CN113005041B - Diamond algae, culture method thereof and application thereof in super-salt oil production - Google Patents
Diamond algae, culture method thereof and application thereof in super-salt oil production Download PDFInfo
- Publication number
- CN113005041B CN113005041B CN202110308844.2A CN202110308844A CN113005041B CN 113005041 B CN113005041 B CN 113005041B CN 202110308844 A CN202110308844 A CN 202110308844A CN 113005041 B CN113005041 B CN 113005041B
- Authority
- CN
- China
- Prior art keywords
- culture
- rhombohedral
- algae
- illumination
- erdschreiber
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/12—Unicellular algae; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
- C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
Abstract
The invention discloses a rhombohedral algae, a culture method thereof and application thereof in super-salt oil production. The rhombohedral algae has no adverse effect on the growth of the rhombohedral algae SDEC-27 by adding NaCl in a seawater Erdschreiber's culture medium, but can stimulate the rhombohedral algae to accumulate grease and improve the grease yield. The seawater-kitchen waste anaerobic digestion solution is used as a substitute culture medium, and the biomass yield and the grease yield of the rhombohedral alga SDEC-27 are higher than those of a seawater Erdschreiber's culture medium. The salt-tolerant high-oil-yield rhombohedral algae provided by the invention can grow in a super-salt environment and efficiently accumulate grease, can also accumulate biomass and grease in seawater-kitchen waste anaerobic digestion liquid in a manner of not consuming fresh water and chemical nutrient salt, and has obvious economic benefits and environmental benefits.
Description
Technical Field
The invention belongs to the technical field of microalgae biology, and relates to rhombohedral algae, a culture method thereof and application thereof in hypersaline oil production.
Background
The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.
The microalgae has the capability of synthesizing energy substances such as substances required by the microalgae, lipid and the like by using light energy, inorganic carbon and inorganic salt, has the characteristics of short growth cycle, strong environmental adaptability, no competition with agriculture and the like, successfully becomes the power for relieving the global energy pressure and promoting sustainable development, and has attracted wide attention of governments, people and scientists of all countries in the world. The basic and application researches on microalgae morphology, physiological metabolism and secondary metabolite show that high production cost and low oil yield caused by chemical nutritive salt and fresh water investment are still the primary factors restricting the large-scale development and application of microalgae bioenergy.
The production of microalgae biomass by using wastewater instead of a chemical culture medium is a hot means for reducing the production cost at present, but also faces adverse factors such as complex and variable wastewater environment, fresh water and energy consumption in pretreatment and the like, and still has the problems of unstable yield of biomass and grease and high production cost. In a natural environment, microalgae are various in types, wide in distribution and strong in viability, and a good foundation is provided for screening algae strains.
Disclosure of Invention
Aiming at the problems of low fresh water consumption and low grease yield, the method for screening the ultra-salt-tolerant and high-yield oil algae strains so as to introduce seawater into the microalgae bioenergy production process and establish the culture method of microalgae in the salt environment such as seawater and even in the seawater coupling wastewater environment can avoid the input of fresh water and chemical nutritive salt, is a key step for promoting the large-scale production and application of microalgae bioenergy, and has both economic benefit and environmental benefit. Therefore, the invention aims to provide the rhombohedral algae, the culture method thereof and the application thereof in the super-salt oil production.
In order to achieve the purpose, the technical scheme of the invention is as follows:
in the first aspect, the rhombohedral alga is M2021192 with the preservation number of CCTCC NO, the preservation date is 25 months at 2 years at 2021, the preservation unit is the China center for type culture Collection, is named as Nitzschia sp. The rhombohedral alga SDEC-27 can tolerate the NaCl concentration of more than 50g/L, is rich in grease, has the content of 33-55% of the dry weight of cells, can be used as a raw material of biodiesel, and can be cultured by using seawater to replace fresh water as a culture medium.
In a second aspect, the culture medium is an Erdschreiber's culture medium additionally added with NaCl, the concentration of the additionally added NaCl is 0-20 g/L, and the concentration of the additionally added NaCl is not 0.
In a third aspect, a method for culturing the rhombohedral algae comprises the steps of placing the rhombohedral algae in an Erdschreiber's culture medium for enrichment culture, inoculating the rhombohedral algae after enrichment culture in the culture medium, and performing illumination culture.
In a fourth aspect, a method for culturing the rhombohedral algae comprises the steps of placing the rhombohedral algae in an Erdschreiber's culture medium for enrichment culture, inoculating the rhombohedral algae after enrichment culture in a culture mixed solution, and performing illumination culture; the culture mixed liquid is a mixed liquid of seawater and kitchen waste anaerobic digestion liquid.
In a fifth aspect, the rhombohedral algae are applied to super-salt oil production.
In a sixth aspect, the culture method of the rhombohedral algae is applied to production of grease.
In the seventh aspect, the super-salt-tolerant high-oil-yield microbial inoculum is obtained by the culture method.
The invention has the beneficial effects that: the invention separates, purifies and screens wetland water which is easy to generate water bloom to obtain a super salt-tolerant oil-rich rhombohedral alga SDEC-27(Nitzschia sp. SDEC-27), and the alga can be better adapted to a seawater culture medium. The rhombohedral alga SDEC-27 of the invention grows rapidly in Erdschreiber's medium with added NaCl and obtains higher oil content and yield than the Erdschreiber's medium. In addition, the rhombohedral alga SDEC-27 disclosed by the invention grows well in a culture solution prepared from seawater and kitchen waste anaerobic digestion solution, accumulates the oil content and yield higher than an Erdschreiber's culture medium, and has the potential of application in a culture mode without consuming fresh water resources.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
FIG. 1 is a photomicrograph of the Diatom rhombifolia SDEC-27 provided by an embodiment of the present invention;
FIG. 2 is a phylogenetic tree of the rhombohedral alga SDEC-27 provided by an embodiment of the present invention;
FIG. 3 is a graph showing the production of oil and fat and the yield of the rhombohedral alga SDEC-27 in Erdschreiber's medium and Erdschreiber's medium with salt according to the present invention;
FIG. 4 is a graph showing the oil production and yield of the rhombohedral alga SDEC-27 in Erdschreiber's medium and seawater-wastewater culture solution according to the present invention.
Detailed Description
It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.
In view of the problems of low fresh water consumption and low oil yield of the existing method for preparing oil by using microorganisms through a biological method, the invention provides a rhombohedral algae, a culture method thereof and application thereof in super-salt oil production.
The invention provides a typical implementation mode of rhombohedral alga, which has a preservation number of CCTCC NO of M2021192, a preservation date of 2021, 2 months and 25 days, is a China center for type culture Collection, is named as Nitzschia sp.SDEC-27 and is separated from an artificial wetland in which water bloom easily occurs. The rhombohedral alga SDEC-27 can tolerate the NaCl concentration of more than 50g/L, is rich in grease, has the content of 33-55% of the dry weight of cells, can be used as a raw material of biodiesel, and can be cultured by using seawater to replace fresh water as a culture medium.
In another embodiment of the invention, a culture medium for culturing the above rhombohedral algae is provided, wherein the culture medium is an Erdschreiber's culture medium additionally added with NaCl, the concentration of the additionally added NaCl is 0-20 g/L, and the concentration of the additionally added NaCl is not 0.
The Erdschreiber's medium may be commercially available or may be self-configured. In the self-configuration, the components and the dosage are as follows: 1L/L of seawater, 12mL/L of P-IV metal solution and NaNO3 195.5mg/L，Na2HPO4·7H218.0mg/L of O, 50mL/L of soil extract, 120.135mg/L of vitamin B, 8.2-8.2 of initial pH and 55-56 mS/cm of conductivity.
The composition of the P-IV metal solution is as follows: distilled water 1L/L, Na2EDTA·2H2O0.75 g/L，FeCl3·6H2O0.097 g/L，MnCl2·4H2O 0.041g/L，ZnCl2 0.005g/L，CoCl2·6H2O 0.002g/L，Na2MoO4·2H2O 0.004g/L。
The preparation method of the soil extracting solution comprises the following steps: weighing 200g of soil rich in humus in a triangular flask, adding 1L of distilled water, and sealing with a breathable cotton plug; continuously boiling in a boiling water bath for 3h, precipitating for 24h, and repeating for 3 times; filtering to obtain the final product.
Experiments prove that the grease yield of the rhombohedral alga SDEC-27 provided by the invention in a culture medium with salt Erdschreiber's is nearly 1 time higher than that in the culture medium without the salt Erdschreiber's, and grease accumulation of the rhombohedral alga SDEC-27 is greatly promoted in an ultra-salt environment. When the concentration of the additionally added NaCl is 9.6-10.4 g/L, the oil yield is higher. In some embodiments, the concentration of the additional NaCl is 9.6-10.4 g/L. The oil yield of the rhombohedral alga SDEC-27 in the Erdschreiber's culture medium with salt is improved by nearly 1 time compared with that in the Erdschreiber's culture medium without salt, and the oil accumulation of the rhombohedral alga SDEC-27 is greatly promoted in a super-salt environment. When the concentration of the additionally added NaCl is 9.6-10.4 g/L, the oil yield is higher.
In a third embodiment of the present invention, a method for culturing the above rhombohedral algae is provided, the rhombohedral algae is placed in an Erdschreiber's culture medium for enrichment culture, and the rhombohedral algae after enrichment culture is inoculated in the culture medium for illumination culture.
The grease content and the yield of the nitzschia SDEC-27 provided by the invention in an Erdschreiber's culture medium are respectively 33% -35% and 102-110 mg/L, and the grease content and the yield in the Erdschreiber's culture medium added with a NaCl solution are respectively 48% -58% and 141-157 mg/L. Therefore, the addition of NaCl to the Erdschreiber's medium greatly promotes the oil accumulation of the rhombohedral alga SDEC-27, does not affect the growth of the rhombohedral alga SDEC-27, and shows the tolerance of the rhombohedral alga SDEC-27 to a high-salt environment and the oil accumulation capacity in the high-salt environment.
In some embodiments, the temperature of the enrichment culture is 24-26 ℃. The illumination intensity of the enrichment culture is 2000-2100 lux. The illumination used is full-wavelength light (full light). The enrichment culture time is 6-8 d. And after enrichment culture, centrifugally collecting algae cells and washing with water to obtain the mud to be inoculated with the rhombohedral algae.
In some embodiments, the temperature of the light culture is 24-26 ℃. The illumination intensity of illumination culture is 2000-4000 lux. The illumination used is full illumination. The illumination culture time is that the rhombohedral alga SDEC-27 grows to a stable phase. The initial inoculation density of the illumination culture is (1-9) multiplied by 106cell/mL。
The fourth embodiment of the invention provides a method for culturing the rhombohedral algae, which comprises the steps of putting the rhombohedral algae into an Erdschreiber's culture medium for enrichment culture, inoculating the rhombohedral algae after enrichment culture into a culture mixed solution, and performing illumination culture; the culture mixed liquid is a mixed liquid of seawater and kitchen waste anaerobic digestion liquid.
The enrichment culture process is the same as that of the third embodiment.
The process of the light culture is the same as the enrichment culture process of the third embodiment.
In some embodiments, the volume of the anaerobic digestion solution of the kitchen waste in the culture mixed solution is 0.5-1.5% of that of seawater.
The fifth embodiment of the invention provides an application of the rhombohedral algae in super-salt oil production.
In a sixth embodiment of the present invention, there is provided an application of the above culture method for rhombohedral algae in the production of oil and fat.
The seventh embodiment of the invention provides a super-salt-tolerant high-oil-yield microbial inoculum obtained by the culture method.
Specifically, the microbial inoculum is a liquid microbial inoculum or powder.
The preparation process of the powder is to freeze and dry the cultured algae mud.
In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.
Example 1: separation and identification of Sdcium rhombifolium SDEC-27
Firstly, collecting samples
And collecting water samples from the wetland of the Shandong Jinnan Jixi country in 25 months in 2020.
Second, separation and purification of the rhombohedral alga SDEC-27
A separation and purification step: the retrieved water sample is added with Erdschreiber's culture medium for amplification culture after being centrifugally concentrated, the algae density is calculated by counting under a microscope through a haemocyte counting method after about 7d, and then the algae liquid is diluted to about 0.9cell/50 mu L according to the algae density. In a clean bench, 50. mu.L of diluted algae solution was placed in wells of a 96-well plate, 200. mu.L of Erdschreiber's medium was added to each well in advance, and the plate was sealed with a sealing film to prevent evaporation of the solution. Culturing the culture plate in a light incubator for 10 days, and observing the algae growing in the small holes under an inverted microscope and marking the single-cell holes. When the number of the cells in the single-cell well to be marked is increased to more than 500 or the cells appear colors, the algae cells in the single-cell well are transferred into a sterilized triangular flask filled with 10mL Erdschreiber's culture medium, sealed by a cotton plug and placed in an illumination incubator for culture. The obtained pure algae strain is inoculated into an Erdschreiber's culture medium added with NaCl to check whether the pure algae strain is tolerant to a super-salt environment, and a pure algae strain is finally obtained after screening and named as SDEC-27.
Identification of Scenedesmus SDEC-27
1. Morphological identification of Sdcec-27
Morphological characteristics of the rhombohedral alga SDEC-27: the algae cells are yellow green under an optical microscope, mostly single cells, short wedges at two ends and gradually narrowed, and the ends of the algae cells are sharp and round. The width of a single cell is 2.7-4.3 μm, the length is 14.1-14.6 μm, and the shape of the single cell accords with the characteristics of the rhombohedral algae. The microstructure is shown in FIG. 1.
2. Molecular biological identification of Sdcec-27 from Trapa japonica
And (3) centrifugally collecting algae cells in the logarithmic growth phase, extracting genome DNA by using a fungus genome DNA extraction kit, and carrying out 18S rDNA amplification on the genome DNA. The PCR amplification system was 50. mu.L, including 0.5. mu.L of DNA sample, 10 XBuffer (Mg)2+) 2.5. mu.L, 1. mu.L of dNTPs (2.5 mM each), 0.2. mu.L of enzyme, 0.5. mu.L of forward primer (10. mu.M), 0.5. mu.L of reverse primer (10. mu.M)L，ddH2O25. mu.L. The PCR amplification program is pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45s, renaturation at 55 ℃ for 45s, extension at 72 ℃ for 1min, and repeating for 30 cycles; extension at 72 ℃ for 10 min.
The upstream and downstream primers are respectively: GTAGTCATATGCTTGTCTC (NS1, see SEQ ID NO.1) and GCATCACAGACCTGTTATTGCCTC (NS6, see SEQ ID NO. 2).
The PCR amplification products were subjected to sequencing by Biotechnology engineering (Shanghai) Ltd. The PCR amplification product is a partial sequence of 18S rDNA, the length is 1304bp, according to the sequencing result, relevant software such as Clustalx1.83 and Mega 6 is utilized to carry out comparison analysis with the homologous sequence found in the GenBank database, and an NJ (neighbor-joining) method is adopted to construct a phylogenetic tree (see figure 2). The Query coverage value of the rhombohedral alga SDEC-27 and Nitzschia sp. (MN696703.1, MN696719.1) reaches 100%, and the Max ident value is 99%. Phylogenetic trees also showed that the rhombohedral alga SDEC-27 was evolutionarily most similar to the genus rhombohedral alga. Combined with microscopic morphological identification, it was initially identified as a rhombohedral alga, designated Nitzschia sp.
Example 2: growth and oil production characteristics of Diatom Sddei SDEC-27 in Erdschreiber's Medium supplemented with NaCl at different concentrations
The growth and lipid accumulation properties of the rhombohedral alga SDEC-27 in Erdschreiber's medium supplemented with different concentrations of NaCl were compared.
(1) The culture medium used is Erdschreiber's culture medium added with NaCl of different concentrations
Erdschreiber's medium was composed as described above, with NaCl concentrations of 0, 10, 20g/L, respectively, and the medium was autoclaved before use.
(2) Growth of Nitzschia SDEC-27 in Erdschreiber's Medium at different NaCl concentrations
The rhombohedral alga SDEC-27 is subjected to amplification culture so that the initial inoculation density is 106The cells/mL are respectively inoculated in an Erdschreiber's culture medium (E's M, a control group) added with 0g/L NaCl concentration and an Erdschreiber's culture medium (an experimental group) added with 10g/L and 20g/L NaCl concentration, and then the Erdschreiber's culture medium is placed in an illumination incubator for culture, the culture temperature is 25 +/-1 ℃, the total illumination is carried out, and the illumination intensity is 4000 lux. Until the algae grows to be stableAnd (4) centrifuging to harvest, and treating the harvested algae mud in a freeze dryer to obtain dry algae powder.
(3) Skeletonema SDEC-27 biomass assay
By monitoring the biomass concentration of the algae cells every day, the algae liquid is centrifugally harvested after the growth stage of the algae cells enters a stable stage. Recording the volume of the harvested algae liquid, filling the algae liquid into a 50mL centrifuge tube, placing the centrifuge tube into a large-capacity refrigerated centrifuge for centrifugation, removing supernatant, retaining bottom mud, and freezing to obtain algae powder. Biomass was calculated as follows:
in the formula: m-algal biomass dry weight, g;
v-volume of algal solution, L.
(4) Determination of oil content of Sdcec-27 of Trapa japonica
Weighing 0.1g of dry algae powder into a 50mL centrifuge tube, adding 10mL of chloroform/methanol (2:1, v/v) solution, crushing for 10min by using an ultrasonicator, then carrying out centrifugal separation for 10min at 4000r/min, transferring an organic phase into a 60mL separating funnel, and repeating the extraction process once on algae residues. Adding 0.9% sodium chloride solution (1:5) according to the volume of the separated organic phase, fully shaking for 1min, standing for 15min for layering, recovering the lower layer oil extraction solution, measuring the volume of the lower layer oil extraction solution in a pre-weighed 10mL glass test tube, drying by using nitrogen, and placing the glass tube in an oven at 60 ℃ to dry to constant weight. Calculating the oil content:
in the formula: LW — oil content on a dry weight basis,%;
m1-dry weight of algae meal, g;
m010mL glass tube dry weight, g;
m2-dry weight of 10mL glass tube with grease, g.
The results are shown in FIG. 3, indicating that: the maximum biomass concentration of the rhombohedral alga SDEC-27 in an Erdschreiber's culture medium is 310mg/L, the oil content is 33 percent of the dry weight of cells, and the oil yield is 102 mg/L; in an Erdschreiber's culture medium added with 10g/L NaCl, the maximum biomass concentration, the maximum oil content and the maximum oil yield are 316mg/L, 49% and 156mg/L respectively; in Erdschreiber's medium supplemented with 20g/L NaCl, the maximum biomass concentration, oil content and oil yield were 283mg/L, 53% and 149mg/L, respectively. Therefore, the addition of 10g/L NaCl in the Erdschreiber's culture medium does not affect the growth of the rhombohedral alga SDEC-27, and can stimulate the accumulation of grease, thereby having higher grease yield.
Example 3 growth and oil production characteristics of Nitzschia SDEC-27 in Erdschreiber's Medium and seawater-wastewater culture
The growth and lipid accumulation characteristics of the rhombohedral alga SDEC-27 in Erdschreiber's medium and seawater-wastewater culture were compared.
(1) The culture medium used is Erdschreiber's culture medium and seawater-wastewater culture solution
The Erdschreiber's culture medium comprises the components as described above, and the seawater-wastewater culture solution is prepared by adding 1/100 kitchen waste anaerobic digestion solution (SW + ADE-KW) into natural seawater, wherein the seawater is collected from Shandong Qingdao, and the kitchen waste anaerobic digestion solution is collected from Shandong Ten-square environmental protection energy resources Co.
(2) Growth of Sdcec-27 in Erdschreiber's medium and seawater-wastewater culture
The rhombohedral alga SDEC-27 is subjected to amplification culture so that the initial inoculation density is 106The cells/mL are respectively inoculated in an Erdschreiber's culture medium (a control group) and a seawater-wastewater culture solution (an experimental group), and then the cells/mL are placed in an illumination incubator for culture, the culture temperature is 25 +/-1 ℃, the full illumination is realized, and the illumination intensity is 4000 lux. And (4) carrying out centrifugal harvesting when the algae grow to a stable stage, and treating the harvested algae mud in a freeze dryer to obtain dry algae powder.
(3) The measurement and calculation of biomass and fat content were carried out according to example 2.
Biomass and oil production by the rhombohedral alga SDEC-27 in both media are shown in fig. 4. The maximum biomass concentration of the rhombohedral alga SDEC-27 in the Erdschreiber's culture medium is 310mg/L, the oil content is 33 percent of the dry weight of cells, and the oil yield is 102 mg/L; in the seawater-wastewater culture solution, the maximum biomass concentration, the oil content and the oil yield are 336mg/L, 38% and 129mg/L respectively. Therefore, the rhombohedral alga SDEC-27 can also grow and accumulate grease in natural seawater and kitchen waste anaerobic digestion liquid, and the biomass yield and the grease yield are both improved compared with an Erdschreiber's culture medium.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Shandong university
<120> rhombohedral algae, culture method thereof and application thereof in super salt-tolerant oil production
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence
<400> 1
gtagtcatat gcttgtctc 19
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence
<400> 2
gcatcacaga cctgttattg cctc 24
Claims (9)
1. A kind of rhombohedral algaeNitzschiasp.) SDEC-27, which is characterized in that the preservation number is CCTCC NO: M2021192, the preservation date is 2021 year, 2 month and 25 days, and the preservation unit is China center for type culture Collection.
2. A method for cultivating rhombohedral algae as claimed in claim 1, wherein the rhombohedral algae are placed in Erdschreiber's culture medium for enrichment culture, the rhombohedral algae after enrichment culture are inoculated in the Erdschreiber's culture medium with additional NaCl added for illumination culture, the concentration of the additional NaCl added is 0-20 g/L, and the concentration of the additional NaCl added is not 0.
3. The method for culturing rhombohedral algae of claim 2, wherein the concentration of the added NaCl is 9.6-10.4 g/L.
4. A method for cultivating rhombohedral algae as claimed in claim 1, wherein the rhombohedral algae are placed in Erdschreiber's culture medium for enrichment culture, and the rhombohedral algae after enrichment culture are inoculated in culture mixture for illumination culture; the culture mixed liquid is a mixed liquid of seawater and kitchen waste anaerobic digestion liquid.
5. The method for cultivating rhombohedral algae of claim 2 or 4, wherein the temperature of the enrichment culture is 24-26 ℃, the illumination intensity of the enrichment culture is 2000-2100 lux, the illumination is full illumination, and the enrichment culture time is 6-8 days;
or the temperature of the illumination culture is 24-26 ℃, the illumination intensity of the illumination culture is 2000-4000 lux, the adopted illumination is full illumination, the illumination culture time is from the growth of the rhombohedral algae to the stable period, and the initial inoculation density of the illumination culture is (1-9) multiplied by 106cell/mL。
6. The method for cultivating rhombohedral algae of claim 4, wherein the volume of the anaerobic digestion solution of kitchen waste in the mixed culture solution is 0.5-1.5% of seawater.
7. Use of the rhombohedral alga of claim 1 for salt tolerant oil production.
8. Use of the method for culturing rhombohedral algae of any one of claims 2-6 in the production of oil and fat.
9. A salt-tolerant lipid-producing microbial inoculum obtained by the culture method of any one of claims 2 to 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110308844.2A CN113005041B (en) | 2021-03-23 | 2021-03-23 | Diamond algae, culture method thereof and application thereof in super-salt oil production |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110308844.2A CN113005041B (en) | 2021-03-23 | 2021-03-23 | Diamond algae, culture method thereof and application thereof in super-salt oil production |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113005041A CN113005041A (en) | 2021-06-22 |
| CN113005041B true CN113005041B (en) | 2022-05-06 |
Family
ID=76405441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110308844.2A Active CN113005041B (en) | 2021-03-23 | 2021-03-23 | Diamond algae, culture method thereof and application thereof in super-salt oil production |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113005041B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102443542B (en) * | 2010-10-15 | 2013-07-17 | 江南大学 | High-density culture process of autotrophic oil-producing microalgae |
| IN2014MU04013A (en) * | 2013-12-27 | 2015-08-28 | Tsuji Oil Mills Co Ltd | |
| FR3027608B1 (en) * | 2014-10-22 | 2018-03-30 | Capsum | GELIFIED CAPSULE COMPRISING A PLANT CELL |
| CN104593314A (en) * | 2014-12-31 | 2015-05-06 | 浙江大学 | Method for improving micro algae growth rate and cell fat content employing high-salinity domestication |
-
2021
- 2021-03-23 CN CN202110308844.2A patent/CN113005041B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113005041A (en) | 2021-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111876351B (en) | Bacillus belgii and application thereof in relieving apple continuous cropping obstacle | |
| CN102093955B (en) | Chlorella strain and application thereof | |
| CN111154673B (en) | Prodigiosin producing strain and production method and application thereof | |
| CN106399132B (en) | One plant of Irpex lacteus and its application | |
| CN103667132A (en) | Bacillus cereus and application thereof to improve plant drought-resistant capability | |
| CN106635807A (en) | Oil-producing monoraphidium sp. as well as culture and application thereof | |
| CN103555584B (en) | Acquisition and application of grease-producing monoraphidium LB50 | |
| CN103981101B (en) | A kind of DSE bacterial strain and the application in sugarcane production thereof | |
| CN100529051C (en) | Method for preparing endophyte of plant | |
| CN107217017B (en) | Acinetobacter and application thereof in petroleum degradation | |
| CN101892159B (en) | Chlamydomonas strain and application thereof | |
| CN103695482A (en) | Method for producing microalgae grease by utilizing algae residues generated after oil extraction | |
| CN110846262B (en) | Serratia marcescens SZ201 and application thereof | |
| CN113005041B (en) | Diamond algae, culture method thereof and application thereof in super-salt oil production | |
| CN103540533B (en) | Obtaining and application of oil-producing monoraphidium LB59 | |
| CN114456942B (en) | Chain belt algae for treating high-concentration molasses alcohol wastewater and application thereof | |
| CN113930358B (en) | Bacterial strain capable of decomposing kelp | |
| CN113897320B (en) | Halophyte with salt-tolerant growth-promoting function and application thereof | |
| CN102911872B (en) | Scenedesmus sp. strain and application thereof | |
| CN101812416A (en) | Method for extracting pseudomonas mendocina strain | |
| CN103160440A (en) | Scenedesmus strain and application thereof | |
| CN108841765A (en) | Steady bacillus and its application in conversion sweet potato stalk production biological flocculant | |
| CN107937302A (en) | A kind of bacterium D10 for improving heavy metal validity and its application | |
| CN106967614B (en) | Cladosporium SCSIO43503 and application thereof | |
| CN105733951B (en) | Chlorella capable of producing grease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |