CN114480713B - Marker primer for detecting wheat grain weight related genes based on KASP technology and application - Google Patents

Marker primer for detecting wheat grain weight related genes based on KASP technology and application Download PDF

Info

Publication number
CN114480713B
CN114480713B CN202210165354.6A CN202210165354A CN114480713B CN 114480713 B CN114480713 B CN 114480713B CN 202210165354 A CN202210165354 A CN 202210165354A CN 114480713 B CN114480713 B CN 114480713B
Authority
CN
China
Prior art keywords
wheat
primer
sequence
kasp
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210165354.6A
Other languages
Chinese (zh)
Other versions
CN114480713A (en
Inventor
赵德辉
王春平
王黎明
庞玉辉
董普辉
闫雪芳
李家创
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan University of Science and Technology
Original Assignee
Henan University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan University of Science and Technology filed Critical Henan University of Science and Technology
Priority to CN202210165354.6A priority Critical patent/CN114480713B/en
Publication of CN114480713A publication Critical patent/CN114480713A/en
Application granted granted Critical
Publication of CN114480713B publication Critical patent/CN114480713B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a marker primer for detecting wheat grain weight related genes based on KASP technology and application thereof, belonging to the technical field of molecular genetic breeding, and providing a specific complete primerKasp‑ TraesCS1A02G045300.2Thousand grain weight of wheat is carried out by utilizing the primerTraesCS1A02G045300.2The detection of the gene has low human error and high analysis flux, and is suitable for the detection of a large number of samples. The co-dominant molecular marker provided by the invention is applied toTraesCS1A02G045300.2Gene transfer for accelerating utilization of thousand grain weight of wheatTraesCS1A02G045300.2The genetic improvement of the gene and the improvement of the breeding efficiency have important practical significance.

Description

Marker primer for detecting wheat grain weight related genes based on KASP technology and application
Technical Field
The invention belongs to the technical field of molecular genetic breeding, and particularly relates to the development and application of a thousand-grain-weight related gene high-throughput KASP (Kompetitive Allele-Specific PCR, competitive allele-Specific PCR) marker.
Background
Wheat is the crop with the largest global planting area, the annual planting area is about 2.2 hundred million hectares, the annual yield is about 1/6 of the world cultivated land area, and the annual yield is more than 7 hundred million tons, which is next to corn (http:// apps.fas. Usda. Gov/psdonline/circuliars/production. Pdf). 43 countries exist worldwide, and 35% -40% of population takes wheat as main food, so that improvement of yield is an important breeding target. Wheat yield per unit is a complex character, is regulated by various direct and indirect genetic factors, can be expressed as the product of grain number per unit area and grain weight, and can be decomposed into grain number per unit area and grain number per spike. Each increase can improve the unit yield, but each factor is mutually restricted, and the high yield can be achieved only by the coordinated development of the spike number, the grain number and the grain weight. Studies of different year bred varieties have found that the increase in wheat yield per unit area in the last century is primarily dependent on an increase in grain count per unit area (Fischer 2008; hawkes ford et al 2013). Since 1980, the role of grain weight in yield enhancement was increasingly revealed (Calderini and Ortiz-Monasterio 2003;Sadras and Lawson 2011). The yield potential of wheat in Henan and Shandong in China continues to increase over the past decades, with a significant increase in spike grain number, and also in Henan province (Zheng et al 2011; xiao et al 2012; gao et al 2017). Grain weight is one of the three most important traits of yield composition, and is mainly dependent on co-inheritance of factors such as grain size, morphology and texture.
Although many QTLs associated with grain weight have been located, their use in breeding has been rarely reported. The main reasons are as follows: (1) Markers linked to QTL are too far from the gene to be selected accurately. Thus, the markers have no versatility and are only effective for materials related to the targeted population (Bagge et al 2007; liu et al 2012); (2) Common wheat is heterohexaploid formed by multiple hybridization, has three subgenomic ABD, has huge and complex genome (Salaminiet al 2002; peng et al 2011), and causes difficult fine positioning of QTL and difficult gene cloning. Comparative genomics studies have found that genes at most sites have collinearity between the genomes of rice and wheat (Sorrells et al 2003), many rice homologous genes related to grain weight traits have been cloned from wheat and functional markers have been developed.
Xu et al (2018) disclose the role of OsMKP1 in regulating rice grain size. Loss of function of OsMKP1 forms large kernels, while overexpression of OsMKP1 results in kernels becoming smaller. Further analysis showed that OsMKP1 was able to interact with OsMAPK6, dephosphorylating OsMAPK6, resulting in and inactivating it. Thus, these studies revealed an important mechanism for OsMKP1 to determine grain size by inhibiting MAPK signaling pathway.
KASP markers have been widely used to detect SNP sites in wheat, rice and maize crops (Ertiro et al 2015; chandra et al 2016; steele et al 2018), and can achieve high throughput genotyping without electrophoresis. The genetic type data of the wheat SNP chip is utilized to carry out QTL positioning and whole genome association analysis, and the linkage SNP is converted into KASP markers (Liu et al, 2016; raspeed, 2016, 2017; jia 2018; fu et al, 2020; jiang et al, 2021), so that the method can be directly applied to molecular marker assisted selective breeding.
Disclosure of Invention
In view of the above, the invention uses the rice with 5 varieties of high thousand grain weight and low thousand grain weight in 160 natural populations in Huang-Huai-Mai regionOsMKP1Is of homology to (2)TraesCS1A02G045300.2The gene is subjected to sequence analysis, and the fact that one base exists in the second exon and is mutated from T to C, so that isoleucine at a corresponding site is changed into valine, KASP (kalant single nucleotide polymorphism) markers are converted into the mutant site, and grain weight effect verification is performed in natural populations, so that the gene can be used for molecular marker assisted breeding.
The invention adopts the following specific scheme:
the present invention is directed to a KASP-labeled primer for detecting a wheat grain-weight-related gene of riceOsMKP1Is of homology to (2)TraesCS1A02G045300.2The KASP marked primer is a complete set primer consisting of a primer 1, a primer 2 and a primer 3;
the primer 1 sequentially comprises a tag sequence A and a sequence SEQ ID NO from the 5 'end to the 3' end: 01, single stranded DNA shown at positions 22-42;
the primer 2 sequentially comprises a tag sequence B and SEQ ID NO from the 5 'end to the 3' end: 02 at positions 22-42;
the primer 3 is SEQ ID NO: 03;
as a further optimization of the above KASP tagged primer, the tag sequence a is a FAM fluorescent tag sequence, and the nucleotide sequence thereof is as shown in SEQ ID NO:01 at positions 1-21; the tag sequence B is HEX fluorescent tag sequence, and the nucleotide sequence is shown in SEQ ID NO:02 from 1 to 21.
The invention also provides a kit for detecting the wheat grain weight related genes, which comprises the set of primersKasp-TraesCS1A02G045300.2。
The third object of the present invention is to provide a method for detecting or assisting in detecting wheatTraesCS1A02G045300.2A method of genotyping comprising the steps of:
step one, extracting genome DNA of wheat to be detected;
step two, taking the genome DNA of the wheat to be detected as a template, and adopting a set of primers to carry out PCR amplification to obtain an amplification product;
the complete set of primers consists of a primer 1, a primer 2 and a primer 3, wherein the nucleotide sequence of the primer 1 is shown in SEQ ID NO:01, the nucleotide sequence of the primer 2 is shown as SEQ ID NO:02, the nucleotide sequence of the primer 3 is shown as SEQ ID NO: shown as 03;
and thirdly, scanning fluorescent signals of the amplification products obtained in the second step, analyzing scanning data by Kmaster Caller software, and genotyping according to analysis results.
In the second step, the PCR amplification volume is 5 mu l, and the reaction system is as follows: 0.056 Mu.l Primer Mix, 2.5. Mu.l Master Mix, 2.2. Mu.l Template DNA (50 ng/. Mu.l), 0.244. Mu.l ddH2O; the Master Mix comprises a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B; the ratio of the Primer Mix is as follows: 12% of primer 1, 12% of primer 2 and 30% of primer 3.
In step three, wheat is determined as followsTraesCS1A02G045300.2Genotype: if fluorescence signal data of the wheat amplification product to be detected is analyzed by Klumer Caller software to be blue, the wheatTraesCS1A02G045300.2Genotype is TT; if fluorescence signal data of the wheat amplification product to be detected is analyzed by Klumter Caller software to be red, the wheatTraesCS1A02G045300.2Genotype is CC; if fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Klumter Caller software to be green, the wheatTraesCS1A02G045300.2Genotype is TC.
It is a fourth object of the present invention to provide the use of the KASP labeled primer, kit or method described above in any one of the following (a) - (F):
(A) The method comprises the following steps For detecting wheat or wheat impuritiesProgeny of the crossTraesCS1A02G045300.2A gene;
(B) The method comprises the following steps For identifying or aiding in identifying thousand kernel weight traits of wheat;
(C) The method comprises the following steps The method is used for cultivating, screening or assisting in screening single plants, strains or varieties of wheat with high or low thousand seed weight characteristics;
(D) The method comprises the following steps Preparation of a kit for detection of wheat or wheat hybrid progenyTraesCS1A02G045300.2A product of the gene;
(E) The method comprises the following steps Preparing a product for identifying or assisting in identifying thousand kernel weight traits of wheat;
(F) The method comprises the following steps The method is used for preparing products for cultivating, screening or assisting in screening single plants, strains or varieties of wheat with high or low thousand grain weight.
The beneficial effects are that: the invention designs a primer according to a key mutation site of a target base based on KASP technology, and uses the purpose of purposely matching the base at the tail end of the primer to genotype the corresponding SNP. The technology can detect a plurality of samples with high flux, greatly improves the detection efficiency, reduces the time and the labor cost, and is very beneficial to large-scale field screeningTraesCS1A02G045300.2The condition of high thousand grain weight genotype of the gene shortens wheatTraesCS1A02G045300.2The transformation process of the gene improves the breeding efficiency.
Drawings
FIG. 1 is a D3 primer amplificationTraesCS1A02G045300.2A gene agarose gel detection result diagram; in the figure, barra, aca 601, xinong 291, shaanxi 715, ningnong 15, zhou Mai, zhongyu No. 9, zhongyu 8425B, zhongmai 895, lu Yuan 502 and Marker are sequentially arranged from left to right;
FIG. 2 is a diagram showing alignment of sequence information in the vicinity of mutation sites;
FIG. 3 is a schematic diagram of a preferred embodiment of the present inventionKasp- TraesCS1A02G045300.2Genotyping results for 160 wheat varieties.
Detailed Description
The invention provides a SNP typing method with high throughput, low cost and low error rate, which is used for detecting thousand grain weightTraesCS1A02G045300.2KASP (KASP-related fragment size) labeled primer of gene, which can be used for molecular marker of thousand grain weight in breedingAuxiliary selection.
Principle of KASP: 3 primers are needed for amplification, two forward competitive primers (the 5 'end of the primer has a base sequence complementary to the fluorophores HEX and FAM, and other sequences only have differences at SNP and InDel at the 3' end) and one reverse common primer; the PCR reaction system contains a fluorescent group and a quenching group modified universal sequence (Master Mix is provided by LGC company), so that the forward primers can specifically bind DNA with the same genotype, the two forward primers can emit light with two different colors, if the locus in a template strand is homozygous, single fluorescence matched with the locus is emitted, and if the locus in the template strand is heterozygous, two kinds of fluorescence can be emitted simultaneously. The KASP labeling PCR amplification system comprises the following reaction systems in every 5 mu l: 0.056 Mu.l Primer Mix, 2.5. Mu.l Master Mix, 2.2. Mu.l Template DNA (50 ng/. Mu.l), 0.244. Mu.l ddH 2 O, master Mix was purchased from LGC company, and the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer, which were synthesized by Shanghai Yingjun company. Amplification was performed using a 384-well PCR apparatus (BIO-RAD, S1000TMthermal Cycler) as follows: 94 ℃ for 15 min;94 ℃ for 20s, 63-55 ℃ for 1 min (1 ℃ drop per cycle), 10 cycles; 94℃for 20s, 55℃for 60s,32 cycles. The final fluorescence data were read from the PCR amplified products in an autofocus fluorescence multifunctional microplate reader (PHERAstarplusSNP, BMG LABECH) and the data were then imported into Klustercaler v3.4 software (LGC, hoddesdon, UK) for genotyping.
Through published Chinese springTraesCS1A02G045300.2Gene sequence, 4 pairs of specific primers (Table 2) are designed to amplify Barra, aca 601, xinong 291, shaan 715, ningnong 15, zhou Mai 18, zhongyu No. 9, zhongfeng 8425B, zhongmai 895 and Luyuan 502 materialsTraesCS1A02G045300.2Sequencing the whole gene sequence by using a gene engineering company, comparing related sequences by using DNAMAN software to find products of 10 varieties in the product sequences amplified by the primer T3TraesCS1A02G045300.2The base at 1648 downstream of the start codon of the gene sequence is mutated from T to C, resulting in the isoleucine at the corresponding position being changed to valine.
According to SNP mutation information characteristics, a specific set of KASP primers is designed, and consists of a primer 1, a primer 2 and a primer 3. The primer 1 is a single-stranded DNA at 22-42 positions of a tag sequence A and a sequence 1 in Table 1 from a 5 'end to a 3' end. Primer 2 is a single-stranded DNA at 22-42 positions of tag sequence B and sequence 2 in Table 1 in sequence from 5 'end to 3' end. Primer 3 is a single-stranded DNA having a nucleotide sequence shown as sequence 3 in Table 1.
Further, the nucleotide sequence of the tag sequence A is the 1 st-21 st position of the sequence 1 in the table 1, and the nucleotide sequence of the tag sequence B is the 1 st-21 st position of the sequence 2 in the table 1.
Specifically, primer 1 is a single-stranded DNA having a nucleotide sequence shown as sequence 1 in Table 1; primer 2 is single-stranded DNA with a nucleotide sequence shown as sequence 2 in Table 1; primer 3 is a single-stranded DNA having a nucleotide sequence shown as sequence 3 in Table 1.
The specific kit KASP primer is used for preparing and detecting thousand seed weight of wheatTraesCS1A02G045300.2The kit of the gene comprises the kit of the KASP primer, and also comprises a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B.
In the invention, the 5' end of the fluorescent probe A is connected with a fluorescent reporter group A; the 3' end of the quenching probe A is connected with a fluorescence quenching group; the 5' end of the fluorescent probe B is connected with a fluorescent reporter group B; the 3' end of the quenching probe B is connected with a fluorescence quenching group. Wherein the fluorescent reporter group A is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching group is BHQ.
In the present invention, the fluorescent probe A, the fluorescent probe B, the quenching probe A and the quenching probe B are present in a KASP 2X Master Mix, wherein the KASP 2X Master Mix is a product of LGC company, UK, catalog number KBS-1016-002 (a well plate of thousands 96/384 is applicable).
Detection or auxiliary detection of wheat to be testedTraesCS1A02G045300.2The method for genotyping the genes is a conventional method: taking the genome DNA of the wheat to be detected as a template, adopting the kit (the fluorescent group A is FAM and the fluorescent group B is HEX) to carry out PCR amplification, carrying out fluorescent signal scanning on the amplified product, adopting Kmaster teller software to analyze scanning data, and carrying out analysis according to the analysisThe analysis results were determined as followsTraesCS1A02G045300.2Genotype: if fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Klumter Caller software to be blue, the wheatTraesCS1A02G045300.2Genotype is TT; if fluorescence signal data of the amplified product of the wheat to be detected is analyzed by Klumter Caller software to be red, the wheat is wheatTraesCS1A02G045300.2The basic form is CC; if fluorescence signal data of the amplified product of the wheat to be detected is analyzed by Klumter Caller software to be green, waxy wheat is obtainedTraesCS1A02G045300.2The base form is TC.
The KASP-labeled primer can be used for detecting wheatTraesCS1A02G045300.2Gene and detection of wheat filial generationTraesCS1A02G045300.2The gene can also be applied to auxiliary selection of thousand grain weight of wheat seeds in wheat breeding.
The technical scheme of the invention will be clearly and completely described in the following in connection with the embodiments of the invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.
In the examples, the wheat has a thousand kernel weightTraesCS1A02G045300.2The gene high-throughput KASP marker design was developed with its specific primer sequence.
Through published Chinese springTraesCS1A02G045300.2Gene sequence, four pairs of specific primers (Table 2) are designed to amplify Barra, aca 601, xinong 291, shaan 715, ningnong 15, zhou Mai 18, zhongyu No. 9, zhongfeng 8425B, zhongmai 895 and Luyuan 502 materialsTraesCS1A02G045300.2The whole length of the gene sequence is cut into gel, recovered and sent to a gene engineering company for sequencing, DNAMAN software is utilized to compare related sequences to find that 10 varieties of products are in the sequence of the products amplified by the primer T3TraesCS1A02G045300.2The base at 1648 downstream of the start codon of the gene sequence is mutated from T to C, resulting in the isoleucine at the corresponding position being changed to valine.
TABLE 1 detection of thousand kernel weight genes in wheatKasp-TraesCS1A02G045300.2And (5) a primer sequence table.
Tag name Sequence name Sequence(s) Sequence Listing number
Kasp-TraesCS1A02G045300.2 1 GAAGGTGACCAAGTTCATGCTAGAGCGTATTGATCCCAGGAT SEQ ID NO：01
2 GAAGGTCGGAGTCAACGGATTAGAGCGTATTGATCCCAGGAC SEQ ID NO：02
3 AGTCATCTAATGCGGAACATTCG SEQ ID NO：03
Note that: in the table 1, the contents of the components,GAAGGTGACCAAGTTCATGCTin order to be a tag sequence 1,
GAAGGTCGGAGTCAACGGATTis tag sequence 2.
TABLE 2 amplificationTraesCS1A02G045300.2A primer sequence table of the gene.
Primer(s) Primer name Sequence(s) Product size (bp) Sequence Listing number
T1 TF1 CATACTTGTATGGTGCTCTCTCTG SEQ ID NO：04
TR1 CTTCACAAACTGGAATGCGTCA 1807 SEQ ID NO：05
T2 TF2 CACCGCGCCATCACTTAATTTTG SEQ ID NO：06
TR2 CTTCACAAACTGGAATGCGTCA 1528 SEQ ID NO：07
T3 TF3 GGACATCACCAGCATCCTCTAT SEQ ID NO：08
TR3 CCATTGGTATTACTCTTATCCGTGG 1254 SEQ ID NO：09
T4 TF4 TGCGGAACATTCGAAGCCCA SEQ ID NO：10
TR5 ACCAGCTACAGAAGTAAACTGACG 1324 SEQ ID NO：11
According to SNP mutation information characteristics, a specific set of KASP primers is designed, and consists of a primer 1, a primer 2 and a primer 3. The 3' -end of the two upstream primers (primer 1 and primer 2) is allelic variation base C/A, and the sequence of the downstream primer 3 is selected to ensure that the amplified fragment is 60-120bp. The 5' end of the upstream primer is connected with a fluorescent tag sequence, wherein the 5' end of the primer 1 is connected with a FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3', and the 5' end of the primer 2 is connected with a HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3'. The invention is based on thousand grain weight of wheatTraesCS1A02G045300.2The KASP marker developed by the gene and the special primer sequence thereof are composed of a sequence 1, a sequence 2 and a sequence 3 (shown in table 1), wherein an underlined sequence in the sequence 1 is a FAM linker sequence, and an underlined sequence in the sequence 2 is a HEX linker sequence.
Utilization of primer pairs:
the experimental materials were 160 wheat varieties, see in particular table 3.
1. Each experimental material was planted in the Anhui/28717 Lo in 2012-2013 and 2013-2014 years, 4 rows and 1.5m rows of each material were routinely managed, seeds were harvested after maturation, and thousand grain weights were measured by a thousand-grain weight analyzer by the ten thousand-deep company SC-G type automatic test.
2. By means ofKasp-TraesCS1A02G045300.2The label detects all experimental materials.
The results are shown in Table 3 and FIG. 2. Of 160 wheat varieties, 135 varieties show TT genotypes, and thousand grain weights of 42.56 g and 46.12 g in two years are respectively; 25 varieties showed CC genotypes, two years thousand grain weight 39.42 grams and 43.52 grams, respectively; statistical test displayKasp-TraesCS1A02G045300.2The gene effect reaches a significant differenceP<0.05）。
Table 3 genotyping results and thousand kernel weight for 160 wheat varieties.
Numbering device Variety of species Marking 13SX 14SX
1 Balance 7228 CC 44.83 47.25
2 Lu Yuan 502 CC 46.44 53
3 Balance 33 CC 43.92 45.5
4 Xinong 2000-7 CC 41.71 42.58
5 Middle 892 CC 52.08 51.92
6 Mantol CC 36.64 41.17
7 Aca 601 CC 30.47 31.38
8 Kitanokaori CC 31 31.08
9 Tobacco grower 15 CC 35.64 40.67
10 Sagittario CC 38.08 43.75
11 Ji chet 02-1 CC 37.44 39
12 Libero CC 31.45 38.83
13 Elytrigia minor 54 CC 39.61 43.83
14 Wennong 14 CC 42.03 45.08
15 Linmai No. 4 CC 43.08 48.83
16 Shijia village No. 8 CC 45.17 52.08
17 Nidera Baguette 20 CC 26.75 22.5
18 Linmai No. 2 CC 45.34 53.42
19 Aca 801 CC 30.88 41.58
20 Zijie No. 2 CC 35.67 40.17
21 West pesticide 291 CC 38.53 43.5
22 Ligusticum sinense 8901 CC 41.19 49.42
23 Jinan 13 CC 44.26 52.42
24 Klein Flecha CC 38.75 40.08
25 Zhongyu No. 5 CC 44.49 49.08
26 Yumai 57 TT 44.45 48.42
27 Zhou Mai 16 and Zhou Mai TT 50.06 52.92
28 Anhui wheat 33 TT 44 42.25
29 Zhengmai 366 TT 42.18 39.08
30 Yumai 49 TT 50.65 44.92
31 Dorico TT 39.42 45.58
32 No. 6 of Kangnong TT 34.59 39.75
33 Zhou Mai 32 and 5232 TT 45.53 48.58
34 Sink 0663 TT 43.96 47.33
35 View 35 TT 42.68 45.75
36 Yumai No. 7 TT 43.94 48.42
37 Sinong 979-005 TT 52.13 46.42
38 Zhou Mai 18 and 5218 TT 46.33 53.67
39 Zhou Mai 11 TT 41.97 46.92
40 Fu 936 TT 45.5 49.83
41 Zhongmai 875 TT 54.03 55.25
42 Yumai 34 TT 56.26 51.75
43 Zhou Mai 28 and 5228 TT 40.5 45.83
44 Zhongmai 895 TT 50.32 52.25
45 Zhou Mai 30A 30 TT 45.97 47.58
46 Dwarf antibody 58 TT 37.83 46.5
47 Interior village 188 TT 43.17 48.08
48 Barley 18 TT 46.08 48.92
49 Yumai 63 TT 47.82 48.17
50 Zhongmai 871 TT 41.99 45.5
51 Zhou Mai 31 and 31 TT 45.26 50.75
52 Zhou Mai 22 and 5222 TT 46 52.42
53 Shaan wheat 509 TT 43.37 44.08
54 Orchid 24 TT 42.73 51.75
55 Xinong 1376 TT 43.08 42.17
56 Zhou Mai 25 and 25 TT 37.02 41.08
57 Flower cultivation No. 5 TT 39.59 47.25
58 Zhou Mai 26 and 5226 TT 43.29 47
59 Orchid No. 2 TT 37.78 46.67
60 11CA40 TT 45.33 52.83
61 New wheat 19 TT 44.06 42.75
62 Huaimai 18 TT 40.75 44.08
63 Wennong No. 5 TT 37.58 45.67
64 Shan 253 TT 47.25 50
65 Zhou Mai 13 and 5213 TT 38.73 43.92
66 Yumai 47 TT 45.83 46.58
67 Yumai 35 TT 50.73 47.08
68 Week 8425B TT 50.9 61.67
69 Jimai 21 TT 48.43 49
70 Lu Mai 9 No. 9 TT 39.34 44.92
71 Anhui wheat 52 TT 41.09 42.25
72 Jin Mai 61 TT 50.03 55.75
73 An 1331 TT 42.23 45.58
74 Handan 6172 TT 43.8 47.08
75 Shaan 512 TT 42.63 44.08
76 Yumai 21 TT 38.17 43.67
77 Anhui wheat 38 TT 36.49 47.83
78 Jinhe 9123 TT 42.85 49.42
79 Anhui wheat 50 TT 49.75 49.42
80 New wheat No. 9 TT 42.13 45.75
81 Barra TT 25.67 30.33
82 Jimai 20 TT 44.43 44.33
83 Anhui 23094 TT 43.68 45
84 New wheat 9408 TT 44.83 45.5
85 Zhou Mai 19 and 19 TT 44.92 44.58
86 Huaimai 21 TT 38.04 40.58
87 Liangxing 66 TT 44.08 48.83
88 Jinan 17 TT 33.52 40.25
89 Shan 715 TT 33.08 34.92
90 Shannong 20 TT 42.92 43.25
91 Dan You 17 and 5217 TT 49 50.25
92 Zhou Mai 23 and 5223 TT 48.36 49.25
93 Wu Nong 148 and 148 TT 39.79 42.75
94 Shaan 354 TT 40.72 44.58
95 Bainong 64 TT 42.23 43.83
96 Shijia 15 TT 44.03 47.5
97 Lu Mai 6 No. Lu Mai TT 41.88 44.17
98 Lu Mai 23 and 5223 TT 45.93 56.83
99 Jining 16 TT 42.92 55
100 Zhou Mai 12 and 5212 TT 45.6 50.58
101 Elytrigia minor 6 TT 42.65 46.67
102 Lampo TT 37.37 36.25
103 Yumai 13 TT 42.51 48.92
104 Stone 4185 TT 39.56 43.33
105 Anhui wheat 53 TT 41.08 46.42
106 Yumai No. 2 TT 40 46.25
107 Zimai 12 TT 42.46 45.5
108 HK1/6/NVSR3/5/BEZ/TVR/5/CFN/BEZ//SU92/CI13645/3NAI60 TT 34.48 32.25
109 Lu Mai 7 No. 7 TT 45.5 40.58
110 Elytrigia repens 4110 TT 49.52 49.42
111 Genio TT 34.1 40.17
112 Jimai 22 TT 40.64 48.42
113 Elytrigia minor 81 TT 38.94 41.17
114 Orchid 906 TT 38.64 46.75
115 Jimai 19 TT 41.75 43.83
116 Stone 733 TT 44.68 47.5
117 Lu Mai 15 and 5215 TT 45.5 44
118 Shanyou 225 TT 33.58 42.25
119 Lomer 21 TT 47.93 51.5
120 Shaan wheat 94 TT 50.44 52.67
121 Zhengzheng 9023 TT 46.4 51.33
122 Zhongyu No. 9 TT 47.67 53.92
123 Liangxing 99 TT 47.5 50.75
124 PH82-2 TT 39 41.83
125 High-quality 503 TT 36.24 43.75
126 Lu Mai 14 and 5214 TT 40.72 44.58
127 Shan 150 TT 44.93 48.17
128 Shannong 78-59 TT 47.78 54.33
129 Norin 61 TT 35.12 40.58
130 Huaimai 20 TT 42.48 47.67
131 Lu Mai 11 TT 47.03 49.58
132 Taishan mountain No. 5 TT 41.15 46.33
133 Tobacco grower 18 TT 49.75 50.83
134 Shaan 229 TT 37.86 45.83
135 Tobacco grower 19 TT 42.25 47.08
136 Temporary antibody 12 TT 44.57 43.92
137 Dwarf Feng No. 3 TT 36.43 32.33
138 Nidera Baguette 10 TT 29.53 30.17
139 Lu Mai 21A 21 TT 36.42 47.08
140 Kanto 107 TT 35.95 38.75
141 Zhengzhen guide No. 1 TT 46.52 50.5
142 Norin 67 TT 34.75 35.5
143 Xinong 88 TT 38.07 42
144 Shannong 981 TT 47.91 50.5
145 Klein Jabal 1 TT 30.34 34.08
146 Lasiosphaera Seu Calvatia (L.) Kuntze TT 37 47.08
147 Interior village No. 5 TT 45.61 57.67
148 Bima1 No. TT 35.84 38.67
149 Bima4 No. 4 TT 39.52 41.83
150 Zhengzhou No. 3 TT 44.17 47.58
151 Sunstate TT 50.38 55.17
152 Taishan mountain No. 1 TT 36.5 44.33
153 Alfu (Alfu) TT 34.86 39.42
154 Anhui wheat 29 TT 41.93 43.42
155 Anhui wheat 19 TT 37.17 47.58
156 Yumai 50 TT 46.18 51.25
157 Elytrigia minor 22 TT 39.93 46.42
158 Lin-Han No. 2 TT 53.64 52.58
159 Bainong 3217 TT 38.92 39.08
160 High yield No. 3 TT 43.03 49.75
It should be noted that the above-mentioned embodiments are to be understood as illustrative, and not limiting, the scope of the invention, which is defined by the appended claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made to the present invention without departing from its spirit or scope.
SEQUENCE LISTING
<110> university of Henan science and technology
<120> labeled primer for detection of wheat grain weight-related Gene based on KASP technique and application
<130> 1
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 42
<212> DNA
<213> Synthesis
<400> 1
gaaggtgacc aagttcatgc tagagcgtat tgatcccagg at 42
<210> 2
<211> 42
<212> DNA
<213> Synthesis
<400> 2
gaaggtcgga gtcaacggat tagagcgtat tgatcccagg ac 42
<210> 3
<211> 23
<212> DNA
<213> Synthesis
<400> 3
agtcatctaa tgcggaacat tcg 23
<210> 4
<211> 24
<212> DNA
<213> Synthesis
<400> 4
catacttgta tggtgctctc tctg 24
<210> 5
<211> 22
<212> DNA
<213> Synthesis
<400> 5
cttcacaaac tggaatgcgt ca 22
<210> 6
<211> 23
<212> DNA
<213> Synthesis
<400> 6
caccgcgcca tcacttaatt ttg 23
<210> 7
<211> 22
<212> DNA
<213> Synthesis
<400> 7
cttcacaaac tggaatgcgt ca 22
<210> 8
<211> 22
<212> DNA
<213> Synthesis
<400> 8
ggacatcacc agcatcctct at 22
<210> 9
<211> 25
<212> DNA
<213> Synthesis
<400> 9
ccattggtat tactcttatc cgtgg 25
<210> 10
<211> 20
<212> DNA
<213> Synthesis
<400> 10
tgcggaacat tcgaagccca 20
<210> 11
<211> 24
<212> DNA
<213> Synthesis
<400> 11
accagctaca gaagtaaact gacg 24

Claims (6)

1. The KASP labeled primer for detecting the wheat grain weight related gene is characterized in that: the wheat grain weight related gene is riceOsMKP1Is of homology to (2)TraesCS1A02G045300.2The KASP marked primer is a complete set of primers consisting of a primer 1, a primer 2 and a primer 3A material;
the primer 1 sequentially comprises a tag sequence A and a sequence SEQ ID NO from the 5 'end to the 3' end: 01, single stranded DNA shown at positions 22-42; the tag sequence A is a FAM fluorescent tag sequence;
the primer 2 sequentially comprises a tag sequence B and SEQ ID NO from the 5 'end to the 3' end: 02 at positions 22-42; the tag sequence B is an HEX fluorescent tag sequence;
the primer 3 is SEQ ID NO: 03.
2. The KASP tagged primer of claim 1, wherein: the nucleotide sequence of the tag sequence A is shown as SEQ ID NO:01 at positions 1-21; the nucleotide sequence of the tag sequence B is shown as SEQ ID NO:02 from 1 to 21.
3. A kit for detecting a wheat grain weight-related gene, the kit comprising the KASP marker primer of claim 1.
4. Detection or auxiliary detection wheatTraesCS1A02G045300.2A method of genotyping characterized by: the method comprises the following steps:
step one, extracting genome DNA of wheat to be detected;
step two, taking the genome DNA of the wheat to be detected as a template, and adopting a set of primers to carry out PCR amplification to obtain an amplification product;
the complete set of primers consists of a primer 1, a primer 2 and a primer 3, wherein the nucleotide sequence of the primer 1 is shown in SEQ ID NO:01, the nucleotide sequence of the primer 2 is shown as SEQ ID NO:02, the nucleotide sequence of the primer 3 is shown as SEQ ID NO: shown as 03;
and thirdly, scanning fluorescent signals of the amplification products obtained in the second step, analyzing scanning data by Kmaster Caller software, and genotyping according to analysis results.
5. The method according to claim 4, wherein: in step three, wheat is determined as followsTraesCS1A02G045300.2Genotype: if fluorescence signal data of the wheat amplification product to be detected is analyzed by Klumer Caller software to be blue, the wheatTraesCS1A02G045300.2Genotype is TT; if fluorescence signal data of the wheat amplification product to be detected is analyzed by Klumter Caller software to be red, the wheatTraesCS1A02G045300.2Genotype is CC; if fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Klumter Caller software to be green, the wheatTraesCS1A02G045300.2Genotype is TC.
6. Use of a KASP-tagged primer of claim 1 or 2, a kit of claim 3, or a method of any one of claims 4-5 in any one of (a) - (F) as follows:
(A) The method comprises the following steps For detecting wheat or wheat filial generationTraesCS1A02G045300.2A gene;
(B) The method comprises the following steps For identifying or aiding in identifying thousand kernel weight traits of wheat;
(C) The method comprises the following steps The method is used for cultivating, screening or assisting in screening single plants, strains or varieties of wheat with high or low thousand seed weight characteristics;
(D) The method comprises the following steps Preparation of a kit for detection of wheat or wheat hybrid progenyTraesCS1A02G045300.2A product of the gene;
(E) The method comprises the following steps Preparing a product for identifying or assisting in identifying thousand kernel weight traits of wheat;
(F) The method comprises the following steps The method is used for preparing products for cultivating, screening or assisting in screening single plants, strains or varieties of wheat with high or low thousand grain weight.
CN202210165354.6A 2022-02-23 2022-02-23 Marker primer for detecting wheat grain weight related genes based on KASP technology and application Active CN114480713B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210165354.6A CN114480713B (en) 2022-02-23 2022-02-23 Marker primer for detecting wheat grain weight related genes based on KASP technology and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210165354.6A CN114480713B (en) 2022-02-23 2022-02-23 Marker primer for detecting wheat grain weight related genes based on KASP technology and application

Publications (2)

Publication Number Publication Date
CN114480713A CN114480713A (en) 2022-05-13
CN114480713B true CN114480713B (en) 2024-01-30

Family

ID=81483367

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210165354.6A Active CN114480713B (en) 2022-02-23 2022-02-23 Marker primer for detecting wheat grain weight related genes based on KASP technology and application

Country Status (1)

Country Link
CN (1) CN114480713B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116694809B (en) * 2023-07-13 2024-03-15 扬州大学 KASP primer group related to wheat grain weight and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3049172A1 (en) * 2016-12-21 2018-06-28 Institute Of Crop Sciences, The Chinese Academy Of Agricultural Sciences Plant grain trait-related protein, gene, promoter and snps and haplotypes
CN108977441A (en) * 2018-09-06 2018-12-11 中国农业科学院作物科学研究所 A kind of method and its primer special group of auxiliary identification Grain Weight in Common Wheat character
CN108998562A (en) * 2018-09-10 2018-12-14 中国农业科学院作物科学研究所 Based on grain length genetic marker and application under 895 genetic background of wheat in wheat breed
CN111394506A (en) * 2020-05-19 2020-07-10 黑龙江省农业科学院克山分院 Wheat molecular marker and application thereof in identification of wheat grain weight character

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3049172A1 (en) * 2016-12-21 2018-06-28 Institute Of Crop Sciences, The Chinese Academy Of Agricultural Sciences Plant grain trait-related protein, gene, promoter and snps and haplotypes
CN108977441A (en) * 2018-09-06 2018-12-11 中国农业科学院作物科学研究所 A kind of method and its primer special group of auxiliary identification Grain Weight in Common Wheat character
CN108998562A (en) * 2018-09-10 2018-12-14 中国农业科学院作物科学研究所 Based on grain length genetic marker and application under 895 genetic background of wheat in wheat breed
CN111394506A (en) * 2020-05-19 2020-07-10 黑龙江省农业科学院克山分院 Wheat molecular marker and application thereof in identification of wheat grain weight character

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"QTL cluster analysis and marker development for kernel traits based on DArT markers in spring bread wheat (Triticum aestivum L.)";Zhankui Zeng et al.;《Frontiers in Plant Science》;第1-13页 *

Also Published As

Publication number Publication date
CN114480713A (en) 2022-05-13

Similar Documents

Publication Publication Date Title
CN112080582B (en) KASP molecular marker closely linked with major QTL locus of wheat spike length and application thereof
CN108165656B (en) Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance
CN113584216B (en) Development and application of KASP marker of wheat grain weight gene TaCYP78A16
CN114134247B (en) Molecular marker closely linked with millet plant height character, primer sequence and application thereof
CN111893209B (en) Indel site detection marker related to thousand grain weight of wheat and application thereof
CN115029465B (en) KASP and dCAPS markers coseparated with rape seed secondary dormancy main effect QTL and application thereof
CN114480713B (en) Marker primer for detecting wheat grain weight related genes based on KASP technology and application
CN113151565A (en) Development and application of KASP marker of rice blast resistance gene Pi40
CN110373491B (en) KASP molecular marker for detecting rice blast-resistant broad-spectrum gene Pi1 and application
CN113832251B (en) SNP locus combination for detecting tomato mosaic virus resistance and application thereof
CN114480718B (en) Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit
CN113736866B (en) SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof
CN111363846B (en) Molecular marker for detecting wheat grain weight gene QTkw.saas-2D and application
CN114438244B (en) KASP (KASP-mediated isothermal amplification) marker for detecting wheat grain weight TaRSR-A1 gene and application thereof
CN107858448B (en) Single nucleotide polymorphism marker site, primer pair, kit and application for identifying peach pollen fertility character
ZHUANG et al. Development and chromosome mapping of new wheat EST-SSR markers and application for characterizing rye chromosomes added in wheat
CN113736906B (en) SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof
CN111235292B (en) Rye 4RS chromosome arm specific KASP molecular marker and application thereof
CN113699273B (en) SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof
CN117467790A (en) KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer
CN115747366A (en) Molecular marker closely linked with thousand-grain weight gene QTL of wheat and application thereof
CN117050991A (en) Method for identifying wheat powdery mildew resistance and primer group used by same
서정환 Molecular Diagnosis of Rice Genotypes Derived from Inter-subspecific Hybridization
CN116904636A (en) Molecular marker for detecting wheat stem WSC content QTL QWSC.caas-7DS and application
CN117126848A (en) Kit for identifying wheat powdery mildew resistance

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant