a flow chart of the development of the anti-clubroot molecular marker of the present invention.
FIG. 2 shows the clustering results of the resistant and re-sequenced resistance and re-sequencing of CRb, PbBa8.1 and CRzi8 for the subspecies and variety resources of Chinese cabbage;
wherein: a is the clustering result of subspecies and variant resources of the Chinese cabbage of CRb resistance source and resequencing;
b is a clustering result of PbBa8.1 resistance source and resequencing cabbage species subspecies and variant resources;
c is the clustering result of the resistance source and the resequencing Chinese cabbage variety subspecies and variant resources of CRzi 8.
FIG. 3 is a graph showing the effect of detecting three molecular markers provided by the present invention in a known genotype material of the corresponding clubroot-resistant gene in example 2;
in the remarks below, the parenthesized R, H, S indicate that the genotype of the variety on the corresponding disease-resistant gene is pure resistance, heterozygosis and susceptibility, respectively.
Wherein: a is the detection effect of the gene CRb molecular marker CRb-sepcific-InDel for resisting the clubroot disease:
lane M: BM5000 marker; 1: bing409R (R); 2: bing409RXGJ3(H) (Bing409R hybridizes with GJ 3F 1); 3: big thigh (S) (red flowering Chinese cabbage); 4: chinese treasure No. one rape heart (S) (heart of cabbage); 5: snowball (S) (wuta tsai, zhanlingfeng 2012); 6: white jade No. 2 (S) (quick vegetable); 7: large cherry blossom (S) (flowering red cabbage); 8: white snow princess (S) (pakchoi);
b is the detection effect of the anti-clubroot gene PbBa8.1 molecular marker PbBa8.1-sepcific-InDel:
lane M: BM5000 marker; 1: hushuang 5R (R); 2: huashuang5RXGJ3(H) (hybrid F1 of Huashuang5R and GJ 3); 3: red hubei No. 1 (S) (red bolt, court trial 001-; 4: papaw (S) (a traditional yunzhou variety of the intermediate type of wuta-tsai pakchoi); 5: snowball (S) (wuta tsai, zhanlingfeng 2012); 6: argentine (S) (brassica alba); 7: milk cabbage (S) (pakchoi); 8: chinese treasure No. one rape heart (S) (heart of cabbage);
c is the detection effect of the molecular marker CRzi8-se pcific-InDel of the main effect anti-clubroot site CRzi8 on A08 chromosome in GJ 3/DelgaCR 117:
lane M: BM5000 marker; 1: GJ3 (R); 2: purple 60(H) (2019 of bolting red vegetables, root swelling disease resistant hybrid, nie jun, etc.); 3: biezaozi (S) (brassica oleracea, wukorin, chenwen super 1997); 4: jiahong No. 6 (S) (red flowering Chinese cabbage); 5: a 70-day extra green heart (S) (heart of chinese cuisine 2007); 6: snowball (S) (wuta tsai, zhanlingfeng 2012); 7: white snow princess (S) (pakchoi); 8: purple heart wu (S) (wuta-tsai).
FIG. 4 is a schematic diagram showing the comparison of the accuracy of the molecular marker of the present invention and the molecular marker of the same gene reported;
wherein the boxes indicate the pure (R) and hetero-anti (H) genotype controls for each anti-clubroot gene (R in lanes 1 and 2, H in lanes 3 and 4); arrows indicate false positive results detected by published molecular markers;
wherein A is the comparison of molecular marker CRb-sepcific-InDel and molecular marker TCR 05;
b is the comparison of the molecular marker PbBa8.1-sepcific-InDel and the molecular marker caps _ 134;
c is the comparison of molecular marker CRzi8-sepcific-InDel and molecular marker BSA 7.
FIG. 5 is a schematic diagram of detection of three molecular marker primers in 96 parts of Chinese cabbage resources.
Detailed Description
The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
obtaining an InDel molecular marker primer for identifying clubroot of crucifers:
1, carrying pure line cabbage type rape Bing409R (CRb resistance source), Huashuang5R (PbBa8.1 resistance source) and clubroot red cabbage flower GJ3(CRzi8 resistance source), wherein the resistance genes are generated by hybridization and transformation with a clubroot resistant Chinese cabbage variety 'Degao CR 117', CRzi8 is named by an applicant, Nie Qiun et al 2018, Songying 2019) which carry clubroot disease resistance genes, and acquiring whole genome re-sequencing data by using a second-generation sequencing technology. 199 secondary sequencing data containing subspecies and varieties of various white cabbage species were also downloaded from the NCBI database (NCBI accession number: SRP 066057).
Wherein, the anti-clubroot gene in CRzi8, GJ 3/DelgaCR 117 is the anti-clubroot major QTL site located on a section of chromosome A08, and a specific gene is not cloned at present, but a cloned anti-clubroot gene Cr r1a is just located in the QTL section of CRzi8, and the possibility of being the same gene exists (Songying 2019). To clarify the relationship between C rr1a and CRzi8 locus, applicants found that missense SNP mutation C → T (encoding leucine at Crr1a, phenylalanine at the allele corresponding to GJ3 and 2302 at Crr1 a) existed in GJ3 by comparing the allele corresponding to Crr1a with the sequence of Crr1a disease-resistant allele, i.e., the anti-clubroot gene in GJ 3/Degao CR117 was not the same disease-resistant gene as Crr1a, so applicants named it as CRzi 8.
2. And (2) analyzing the second-generation sequencing data obtained in the step (1) on a biological information high-performance computing cluster of a national key laboratory for crop genetic improvement of university of agriculture in Huazhong by using a GATK algorithm (realized by using sentieon software) to obtain genotype data (VCF files) of InDel and SNP. For 199 parts of cabbage subspecies and varieties and the bolting red flower GJ3, calculating the genotype by taking the V3.0 version (Zhangetal 2018) of a cabbage reference genome Chiifu-401-42 as a reference genome; for Brassica napus Bing409R (CRb resistance source) and Huashuang5R (PbBa8.1 resistance source), as CRb and PbBa8.1 are located on chromosomes A03 and A08, in order to keep the physical coordinates of InDel and SNP calculated on the corresponding chromosomes of the two Brassica napus to be consistent with the subspecies and varieties of Chinese cabbage, the genotypes are calculated by replacing the chromosomes A03 and A08 of the Brassica napus reference genome ZS11(song et al2020) with the chromosomes A03 and A08 of Chiifu-401-42 and then using the chromosomes as reference genomes.
3. 199 parts of cabbage subspecies and variety resources are respectively clustered with SNP genotypes of three anti-clubroot gene resistance sources in a 1Mb linkage interval of the anti-clubroot gene (the 1Mb linkage interval of CRb is A03:25024902-,
the clustering results of the CRb, pbba8.1, CRzi8 resistance source and 199 varieties of cabbage and variety resources are respectively shown as A, B, C in fig. 2, from the clustering results, the resistance source (shown by an arrow) corresponding to each disease-resistant gene is gathered in turnip (turn ip), which is also consistent with the condition that the clubroot resistance source is found only in part of the turnip strains in the current cabbage varieties and varieties, and the turnip strains are the most recent genetic relationship with the resistance source, which also indicates that the other cabbage varieties in the figure do not carry the three disease-resistant genes. Therefore, the CRb, PbBa8.1 and CRzi8 resistance sources are respectively used as the disease-resistant groups corresponding to each disease-resistant gene (namely, only one resistance source is in each disease-resistant group), and other 199 Chinese cabbage resources are used as susceptible groups.
And (4) distinguishing two variety groups carrying disease-resistant genes and not carrying the disease-resistant genes according to the clustering result. Searching for InDel (>40 bp) within 1Mb that is different in both disease-resistant and disease-sensitive groups in order to ensure sufficient resolution in agarose gel electrophoresis;
4. designing a primer aiming at the InDel screened in the step 3, and firstly verifying the InDel authenticity and the primer amplification effect in the known pure-resistant, heterozygous and pure-sense strains of the disease-resistant genes;
5. after the authenticity and the primer amplification effect of InDel are determined, the InDel is compared with the existing molecular marker and verified in more germplasm resources, and the use effect of the newly developed molecular marker is evaluated; finally, the molecular markers of 3 clubroot resistant genes CRb, PbBa8.1 and CRzi8 are obtained, respectively: CRb-sepcific-InDel, PbBa8.1-sepcific-In Del and CRzi8-sepcific-InDel, and the primers designed aiming at the three molecular markers are as follows:
CRb-sepcific-InDel: f: ATTAATTGAAGTATTAAAGTGGATAGCGA and R: TCGATGCA GTGTGTTGTAATGAT, respectively; the disease-resistant strip is 160 bp; the susceptible band is 225 bp.
PbBa8.1-sepcific-InDel: f: ATTCAAATCAACCAAACTGAATTCG and R: TGTTGGAGC TCTAGTTGTCTG, respectively; a disease-resistant band is 257 bp; the susceptible band is 299 bp.
CRzi 8-sepcific-InDel: f: GGTCCACTTGTGTAAGATCCC and R: TGCATGCTCGATCTA GACGAT, respectively; a disease-resistant band is 237 bp; the susceptible band is 306 bp.
And (3) PCR reaction system: total volume 20 μ L, wherein: 2.0. mu.L of 10X Easy Taq buffer, 0.4. mu.L of dNTP (10mM), 0.4. mu.L of forward and reverse primers (10. mu.M) respectively, 1. mu.L of DNA template (50-200 ng/. mu.L), 0.2. mu.L of Easy Taq enzyme (5U/uL), ddH2O 15.6μL;
PCR reaction procedure: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, performing 35 cycles, extension at 72 deg.C for 5min, and storing at 4 deg.C for 10 min;
and (3) gel electrophoresis detection: the PCR product was electrophoresed with 2.5% agarose gel at 130V for 25min and the results were displayed on a gel imaging system.
Example 2:
the application of the InDel molecular marker primer for identifying clubroot of cruciferous plants in identification of clubroot resistance of plants comprises the following steps:
r, H and S in brackets of each variety below indicate that the genotype of the variety on the corresponding disease-resistant gene is pure resistance, heterozygosity and susceptibility, and the numbering sequence before the variety corresponds to the lane number of the detection result of each marker in FIG. 3.
1) The known genotype varieties for verifying the detection effect of the CRb-sepcific-InDel molecular marker primer are as follows:
1: bing409R (R); 2: bing409RXGJ3(H) (Bing409R hybridizes with GJ 3F 1); 3: big thigh (S) (young red cabbage); 4: chinese treasure No. one rape heart (S) (heart of cabbage); 5: snowball (S) (wuta tsai, zhanlingfeng 2012); 6: white jade No. 2 (S) (quick vegetable); 7: large cherry blossom (S) (flowering red cabbage); 8: white snow princess (S) (pakchoi).
The above cultivars were identified by PCR in example 1, and the results are shown in FIG. 3, in which A shows that only the pure resistant and heteroresistant cultivars had 160bp of the disease-resistant band.
2) The known genotype varieties for verifying the detection effect of the PbBa8.1-sepcific-InDel molecular marker primer are as follows:
1: hushuang 5R (R); 2: huashuang5RXGJ3(H) (hybrid F1 of Huashuang5R with GJ 3); 3: red hubei No. 1 (S) (red bolt, court trial 001-; 4: papaw (S) (a traditional yunzhou variety of the intermediate type of wuta-tsai pakchoi); 5: snowball (S) (wuta tsai, zhanlingfeng 2012); 6: silver (S) (brassica alba); 7: milk cabbage (S) (pakchoi); 8: chinese treasure No. one rape heart (S) (heart of cabbage);
the above cultivars were identified by PCR in example 1, and the result is shown in B in FIG. 3, where only the pure and hetero resistant cultivars had a 257bp band against disease.
3) The known genotype varieties for verifying the detection effect of the CRzi8-sepcific-InDel molecular marker primer are as follows:
1: GJ3 (R); 2, purple 60(H) (red flowering cabbage, root swelling disease resistant hybrid, Nie Qijun, and the like 2019); 3: biezaozi (S) (brassica oleracea, wukorin, chenwen super 1997); 4: jiahong No. 6 (S) (red flowering Chinese cabbage); 5: a 70-day extra green heart (S) (heart of chinese cuisine 2007); 6: snowball (S) (wuta tsai, zhanlingfeng 2012); 7: white snow princess (S) (pakchoi); 8: zixin wu (S) (wuta-tsai);
the above cultivars were identified by the PCR method in example 1, and the results are shown in FIG. 3C, where only the pure resistant and heteroresistant cultivars had a 237bp band of resistance.
Example 3:
the accuracy of identifying the clubroot-resistant gene by using the InDel molecular marker primer for identifying the clubroot of cruciferous plants (compared with the published markers) is as follows:
1) comparison of the molecular marker CRb-sepcific-InDel with the molecular marker TCR05 (Niping et al 2016)
Primers for the molecular marker TCR05 were: TCR 05-F: AGAATCATGACCGGGGAAAT TCR 05-R: GC AGCTAAGTCATCGACCAA, respectively; the PCR amplification of the primer of TCR05 on the material to be detected can amplify 279bp disease-resistant band and 250bp infection-resistant band in CRb positive and negative material. The molecular markers of the two CRbs are used to detect the following varieties as described In example 1, and the varieties to be detected (R, H represents the pure resistance and heterozygous control of the disease-resistant gene respectively, and the rest are known susceptible varieties) are sequentially:
1: bing409R-5(R) (line after Bing409R propagation); 2: bing409R-6R) (the strain after Bing409R propagation); 3: bing409RX white jade No. 2 (H) (Bing409R crosses white jade No. 2F 1); 4: bing409RX April Slow (H) (Bing409R hybridizes with April Slow F1); 5: zixin wu (wuta tsai); 6: milk cabbage (pakchoi); 7: white jade No. 2 (quick vegetable); 8: red 60 hubei (red flowering Chinese cabbage); 9: BT45 (Chinese cabbage bolt, Wuhan Bo Huo recommended the kind of the bolt in 2020); 10: red hubei No. 1 (red bolt, court trial 001-; 11: LH70 (Red flowering cabbage, the flowering cabbage variety recommended by Wuhan Boehringer in 2020); 12: alpine red (red young cabbage, huiezu dish 2015001); 13: red hubei No. 2 (red bolt, court trial 002-; 14: hubei No. 4 (red flowering Chinese cabbage, hubei vegetable 2010001); 15: slow april (pakchoi); 16: hubei No. 5 (red bolt, hubei dish 2015002).
The results are shown in FIG. 4A (lane numbers corresponding to the pre-breed numbering sequence), except for the positive control (box) of the pure and hybrid antibodies, the remaining material was of known susceptible variety of Brassica subspecies and varieties, but false positive results (arrow) were observed for TCR05, whereas CRb-sepcific-InDel did not.
2) Comparison of molecular marker PbBa8.1-sepcific-InDel with molecular marker caps-134 (Kazongxiang 2020)
Primers for the molecular marker caps _134 were: caps-134-F: TCTTCTACTTTGTCAGTCCGTTCAC and ca ps-134-R: TACGAGGTTGGTTTTCCACATGATG, respectively; performing conventional PCR amplification on a material to be detected by caps _134 to obtain a PCR product with the strip size of 338bp, performing enzyme digestion on the PCR product by using a restriction enzyme TaqI, and performing enzyme digestion on an amplified strip in a PbBa8.1 positive material, wherein the strip type is 87bp +251 bp; in the PbBa8.1 negative material, the amplified band could not be cleaved by enzyme, and was 338 bp. The use of PbBa8.1-sepcific-InDel was as described in example 1, and the following strains were tested using the two molecular markers for PbBa8.1, and the strains tested (R, H represents the pure resistance and heterozygous control of the disease resistance gene, respectively, and the rest are known susceptible strains) were in the following order:
1: huashuang5R-7(R) (the line after Huashuang5R propagation); 2: huashuang5R-8(R) (the line after the Huashuang5R is propagated); 3: huashuang5RXGJ3(H) (Huashuang5R hybridizes with GJ 3F 1); 4: huashuang5RX bienniang (H) (Huashuang5R crossed bienniang F1); 5: yibin modern red (flowering red, wangliping 2005); 6: LH70 (Red flowering cabbage, the flowering cabbage variety recommended by Wuhan Boehringer in 2020); 7: snowball (wuta tsai, zhanlingfeng 2012); 8: red 60 hubei (red flowering Chinese cabbage); 9: a 70-day special green heart (heart of dish, huyingzhong 2007); 10: zaozi (red flowering cabbage, Wukoring, Chenwen super 1997); 11: slow april (pakchoi); 12: hongting No. 2 (red flowering cabbage, mourning, etc. 2008); 13: jiahong number 6 (red young cabbage); 14: hubei No. 5 (red bolt, hubei dish 2015002).
The results are shown in FIG. 4B (lane numbers corresponding to the pre-breed numbering sequence), except for the positive control (box) of pure and heterozygous resistance, the remaining material was of known susceptible variety of Brassica subspecies and varieties, but false positive results (arrows) were observed for caps-134, whereas PbBa8.1-sepcific-InDel were not observed.
3) Comparison of molecular marker CRzi8-sepcific-InDel with molecular marker BSA7 (Songying 2019)
The primers labeled by the BSA7 molecule are: BSA 7-F: AAGCAGAAGGGTTCTTGTCTGAACTBSA-R: t CACTCTGAGACATGAGGACACTTG, respectively; the BSA7 is used for carrying out conventional PCR amplification on the material to be detected, and a disease-resistant band of 330bp and a disease-sensitive band of 352bp can be respectively amplified in the CRz i8 positive material and the CRz i8 negative material. The use of CRzi8-sepcifi c-InDel was as described in example 1, and the following varieties were tested using the molecular markers of these two CRzi8, and the varieties to be tested (R, H respectively represent the pure resistance and heterozygous control of the disease-resistant gene, and the rest are known susceptible varieties) were in turn:
1: GJ3(R) (red flowering cabbage, pure system for resisting clubroot, Nie Jun, etc. 2018); 2: GJ9(R) (red flowering cabbage, pure system for resisting clubroot, Nie Jun, etc. 2018); 3: degao CR117(H) (chinese cabbage, clubroot-resistant hybrid, songying 2019); 4: purple Yu 70(H) (Red flowering cabbage, root swelling disease resistant hybrid, Nie Jiangjun, 2019); 5: red 60 hubei (red flowering Chinese cabbage); 6: LH70 (Red flowering cabbage, the flowering cabbage variety recommended by Wuhan Bob in 2020); 7: BT45 (Chinese cabbage bolt, Wuhan Bo Huo recommended the kind of the bolt in 2020); 8: red hubei No. 2 (red bolt, court trial 002-; 9: alpine red (red young cabbage, huiezu dish 2015001); 10: red 5 from hubei (red flowering cabbage 2015002 from hubei); 11: big thigh (red bolt).
The results are shown in FIG. 4C (lane numbers corresponding to the pre-varietal numbering sequence), and the remaining material was of known disease-susceptible variety of Brassica subspecies and varieties, except for the positive control (box) of the pure and heterozygous resistance, but with false positive results (arrows) for BSA7 and no false positive results for CRzi 8-sepcific-InDel.
Therefore, the molecular marker developed by the invention aiming at the three clubroot-resistant genes has higher accuracy compared with the published molecular marker, and can be used alone or in combination for identifying the clubroot-resistant character of the plant.
Example 4:
the universality of the InDel molecular marker primer for crucifer clubroot identification is as follows:
in the embodiment, 96 parts of cabbage variety subspecies and variant resources (all are susceptible materials) collected by an applicant are identified by using the three pairs of molecular marker primers,
the result is shown in fig. 5, except for Marker, the first lane counted on the left of each row is positive control (positive control of disease-resistant gene CRb is Bing409R, positive control of disease-resistant gene PbBa8.1 is Huashuang5R, and positive control of disease-resistant gene CRzi8 is GJ3), and the three molecular markers provided by the invention do not find false positive in 96 Chinese cabbage resources.
Information of 96 parts of Chinese cabbage resources
Compared with the existing molecular markers, the molecular markers CRb-sepcific-InDel, PbBa8.1-sepci fic-InDel and CRzi8-sepcific-InDel developed aiming at CRb, PbBa8.1 and CRzi8 show good accuracy, and meanwhile, false positive results are found in wide germplasm resources, so that high specificity is shown. Shows wide application prospect in the breeding of the cabbage plant for resisting clubroot, can be used independently or jointly and is used for identifying or breeding the cruciferous plant for resisting the clubroot.
Sequence listing
<110> institute of economic crops of academy of agricultural sciences of Hubei province
<120> InDel molecular marker primer for identifying clubroot-resistant PbBa8.1 genes of cruciferous plants and application thereof
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
attaattgaa gtattaaagt ggatagcga 29
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tcgatgcagt gtgttgtaat gat 23
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
attcaaatca accaaactga attcg 25
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tgttggagct ctagttgtct g 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggtccacttg tgtaagatcc c 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgcatgctcg atctagacga t 21
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcttctactt tgtcagtccg ttcac 25
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tacgaggttg gttttccaca tgatg 25
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aagcagaagg gttcttgtct gaact 25
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tcactctgag acatgaggac acttg 25
Claims (6)
1. An InDel molecular marker primer identified by a crucifer clubroot-resistant gene PbBa8.1, wherein the molecular marker primer is F: ATTCAAATCAACCAAACTGAATTCG and R: TGTTGGAGCTCTAGTTGTCTG, the crucifer is Chinese cabbage or its subspecies or variety.
2. An InDel molecular marker primer combination for identifying clubroot-resistant genes of cruciferae plants: the molecular marker primer combination is as follows:
f: ATTCAAATCAACCAAACTGAATTCG, R: TGTTGGAGCTCTAGTTGTCTG, respectively; and F: GGTCCACTTGTGTAAGATCCC, R: TGCATGCTCGATCTAGACGAT, respectively; the cruciferae plant is Chinese cabbage or subspecies or varieties thereof.
3. Use of the primers of claim 1 in the identification of clubroot resistance in crucifers which are cabbage or subspecies or varieties thereof.
4. The use of the primers of claim 1 in breeding clubroot resistant crucifer which is cabbage or subspecies or varieties thereof.
5. Use of the primer combination of claim 2 in the identification of clubroot resistance in crucifers which are cabbage or subspecies or varieties thereof.
6. Use of the primer combination of claim 2 for breeding clubroot resistant crucifers, said crucifers being cabbage or subspecies or varieties thereof.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110040133.1A CN113201597B (en) | 2021-01-13 | 2021-01-13 | InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110040133.1A CN113201597B (en) | 2021-01-13 | 2021-01-13 | InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN113201597A CN113201597A (en) | 2021-08-03 |
CN113201597B true CN113201597B (en) | 2022-07-01 |
Family
ID=77025182
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110040133.1A Active CN113201597B (en) | 2021-01-13 | 2021-01-13 | InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113201597B (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104894228A (en) * | 2012-09-05 | 2015-09-09 | 沈阳农业大学 | Molecular marker and primer linked with Chinese cabbage clubroot disease resistant CRb gene and clubroot disease resistant plant selecting method |
CN105063033A (en) * | 2015-08-15 | 2015-11-18 | 华中农业大学 | Molecular marker of brassica napus anti-clubroot gene and application of molecular marker to anti-clubroot breeding |
CN105543391A (en) * | 2016-02-05 | 2016-05-04 | 北京市农林科学院 | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof |
WO2017102923A1 (en) * | 2015-12-15 | 2017-06-22 | Bayer Cropscience Nv | Brassicaceae plants resistant to plasmodiophora brassicae (clubroot) |
CN109280716A (en) * | 2018-10-12 | 2019-01-29 | 湖北省农业科学院经济作物研究所 | A kind of and the anti-clubroot QTL of radish chain SSR molecular marker and application |
-
2021
- 2021-01-13 CN CN202110040133.1A patent/CN113201597B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104894228A (en) * | 2012-09-05 | 2015-09-09 | 沈阳农业大学 | Molecular marker and primer linked with Chinese cabbage clubroot disease resistant CRb gene and clubroot disease resistant plant selecting method |
CN105063033A (en) * | 2015-08-15 | 2015-11-18 | 华中农业大学 | Molecular marker of brassica napus anti-clubroot gene and application of molecular marker to anti-clubroot breeding |
WO2017102923A1 (en) * | 2015-12-15 | 2017-06-22 | Bayer Cropscience Nv | Brassicaceae plants resistant to plasmodiophora brassicae (clubroot) |
CN105543391A (en) * | 2016-02-05 | 2016-05-04 | 北京市农林科学院 | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof |
CN109280716A (en) * | 2018-10-12 | 2019-01-29 | 湖北省农业科学院经济作物研究所 | A kind of and the anti-clubroot QTL of radish chain SSR molecular marker and application |
Non-Patent Citations (2)
Title |
---|
RAPD分子标记技术及其在十字花科蔬菜研究中的应用;胡学军等;《湖北农业科学》;20050330(第3期);第107-110页 * |
甘蓝型油菜抗根肿病资源创新与PbBa8.1位点遗传转育;战宗祥;《中国优秀博硕士学位论文全文数据库(博士)农业科技辑》;20180115(第1期);第1-76页 * |
Also Published As
Publication number | Publication date |
---|---|
CN113201597A (en) | 2021-08-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Calenge et al. | Identification of a major QTL together with several minor additive or epistatic QTLs for resistance to fire blight in apple in two related progenies | |
CN106929574B (en) | SNP molecular marker of upland cotton No. 4 chromosome related to fiber strength | |
CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
CN107043813B (en) | SNP molecular marker of upland cotton No. 25 chromosome related to fiber strength | |
CN108165656B (en) | Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance | |
Tacconi et al. | Polymorphism analysis of genomic regions associated with broad-spectrum effective blast resistance genes for marker development in rice | |
CN110512025B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof | |
CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
WO2011072478A1 (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
CN108893550B (en) | Development and application of SNP molecular marker related to resistance of corn stalk rot | |
CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
Baturo-Ciesniewska et al. | Molecular identification of Sclerotinia trifoliorum and Sclerotinia sclerotiorum isolates from the United States and Poland | |
CN111286555B (en) | SNP molecular marker based on pgx4 gene, application thereof in fusarium oxysporum detection, detection method and kit | |
Chand et al. | Genetics and molecular mapping of a novel purple blotch-resistant gene ApR1 in onion (Allium cepa L.) using STS and SSR markers | |
CN110684858B (en) | Molecular marker of rice slender grain type gene and application thereof | |
CN113201596B (en) | InDel molecular marker primer for identifying clubroot-resistant gene CRb of cruciferous plant and application | |
CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
CN113201597B (en) | InDel molecular marker primer identified by crucifer clubroot-resistant gene PbBa8.1 and application thereof | |
CN113201595B (en) | InDel molecular marker primer identified by clubroot-resistant gene CRzi8 of cruciferous plants and application | |
CN113881799B (en) | Functional molecular marker for screening/detecting tobacco root black rot main effect resistance locus and application thereof | |
CN114480713B (en) | Marker primer for detecting wheat grain weight related genes based on KASP technology and application | |
CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
CN115786564A (en) | Rice Pi-ta and Ptr dominant functional molecular marker and application thereof | |
CN111363846B (en) | Molecular marker for detecting wheat grain weight gene QTkw.saas-2D and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |