CN117467790A - KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer - Google Patents

KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer Download PDF

Info

Publication number
CN117467790A
CN117467790A CN202311263166.8A CN202311263166A CN117467790A CN 117467790 A CN117467790 A CN 117467790A CN 202311263166 A CN202311263166 A CN 202311263166A CN 117467790 A CN117467790 A CN 117467790A
Authority
CN
China
Prior art keywords
wheat
primer
molecular marker
plant height
kasp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311263166.8A
Other languages
Chinese (zh)
Inventor
杨莉
赵德辉
桑萌育
刘瑞芳
吕维娜
赵严
丁志强
段国辉
张学品
冯伟森
杨洪强
温红霞
张少澜
顾晶晶
李影
吴少辉
高海涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan University of Science and Technology
Luoyang Academy of Agriculture and Forestry Sciences
Original Assignee
Henan University of Science and Technology
Luoyang Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan University of Science and Technology, Luoyang Academy of Agriculture and Forestry Sciences filed Critical Henan University of Science and Technology
Publication of CN117467790A publication Critical patent/CN117467790A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a KASP molecular marker and a primer related to thousand grain weight and plant height of wheat and application thereof, belonging to the technical field of molecular genetic breeding, and the research is carried out on riceOsMKP1Is of homology to (2)TraesCS1D02G046000.2Sequence analysis of the gene revealed that there was a mutation of one base from A to C at 1245bp downstream of the second exon start codon, a KASP marker was converted to the mutation site, and a set of KASP primers was provided, which were used to make thousand grain weight and plant height of wheatTraesCS1D02G046000.2The detection of the gene has low human error and high analysis flux, and is suitable for the detection of a large number of samples. The co-dominant molecular marker provided by the invention is applied toTraesCS1D02G046000.2The gene transfer has the advantages of accelerating the genetic improvement of the thousand-grain weight and plant height genes of wheat, and improving the breeding efficiencyThe meaning is to be put into practice.

Description

KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer
Technical Field
The invention belongs to the technical field of molecular genetic breeding, and particularly relates to the development and application of a thousand-grain weight and plant height gene high-throughput KASP (Kompetitive Allele-Specific PCR) functional marker.
Background
Wheat is the crop with the largest global planting area, the annual planting area is about 2.2 hundred million hectares, the wheat accounts for about 1/6 of the world cultivated land area, and the annual yield is more than 7 hundred million tons, which is inferior to corn. Wheat yield per unit is a complex trait regulated by various direct and indirect genetic factors. Grain weight is one of the three most important traits of yield composition, and is mainly dependent on co-inheritance of factors such as grain size, morphology and texture. Studies of different annual cultivars have found that the increase in wheat yield per unit area in the last century is primarily dependent on an increase in grain count per unit area (Fischer 2008;Hawkesford et al.2013). Since 1980, the role of grain weight in yield enhancement was increasingly revealed (Calderini and Ortiz-Monasterio 2003;Sadras and Lawson 2011). The yield potential of Henan and Shandong wheat in China continues to increase in the past decades, and the number of grains per ear is significantly increased, wherein the grain weight in Henan province is also significantly increased (Zheng et al 2011; xiao et al 2012; gao et al 2017).
The wheat stalks serve as ground supporting organs, have the functions of a 'warehouse' and a part of a 'source', are intermediate bridges for connecting wheat leaves and grains, and are necessary routes for various physiological activities (Goodwin et al 2018). Too high wheat plants can cause lodging, leading directly to yield decline (Hedden, 2003), but too low plants can also cause crowding of canopy leaves, affect photosynthetic rates, can cause biomass that is too low to provide sufficient "source", and thus result in yield decline. Therefore, plant height should be reduced appropriately in order to increase the lodging resistance of plants and the harvest index of wheat (Peng et al 2014; ma Dongyun et al 2006). Currently, there are 25 formally named dwarf genes (Rht 1 to Rht 25), 19 of which have definite positions and are distributed on the following chromosomes, 2A (2), 2BL (1), 2DS (1), 3BS (1), 4BS (2), 4DS (2), 5AL (1), 5B (1), 5DL (1), 6AS (2), 6AL (2) 7AS (1), 7BS (2) respectively (Chen et AL 2015; peng et AL 2011; tian et AL 2017).
Xu et al (2018) disclose the role of OsMKP1 in regulating rice grain size. Loss of function of OsMKP1 forms large kernels, while overexpression of OsMKP1 results in kernels becoming smaller. Further analysis showed that OsMKP1 was able to interact with OsMAPK6, dephosphorylating OsMAPK6, resulting in and inactivating it. Thus, these studies revealed an important mechanism for OsMKP1 to determine grain size by inhibiting MAPK signaling pathway.
KASP markers have been widely used to detect SNP sites in wheat, rice and maize crops (Ertiro et al 2015; chandra et al 2016; steele et al 2018), and can achieve high throughput genotyping without electrophoresis. The genetic type data of the wheat SNP chip is utilized to carry out QTL positioning and whole genome association analysis, and the linkage SNP is converted into KASP markers (Liu et al, 2016; raspeed, 2016, 2017; jia 2018; fu et al, 2020; jiang et al, 2021), so that the method can be directly applied to molecular marker assisted selective breeding.
Disclosure of Invention
Aiming at the problems, the invention provides a high-throughput, low-cost and low-error-rate SNP typing method for detecting KASP (kal-specific amplified fragment) labeled primers of TraesCS1D02G046000.2 genes, which can be used for molecular marker assisted selection of thousand-grain weights and plant heights in breeding.
The invention adopts the following specific scheme:
in a first aspect, the invention provides a KASP molecular marker related to thousand kernel weight and plant height of wheat, wherein the molecular marker is KASP-traescs1d02g046000.2; the molecular marker corresponds to the base mutation from A to C at 1245bp downstream of the start codon of the second exon of the homologous TraesCS1D02G046000.2 gene of the rice OsMKP 1.
Preferably, the molecular marker is represented by the sequence shown in SEQ ID NO:01 to 03.
In a second aspect, the present invention provides a primer for amplifying the above molecular marker, wherein the primer is a KASP kit primer consisting of primer 1, primer 2 and primer 3;
the nucleotide sequence of the primer 1 is shown as SEQ ID NO:01 is shown in the figure;
the nucleotide sequence of the primer 2 is shown as SEQ ID NO:02, shown in the figure;
the nucleotide sequence of the primer 3 is shown as SEQ ID NO: shown at 03.
In a third aspect, the invention provides application of the primer in preparation of a kit for assisting in screening thousand kernel weight and plant height of wheat.
In a fourth aspect, the invention provides a kit for assisting in screening thousand kernel weight and plant height of wheat, which comprises the primer. Preferably, the kit further comprises a fluorescent probe a, a fluorescent probe B, a quenching probe a, a quenching probe B; the fluorescent probe A contains a fluorescent reporter gene FAM, and the fluorescent probe B contains a fluorescent reporter gene HEX.
In a fifth aspect, the present invention provides the use of a molecular marker, primer or kit as described above in any one of the following: a. detecting or assisting in detecting the genotype of TraesCS1D02G046000.2 of wheat and wheat filial generation;
b. screening or assisting in screening wheat grains related to thousand seed weight and plant height characters of wheat;
c. and (5) genetic improvement of wheat varieties.
In a sixth aspect, the present invention provides a method for detecting or assisting in detecting genotyping associated with thousand kernel weight and plant height traits of wheat, comprising the steps of:
step one, extracting genome DNA of wheat to be detected;
step two, taking the wheat genome DNA obtained in the step one as a template, and adopting a sequence shown in SEQ ID NO: carrying out PCR amplification by using a primer shown in 01-03;
and thirdly, scanning fluorescent signals of the amplification products obtained in the second step, and genotyping according to fluorescent colors.
The steps are as follows: the total volume of the amplification reaction is 5 μl, and the reaction system is as follows: 0.056. Mu.l of Primer Mix, 2.5. Mu.l of Master Mix, 2.2. Mu.l of Template DNA (50 ng/. Mu.l), 0.244. Mu.l of ddH2O, master Mix purchased from LGC company, the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer, which were synthesized by Shanghai Yingjun company. Amplification was performed using a 384-well PCR apparatus (BIO-RAD, S1000TMthermal Cycler) as follows: 94 ℃ for 15min;94 ℃ for 20s, 63-55 ℃ for 1min (1 ℃ for each cycle), 10 cycles; 94℃for 20s, 55℃for 60s,32 cycles. The final fluorescence data were read from the PCR amplified products in an auto-focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABECH) and the data were then imported into Klumtercalaller v3.4 software (LGC, hoddesdon, UK) for genotyping.
Preferably, in the third step, the genotyping is performed according to fluorescent color, specifically: if the fluorescence signal data of the wheat amplification product to be detected shows blue through analysis, the genotype of the wheat TraesCS1D02G046000.2 is AA; if the fluorescence signal data of the wheat amplification product to be detected is analyzed to be red, the genotype of the wheat TraesCS1D02G046000.2 is CC; if the fluorescence signal data of the wheat amplification product to be detected shows green through analysis, the genotype of the wheat TraesCS1D02G046000.2 is AC.
The study finds that a base mutation from A to C exists at 1245bp downstream of the start codon of the second exon through sequence analysis of the homologous TraesCS1D02G046000.2 gene of the rice OsMKP1, converts the mutation site into KASP marks, performs grain weight and plant height effect verification in 159 parts of natural populations of Huang-Huai wheat regions, and can be used for molecular marker assisted breeding. The three groups of KASP primers provided by the invention are used for detecting thousand grain weight and plant height TraesCS1D02G046000.2 genes of wheat, have low human error and high analysis throughput, and are suitable for detecting a large number of samples. The co-dominant molecular marker provided by the invention is applied to transformation of the TraesCS1D02G046000.2 gene, and has important practical significance for accelerating genetic improvement by utilizing the TraesCS1D02G046000.2 gene with thousand grain weight and plant height of wheat and improving breeding efficiency.
Drawings
FIG. 1 is a graph showing agarose gel detection results of TraesCS1D02G046000.2 gene of designed primer amplification Barra, nicotiana 15, wednesday 8425B and Zhongmai 895 materials;
FIG. 2 is a diagram showing comparison of sequence information of Barra, nicotiana 15, zhongfeng 8425B and Zhongmai 895 near mutation sites after specific primer T2 amplification;
FIG. 3 is a graph showing the genotyping results of Kasp-TraesCS1D02G046000.2 pairs of 159 wheat varieties.
Detailed Description
The invention provides a KASP marker Kasp-TraesCS1D02G046000.2 for screening thousand seed weight and plant height, and the sequence of the KASP marker Kasp-TraesCS1D02G046000.2 is shown in a primer sequence table (table 1).
Principle of KASP: 3 primers are needed for amplification, two forward competitive primers (the 5 'end of the primer has a base sequence complementary to the fluorophores HEX and FAM, and other sequences only have differences at SNP and InDel at the 3' end) and one reverse common primer; the PCR reaction system contains a fluorescent group and a quenching group modified universal sequence (Master Mix is provided by LGC company), so that the forward primers can specifically bind DNA with the same genotype, the two forward primers can emit light with two different colors, if the locus in a template strand is homozygous, single fluorescence matched with the locus is emitted, and if the locus in the template strand is heterozygous, two kinds of fluorescence can be emitted simultaneously. The KASP-labeled PCR amplification system was as follows for every 5. Mu.l of reaction system: 0.056. Mu.l Primer Mix, 2.5. Mu.l Master Mix, 2.2. Mu.l Template DNA (50 ng/. Mu.l), 0.244. Mu.l ddH 2 O, master Mix was purchased from LGC company, and the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer, which were synthesized by Shanghai Yingjun company. Amplification was performed using a 384-well PCR apparatus (BIO-RAD, S1000TMthermal Cycler) as follows: 94 ℃ for 15min;94 ℃ for 20s, 63-55 ℃ for 1min (1 ℃ for each cycle), 10 cycles; 94℃for 20s, 55℃for 60s,32 cycles. The final fluorescence data were read from the PCR amplified products in an auto-focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABECH) and the data were then imported into Klumtercalaller v3.4 software (LGC, hoddesdon, UK) for genotyping.
4 pairs of specific primers (Table 2) are designed to amplify the full length of the traescs1D02G046000.2 gene sequences of Barra, nicotiana 15, zhongmai 8425B and Zhongmai 895 materials through published traescs1D02G046000.2 gene sequences, target fragments are recovered through cutting glue, purified DNA fragment connecting vectors, monoclonal is selected, sequencing is carried out by a gene company, DNAMAN software is utilized to compare related sequences, and the base mutation from A to C is found at 1245bp downstream of the initiation codon of the traescs1D02G046000.2 gene sequences in the product sequence amplified by the primer T2. The four pairs of primer sequence information are shown in Table 2.
According to the SNP mutation information characteristics, a specific set of KASP primers is designed, consisting of primer 1 (SEQ ID NO: 01), primer 2 (SEQ ID NO: 02) and primer 3 (SEQ ID NO: 03) (Table 1). The primer 1 is sequentially a tag sequence A and 22-42 single-stranded DNA of a sequence 1 in a sequence table from a 5 'end to a 3' end; the primer 2 is sequentially a tag sequence B and 22-42 single-stranded DNA of a sequence 2 in a sequence table from a 5 'end to a 3' end; the primer 3 is single-stranded DNA with a nucleotide sequence shown as a sequence 3 in a sequence table.
Further, the nucleotide sequence of the tag sequence A is the 1 st-21 st position of the sequence 1 in the sequence table, and the nucleotide sequence of the tag sequence B is the 1 st-21 st position of the sequence 2 in the sequence table.
More specifically, the primer 1 is single-stranded DNA with a nucleotide sequence shown as a sequence 1 in a sequence table; the primer 2 is single-stranded DNA with a nucleotide sequence shown as a sequence 2 in a sequence table; the primer 3 is single-stranded DNA with a nucleotide sequence shown as a sequence 3 in a sequence table.
The kit for detecting the thousand-grain weight and plant height TraesCS1D02G046000.2 genes of wheat provided by the invention comprises the complete set of KASP primers, and also comprises a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe A.
In the invention, the fluorescent reporter group A is FAM, the fluorescent reporter group B is HEX, and the fluorescent quenching group is BHQ.
In the present invention, the fluorescent probe A, the fluorescent probe B, the quenching probe A and the quenching probe B are present in a KASP 2X Master Mix, wherein the KASP 2X Master Mix is a product of LGC company, UK, catalog number KBS-1016-002 (a well plate of thousands 96/384 is applicable).
The invention provides application of the KASP labeled primer, which is used for detecting the wheat TraesCS1D02G046000.2 gene.
The method for detecting or assisting in detecting the genotype of the wheat TraesCS1D02G046000.2 gene to be detected is a conventional method: taking the genome DNA of the wheat to be detected as a template, adopting the kit (the fluorescent group A is FAM and the fluorescent group B is HEX) to carry out PCR amplification, carrying out fluorescent signal scanning on the amplified product, adopting Kmaster Caller software to analyze scanning data, and determining the genotype of the wheat TraesCS1D02G046000.2 according to the analysis result as follows: if fluorescence signal data of a product amplified by the wheat to be detected is blue through Klumter Caller software analysis, the genotype of the wheat TraesCS1D02G046000.2 is AA; if fluorescence signal data of a product amplified by the wheat to be detected is red through Klumter Caller software analysis, the wheat TraesCS1D02G046000.2 basic type is CC; if the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Klumter Caller software to be green, the wheat TraesCS1D02G046000.2 basic type is AC.
The above KASP-labeled primer can also be used to detect the TraesCS1D02G046000.2 gene of wheat filial generation.
The invention designs a primer according to a key mutation site of a target base based on KASP technology, and uses the purpose of purposely matching the base at the tail end of the primer to genotype the corresponding SNP. The technology can detect a plurality of samples with high flux, greatly improves the detection efficiency, reduces the time and labor cost, is very beneficial to the field large-scale screening of the conditions of high thousand grain weight and plant height of the TraesCS1D02G046000.2 gene, shortens the transformation process of the wheat TraesCS1D02G046000.2 gene, and improves the breeding efficiency.
The molecular marker can be applied to auxiliary selection of thousand grain weight and plant height of wheat seeds in wheat breeding.
The technical scheme of the invention will be clearly and completely described in the following in connection with the embodiments of the invention.
The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.
In the examples, the high-throughput KASP marker design of the TraesCS1D02G046000.2 gene of thousand kernel weight and plant height of wheat was developed with its special primer sequence.
Four pairs of specific primers (Table 2) are designed to amplify the full length of the TraesCS1D02G046000.2 gene sequences of Barra, nicotiana 15, zhongmai 8425B and Zhongmai 895 materials through published TraesCS1D02G046000.2 gene sequences, target fragments are recovered through cutting glue, purified DNA fragment connecting vectors, monoclonal is selected, sequencing is carried out by a gene company, DNAMAN software is utilized to compare related sequences, and the base of the primer T2 amplified product is mutated from A to C at 1245bp downstream of the initiation codon of the TraesCS1D02G046000.2 gene sequence.
According to SNP mutation information characteristics, a specific set of KASP primers is designed, and consists of a primer 1, a primer 2 and a primer 3. The 3' -end of the two upstream primers (primer 1 and primer 2) is allelic variation base C/A, and the sequence of the downstream primer 3 is selected to ensure that the amplified fragment is 60-120bp. The 5' end of the upstream primer is connected with a fluorescent tag sequence, wherein the 5' end of the primer 1 is connected with a FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3', and the 5' end of the primer 2 is connected with a HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3'. The invention discloses a KASP marker developed based on wheat thousand seed weight and plant height TraesCS1D02G046000.2 gene and a special primer sequence thereof, wherein the sequence comprises a sequence 1, a sequence 2 and a sequence 3, an underlined sequence in the sequence 1 is a FAM street sequence, and an underlined sequence in the sequence 2 is a HEX joint sequence.
Utilization of primer pairs:
the experimental materials were 159 wheat varieties, see in particular table 3.
1. Each experimental material was planted in the Anhui, 28627, 2 nd year 2012-2013 and 2013-2014, each material was 4 rows and 1.5m rows long, the management was conventional, the plant height was measured after maturation and the seeds were harvested, and the thousand-grain weight was measured by the ten thousand-deep company SC-G type automatic seed test and thousand-grain weight analyzer.
2. All experimental materials were tested using the Kasp-TraesCS1D02G046000.2 label.
The results are shown in Table 3 and FIG. 2. Of 159 wheat varieties, 101 varieties showed AA genotype, and two years thousand grain weight and plant height were 41.3 g and 45.0 g, 82.8 cm and 85.6 cm, respectively; 58 varieties show CC genotypes, and the thousand grain weights and plant heights are 43.7 g and 47.4 g, 76.0 cm and 78.7 cm in two years respectively; statistical tests showed that the gene effect of Kasp-TraesCS1D02G046000.2 reached a significant difference (P < 0.05).
Table 1 contains a sequence table of Kasp-TraesCS1D02G046000.2 primers for detecting thousand kernel weight and plant height genes of wheat.
Note that:GAAGGTGACCAAGTTCATGCTin order to be a tag sequence 1,
GAAGGTCGGAGTCAACGGATTis tag sequence 2.
Table 2 primer sequence listing for amplifying TraesCS1D02G046000.2 gene.
Table 3 genotype test results and thousand kernel weight and plant height for 159 wheat varieties.
/>
It should be noted that the above-mentioned embodiments are to be understood as illustrative, and not limiting, the scope of the invention, which is defined by the appended claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made to the present invention without departing from its spirit or scope.

Claims (9)

1. A KASP molecular marker associated with thousand kernel weight and plant height of wheat, characterized in that: the molecular marker isKasp- TraesCS1D02G046000.2The method comprises the steps of carrying out a first treatment on the surface of the The molecular marker corresponds to riceOsMKP1Is of homology to (2)TraesCS1D02G046000.2The base mutation from A to C is carried out at 1245bp downstream of the start codon of the second exon of the gene.
2. The molecular marker of claim 1, wherein: the molecular marker passes through a sequence shown as SEQ ID NO: and (3) amplifying the primer shown in 01-03.
3. A primer for amplifying the molecular marker of claim 1, characterized in that: the primer is a KASP complete set primer consisting of a primer 1, a primer 2 and a primer 3;
the nucleotide sequence of the primer 1 is shown as SEQ ID NO:01 is shown in the figure;
the nucleotide sequence of the primer 2 is shown as SEQ ID NO:02, shown in the figure;
the nucleotide sequence of the primer 3 is shown as SEQ ID NO: shown at 03.
4. Use of the primer according to claim 3 for preparing a kit for assisting in screening thousand kernel weight and plant height of wheat.
5. A kit for assisting in screening thousand seed weight and plant height of wheat is characterized in that: the kit comprises the primer of claim 3.
6. The kit of claim 5, wherein: the kit also comprises a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B; the fluorescent probe A contains a fluorescent reporter gene FAM, and the fluorescent probe B contains a fluorescent reporter gene HEX.
7. Use of the molecular marker of claim 1, the primer of claim 3 or the kit of claim 5 in any of the following:
a. detection or auxiliary detection of wheat and wheat filial generationTraesCS1D02G046000.2Genotype;
b. screening or assisting in screening wheat grains related to thousand seed weight and plant height characters of wheat;
and (5) genetic improvement of wheat varieties.
8. A method for detecting or assisting in detecting genotyping related to thousand kernel weight and plant height traits of wheat, which is characterized in that: the method comprises the following steps:
step one, extracting genome DNA of wheat to be detected;
step two, taking the wheat genome DNA obtained in the step one as a template, and adopting a sequence shown in SEQ ID NO: carrying out PCR amplification by using a primer shown in 01-03;
and thirdly, scanning fluorescent signals of the amplification products obtained in the second step, and genotyping according to fluorescent colors.
9. The method according to claim 8, wherein: in the third step, genotyping is performed according to the fluorescence color, specifically: if the fluorescence signal data of the amplified product of the wheat to be detected shows blue through analysis, the wheatTraesCS1D02G046000.2Genotype is AA; if the fluorescence signal data of the amplified product of the wheat to be detected is analyzed to be red, the wheatTraesCS1D02G046000.2Genotype is CC; if the fluorescence signal data of the amplified product of the wheat to be detected is analyzed to be green, the wheatTraesCS1D02G046000.2Genotype is AC.
CN202311263166.8A 2022-12-15 2023-09-27 KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer Pending CN117467790A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022116157661 2022-12-15
CN202211615766 2022-12-15

Publications (1)

Publication Number Publication Date
CN117467790A true CN117467790A (en) 2024-01-30

Family

ID=89638745

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311263166.8A Pending CN117467790A (en) 2022-12-15 2023-09-27 KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer

Country Status (1)

Country Link
CN (1) CN117467790A (en)

Similar Documents

Publication Publication Date Title
CN111893209B (en) Indel site detection marker related to thousand grain weight of wheat and application thereof
CN110747288A (en) Rice large grain gene function marker and application
CN110894542A (en) Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer
CN115029465B (en) KASP and dCAPS markers coseparated with rape seed secondary dormancy main effect QTL and application thereof
CN112266975B (en) Primer group and kit for detecting KASP marker related to POD activity of wheat grains and application of kit
CN113151565A (en) Development and application of KASP marker of rice blast resistance gene Pi40
CN114480713B (en) Marker primer for detecting wheat grain weight related genes based on KASP technology and application
CN109811077B (en) KASP marker closely linked with wheat dwarf gene and application thereof
CN108531642B (en) SSR molecular markers for identifying corn varieties and application thereof
CN117467790A (en) KASP molecular marker and primer related to thousand grain weight and plant height of wheat and application of KASP molecular marker and primer
CN111778262B (en) Early-maturing gene eam.z and molecular marker SNP595 and application thereof
CN111118192B (en) KASP molecular marker of wheat ear base small ear fruition main effect QTL and application thereof
CN111004857B (en) Molecular marker primer of soybean branch number major QTL locus and application thereof
CN113881799A (en) Functional molecular marker for screening/detecting main effect resistance locus of tobacco root black rot and application thereof
Wang et al. A novel Effective Panicle Number per Plant 4 haplotype enhances grain yield by coordinating panicle number and grain number in rice
CN112593006B (en) Wheat green-extending character main effect QTL locus, KASP primer closely linked with same and application of KASP primer
CN114438244B (en) KASP (KASP-mediated isothermal amplification) marker for detecting wheat grain weight TaRSR-A1 gene and application thereof
Wang et al. QTL localisation of seed-related traits in Tibetan hulless barley based on a high-density single-nucleotide polymorphism genetic map.
CN112048569B (en) Molecular marker coseparated with wheat low polyphenol oxidase activity gene QPpo-5D
CN111118191B (en) KASP molecular marker of wheat head top spikelet fructicity main effect QTL and application thereof
CN111235292B (en) Rye 4RS chromosome arm specific KASP molecular marker and application thereof
CN108265124B (en) Molecular marker associated with rape root surface area and application thereof
CN115747366A (en) Molecular marker closely linked with thousand-grain weight gene QTL of wheat and application thereof
CN117887890A (en) SNP molecular marker related to wheat grain protein content, KASP primer pair and application thereof
CN117248065A (en) Molecular marker of total root tip number QNRT.caas-5D of wheat and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination