CN101812416A - Method for extracting pseudomonas mendocina strain - Google Patents
Method for extracting pseudomonas mendocina strain Download PDFInfo
- Publication number
- CN101812416A CN101812416A CN200910199191A CN200910199191A CN101812416A CN 101812416 A CN101812416 A CN 101812416A CN 200910199191 A CN200910199191 A CN 200910199191A CN 200910199191 A CN200910199191 A CN 200910199191A CN 101812416 A CN101812416 A CN 101812416A
- Authority
- CN
- China
- Prior art keywords
- strain
- medium
- bacterial strain
- pseudomonas mendocina
- pseudomonas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to a method for extracting a pseudomonas mendocina strain, which comprises the following steps: standing an acclimated mud-water mixed sample for 30 minutes, taking 1 milliliter of upper water sample for gradient dilution of 10<1> to 10<10>, inoculating 1 milliliter of bacterial liquid with each diluted concentration to a specific denitrified solid culture medium to perform enrichment and purification culture, and ensuring growing a single strain; inoculating the strain to a sterile nutrient broth culture medium, culturing the strain for 12 to 16 hours at the temperature of between 30 and 34 DEG C and at the speed of between 110 and 120 r/min, adding the strain into a screening culture medium to perform an option experiment of unique carbon source, and finally detecting NO3-N to obtain the strain of which the denitrification rate is 90.1 percent. The method directly extracts the denitrified strain from mud and water in a purification tank in a combined process; the seed source is easily obtained; the separation and purification method is simple and quick, has low cost and is environmentally-friendly; the denitrification rate of the extracted strain can reach over 90 percent; and the method has good application prospect.
Description
Technical field
The invention belongs to the separation and purification field of microorganism strains, particularly a kind of extracting method with pseudomonas mendocina strain.
Background technology
Since the seventies in 20th century, along with the quick growth of people in the countryside and the continuous development of rural economy, comprehensive agricultural development scale and township industry enlarge day by day to the intensity of utilizing of resource, make China rural area original just short resource and fragile ecology be faced with the increasing pressure.The zone of China and population emphasis are in the rural area, rural ecological environmental degradation trend is not fundamentally reversed, to have a strong impact on not only and restrict that agriculture stable yields increases income, peasant programme and rural area modernization, make " rural economy, rural development and rural demography " become the very crux that more and more is difficult to resolve, and will directly influence the Chinese society sustainable economic development, the serious threat broad masses of the people's is healthy, concerns food safety and social stability.Therefore, strengthen the rural ecological environment protection and be not only urgent and difficult task in the current rural economy social development, and become the most important thing of China's new period ecotope maintenance work.
Microorganism can secrete different enzymes at different pollutents and participate in reaction, thereby changes the structure of pollutent, reduces its disadvantageous effect.The present invention behind domestication, concentration and separation, purifying, obtains the bacterium that a plant height is imitated the denitrogenation degraded by the thought of biological reinforcing technology from domestic sewage in rural areas by using.Because microorganism is strong to environmental compatibility, and one section natural domestication of pollution course experience, thereby can from physical environment, screen the purpose bacterial strain by domestication.
Summary of the invention
Technical problem to be solved by this invention provides a kind of extracting method with pseudomonas mendocina strain, this method direct extraction denitrifier from the muddy water of domestic sewage in rural areas by using, provenance be easy to get and separation purification method simple and efficient, cost is low, and is environmentally friendly; The bacterial classification denitrification percent that extracts can reach more than 90%, has a good application prospect.
A kind of extracting method with pseudomonas mendocina strain of the present invention comprises:
(1) extracts the water sample of taming after cultivating
From Chongming, Shanghai City district domestic sewage in rural areas by using treatment project biopurification groove-intensified ecological floating bed, extract the muddy water compound sample of having tamed after 7 months;
(2) concentration and separation of bacterial strain and purifying
The muddy water compound sample of having tamed after 7 months is left standstill 30min, get upper strata water sample 1mL and do 10
-1～10
-10Gradient dilution, every kind of weaker concn is got 1mL bacterium liquid respectively and carried out enriching and purifying and cultivate in being inoculated into obligate denitrogenation solid medium then, guarantees to grow single bacterial strain, inoculates slant medium, preserves down in 4 ℃, and is standby;
(3) screening of bacterial strain
Above-mentioned bacterial strains is inoculated in the aseptic nutrient broth medium by 10% inoculum size, under 30～34 ℃, the condition of 110～120r/min, cultivated 12～16 hours, join the selection experiment that screening culture medium is carried out sole carbon source by 20% inoculum size then, pass through NO at last
3It is 90.1% bacterial strain that the detection of-N obtains denitrification percent.
Obligate denitrogenation isolation medium in the described step (2) is KNO
32g/L, K
2HPO
40.5g/L, MgSO
47H
2O0.2g/L, distilled water 1000ml, pH 7.2～7.4, sodium acetate 50mmol/L; Solid medium need add the agar of 1.8%W/V in addition;
Enriching and purifying cultivation in the described step (2) is meant cultivates 48h with bacterium liquid in 30 ℃ of incubators after being inoculated into the obligate solid medium, the single clearly bacterium colony of picking form, numbering, on solid medium, rule, culture dish is inverted in 30 ℃ of incubators cultivates 48h,, under electron microscope, observe colonial morphology, 2～4 times repeatedly, guarantee to grow pure single bacterial strain;
Aseptic nutrient broth medium is extractum carnis 3.0g/L in the described step (3), peptone 10.0g/L, NaCl 5.0g/L, distilled water 1000mL, pH=7.0～7.2, slant medium is for dissolving the solid medium heating, get clean test tube, pour 4～6mL solid medium in the test tube into, will try nose end and be placed on the glass stick, make in the pipe substratum form the inclined-plane and form;
Screening culture medium in the described step (3) is based on obligate fixed nitrogen substratum, add a kind of in the sodium acetate, Sodium Propionate, ethanol, Sodium Glutamate, Trisodium Citrate, Seignette salt, methyl alcohol, Sulfothiorine, glucose, sodium bicarbonate of 3g/L, regulate pH to 7.7 as sole carbon source.
Described denitrifier is through 16S rDNA sequencing, and the gene complete sequence is as follows:
GATCAAGGTCAAAGGGAAAGTGAATTGAGTGCAAAGGGGCATTAATTCTCAATCTTTATCAAGAAGTACTCTCATATCTATTGCTGTCCGCCATGTTTGAAACACCTGACTCGAGCCACAACATCGAAAATAGTTTAAAGAAGTATAGAAGCTGATAATTAGTACTTTTTATCTGTGGGGTGCGCTTGGGTAGACAGAACGATACTAGGCGATTACACAGGTGCCCGGGATACTACTCCGAACATGCACTCACTGTACGTGCATACTGCTGCTAGCTTCCTAATAATAAAGCTCAAAGCAATTAGATCACAAAGGTAAGTCCGCGTTACTATTGTCTTCGATTGAGATTATCCCTCTGGCAACTTTCCGAAATCCAACGTGTCCAACGTCACCGATTCTTACTTCAACACAAGGTCTCCGATACAACACCTGTCTTGTCCCGTCCCGTCCCCTGACCCCATTCTCCGGACCGGCTCCTGGTTCCGTGGAAGATCCTGAATCCAGCACCTGCCACTATTCGAAGACGAGCTTTCTTGCTGTCAATATTATTGACAGAGCCAAGCAGATAAACTCAGTGAAGTGAAGCTTTGGTTCCAGTCAATACCAAATTGTCGAGAAACCATAAGCGGGACCGGAAGGGATAGGAGAAAAGAGAGGGGGCACGCAAGACCAACAGAGGGAGAGGGGAGAATAACGTCAGACCCAACTAAGACGATTATCGAGCAGGGGCCAGCACAACGCAGAACTTGAGTCACTATCACGGCTATTATCCCTCGCCCTCTGTTTACCTCGAGTCTGCAACAACAAAGATGGCTGGTACAAGGAACTACGACTTTCTGGTAAGTATTGACTAAACTCCCAAGAAACCATAAGCTAAATGTCGGTCTTTGTAGATCAAGTTACTACTTATTGGGGACTCTGGGGTGGGAAAGTCATGCTGTCTATTGCGATTCAGTGAAGACTCGTTCACTCCGTCGTTCATTACTACCATCGGAATCGACTTCAAAATACGTACCATCGAATTGGACGGTAAAAGAGTAAAGCTCCAGATATGGGATACAGCTGGGCAAGAGCGATTTAGAACTATCACTACTGCTTACTACAGAGGAGCCATGGGCATTCTTCTTGTATACGATGTCACTGATGAAAGATCATTCCAAAGTGAGAAACGCCTTCCTTAAACCCGAGGTGGGTCATAAGATAATTTGATGCTAATGCCCAATCACCTTAGACATTCGCACCTGGTTCTCAAATGTCGAACAACATGCGAGCGAAGGCGTTCACAAGATCCTTATTGGCAACAAATGTGATTGGGAAGAGAAGAGGGCTGTGTCAACCGAGCAAGGGCAGCAATTGGCTAATGAGCTGGGAATACCATTCCTTGAAGTATCGGCTAAGAACAACATCAACATCGAGAAAGCGTTTTATGATCTCGCATCCGACATCAAAAAAGGAATGGATACGTCGAAGTCTGAACAGGTCGGCTCTCAGGGCGTGAGCATAGACCAGCAAGGTTCCGGGTTGAATGGCAGCGCAGGTGGGAAGTGCTGTTGAATAGATAGTGCACCCTCATTTGGTCTTCGGGTTATATCTTTCCATCATGACTCTATGTCTTTGCGCGTTACAGGTTTGTGTCATGGCTTCAGTACATCATTACGTTCACGGTTCGAATAGATGCTGGGAAGCTAATTGGCTGATTCTGCTCCTATCCTATGTATGTTGATAATGATGGCAGGGGCTTATGGTTTTCGTGATTGCCTTTATCCTTCTTTCTGTTCTGTCTTGGGTTCTCATCCATTTACTGCGATCGAACTTTCCCAGGTGGCGTTATTCTGTTATATTCATAACTGTGCAAATGATATTCGGTATGGCCATAAACAGTCTTCTGGAAGTGCGGTATACATCACCCTCCAGAATCCCCTTATAAACATGAGGAAACATGGGGCATGTCCGTTTTTAAATGATCTTGGCAAGAGTT；
The gene complete sequence of bacterial strain 16S rDNA is analyzed in ncbi database relatively, is accredited as pseudomonas mendocina, called after Pseudomonas MedocinaA-5; The bacterium colony of bacterial strain is faint yellow, circle, and bacterium colony becomes the oil droplet shape to climb to prolong phenomenon.Find that with electron microscope and scanning electron microscopic observation bacterial strain is a bacillus behind the gramstaining, the gramstaining reaction negative, one pole is given birth to flagellum, and is translucent;
This pseudomonas mendocina (Pseudomonas Medocina) A-5 plasmid detected result shows that this bacterium do not carry plasmid, so degrading genes is encoded on the karyomit(e).This characteristic makes is utilizing plasmid to carry out in the process of Horizontal Gene Transfer, having avoided the uncompatibility of plasmid, is the good material that makes up the genetic engineering bacterium that possesses multiple degradation capability, and to the equal non-resistant of general microbiotic, and be easy to deactivation, guaranteed the ecological security that uses.
Beneficial effect
(1) provenance of pseudomonas mendocina provided by the present invention (Pseudomonas Medocina) A-5 is the mud mixture in the biopurification groove of handling domestic sewage in rural areas by using, provenance be easy to get and separation purification method simple and efficient, cost is low, and is environmentally friendly;
(2) pseudomonas mendocina provided by the present invention (Pseudomonas Medocina) A-5 denitrogenation effectively, denitrification percent can reach more than 90%, and this bacterial strain can adapt to complicated physical condition, and this makes having a extensive future of this bacterium.
Description of drawings
Fig. 1 is the systematic evolution tree of (Pseudomonas Medocina) A-5;
Fig. 2 is the scanning electron microscope of (Pseudomonas Medocina) A-5;
Fig. 3 is the gramstaining design sketch of (Pseudomonas Medocina) A-5;
Fig. 4 is the growth curve of (Pseudomonas Medocina) A-5 A-5 under differing temps;
Fig. 5 is the biomass of (Pseudomonas Medocina) A-5 A-5 under different pH;
Fig. 6 is the biomass of (Pseudomonas Medocina) A-5 A-5 under the different vaccination amount;
Fig. 7 is the mensuration of (Pseudomonas Medocina) A-5 degradation capability.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Embodiment 1
Separation screening of efficient denitrification bacterium and evaluation
(1) from Chongming, Shanghai City district domestic sewage in rural areas by using treatment project biopurification groove-intensified ecological floating bed, extracts the muddy water compound sample of having tamed after 7 months;
(2) the muddy water compound sample that will tame after 7 months leaves standstill 30min, gets upper strata water sample 1mL and does 10
-1～10
-10Gradient dilution, every kind of weaker concn is got 1mL bacterium liquid respectively (substratum P/ (gL is selected in the obligate denitrogenation in being inoculated into obligate denitrogenation solid medium then
-1) be: KNO
32g, K
2HPO
40.5g, MgSO
47H
2O 0.2g, distilled water 1000ml, pH 7.2～7.4, sodium acetate 50mmol/L (solid medium adds 1.8% (W/V) agar in addition) carries out enriching and purifying and cultivates, culture dish is put on the table, come the back rotation culture dish after, culture dish is inverted in 30 ℃ of incubators cultivates 48h.The single clearly bacterium colony of picking form, numbering is rule on solid medium, culture dish is inverted in 30 ℃ of incubators cultivates 48h, again observations.2-4 time repeatedly, and under electron microscope, observe, guarantee it is behind the pure single bacterial strain, isolated bacterial classification inoculation to slant medium, is stored under 4 ℃ and treats the follow-up test of degrading in the refrigerator;
(3) above-mentioned bacterial strains is inoculated in aseptic nutrient broth medium (extractum carnis 3.0g/L by 10% inoculum size, peptone 10.0g/L, NaCl 5.0g/L, distilled water 1000mL, pH=7.0～7.2, slant medium is for dissolving the solid medium heating, get clean test tube, pour 4～6mL solid medium in the test tube into, to try nose end is placed on the glass stick, make in the pipe substratum form the inclined-plane and form) in, in 30～34 ℃, cultivated under the condition of 110～120r/min 12～16 hours, extracting bacterium liquid with 20% inoculum size then joins screening culture medium (selecting substratum with the obligate denitrogenation is basic medium, use the sodium acetate of 3g/L again, Sodium Propionate, ethanol, Sodium Glutamate, Trisodium Citrate, Seignette salt, methyl alcohol, Sulfothiorine, glucose and sodium bicarbonate are as sole carbon source, regulate pH to 7.7) carry out the selection experiment of sole carbon source, the inoculation under at last optimum carbon source being cultivated is to containing quantitative NO
3In-N the substratum, test each bacterial strain 30 ℃, the denitrification percent when 110r/min cultivates 12h in different carbon sources, filter out the good bacterial strain of denitrification capability, the result is as shown in table 1.
(4) thalline is carried out gramstaining and electron-microscope scanning, observe the formalness feature of bacterial strain.The bacterium colony of bacterial strain is faint yellow, circle, and bacterium colony becomes the oil droplet shape to climb to prolong phenomenon.Find that with electron microscope and scanning electron microscopic observation bacterial strain is a bacillus behind the gramstaining, the gramstaining reaction negative, one pole is given birth to flagellum.The scanning electron microscope result of thalline and gramstaining effect are seen Fig. 1,2.The single bacterial strain that separation and purification is obtained joins for 2-3 time in the aseptic nutrient broth nutrient solution with transfering loop bar bacterium colony and carries out liquid culture again; deliver to sea base health biotech company again and measure complete sequence, determine that types of spawn is pseudomonas mendocina (Pseudomonas Medocina) A-5.
Table 1
The top condition of efficient denitrification bacterium
(1) under the differing temps, at the denitrification test substratum (KNO of pH value 7.7
32g/L, K
2HPO
40.5g/L, MgSO
47H
2O0.2g/L, distilled water 1000ml, pH 7.2～8.2, and the sodium acetate that adds 12g/L is as sole carbon source, wherein NO
3-N mass concentration is 100mg/L, NO
3-N is provided by saltpetre, insert 20% the nutrient solution that contains strains A-5, cultivate denitrogenation speed and the denitrification percent of measuring strains A-5, as can be known the nitric efficiency maximum of strains A-5 30 ℃ the time, consider that from application point biological denitrificaion should be selected for use under 30 ℃ of left and right sides conditions and carry out.
(2) strains A-5 is inoculated in the test medium of different initial pH value, inoculum size is 20%, cultivate 20h for 30 ℃, measure denitrification percent know denitrogenation suit under alkali condition partially (pH is 7.2～8.2) carry out, strains A-5 is that growing state is best in 7.7 the substratum in the pH value, this moment, its logarithmic phase was the shortest, obtained the concentration maximum of bacterial strain at last.Therefore, the suitableeest growth pH value of strains A-5 is 7.7.PH is lower than 7.0 and be higher than 9.0 denitrogenation speed and decline by a big margin.
(3) strains A-5 is seeded in 100ml is housed, the pH value is in the 250ml Erlenmeyer flask of 7.7 test medium, cultivate 20h with different 30 ℃ of inoculum size inoculations, 110r/min, measure denitrification percent, visible inoculum size is increased to 80% from 20%, denitrification percent increases little, because inoculum size strengthens, though the increase of nitrate reductase amount, during its amount of reaching capacity, it is little to the denitrogenation influence to increase enzyme concentration, so the optimum inoculation amount of strains A-5 is 20-30%.
The optimum growing condition that draws A-5 by growth conditions optimization is for being under the sole carbon source at sodium acetate, and 30 ℃, the optimum medium initial pH value is 7.7, and the suitableeest inoculum size is 20%.
The degradation analysis of efficient denitrification bacterium
At test medium (KNO
32g, K
2HPO
40.5g, MgSO47H
2O 0.2g, distilled water 1000ml adds sodium acetate 12g, and initial pH value is adjusted to 7.7, NO
3-N mass concentration is 100mgL
-1, inoculum size is 20%, cultivates down at 30 ℃, at interval residual NO in the 4h sampling and measuring substratum
3-N concentration.
Be determined at by analysis under the optimum growing condition, A-5 removes NO
3The ability of-N is remarkable, as the initial NO of nutrient solution
3-N concentration is 100mgL
-1The time, degradation rate reaches 90.1% in the 24h.The result shows, uses NO in this removal of microorganisms domestic sewage in rural areas by using
3-N, it is feasible improving environment.SEQUENCE?LISTING
＜110〉Donghua University
＜120〉a kind of extracting method with pseudomonas mendocina strain
<140>2009101991918
<141>2009-11-20
<160>1
<170>PatentIn?version?3.3
<210>1
<211>1978
<212>DNA
＜213〉pseudomonas mendocina (Pseudomonas Medocina)
<400>1
gatcaaggtc?aaagggaaag?tgaattgagt?gcaaaggggc?attaattctc?aatctttatc 60
aagaagtact?ctcatatcta?ttgctgtccg?ccatgtttga?aacacctgac?tcgagccaca 120
acatcgaaaa?tagtttaaag?aagtatagaa?gctgataatt?agtacttttt?atctgtgggg 180
tgcgcttggg?tagacagaac?gatactaggc?gattacacag?gtgcccggga?tactactccg 240
aacatgcact?cactgtacgt?gcatactgct?gctagcttcc?taataataaa?gctcaaagca 300
attagatcac?aaaggtaagt?ccgcgttact?attgtcttcg?attgagatta?tccctctggc 360
aactttccga?aatccaacgt?gtccaacgtc?accgattctt?acttcaacac?aaggtctccg 420
atacaacacc?tgtcttgtcc?cgtcccgtcc?cctgacccca?ttctccggac?cggctcctgg 480
ttccgtggaa?gatcctgaat?ccagcacctg?ccactattcg?aagacgagct?ttcttgctgt 540
caatattatt?gacagagcca?agcagataaa?ctcagtgaag?tgaagctttg?gttccagtca 600
ataccaaatt?gtcgagaaac?cataagcggg?accggaaggg?ataggagaaa?agagaggggg 660
cacgcaagac?caacagaggg?agaggggaga?ataacgtcag?acccaactaa?gacgattatc 720
gagcaggggc?cagcacaacg?cagaacttga?gtcactatca?cggctattat?ccctcgccct 780
ctgtttacct?cgagtctgca?acaacaaaga?tggctggtac?aaggaactac?gactttctgg 840
taagtattga?ctaaactccc?aagaaaccat?aagctaaatg?tcggtctttg?tagatcaagt 900
tactacttat?tggggactct?ggggtgggaa?agtcatgctg?tctattgcga?ttcagtgaag 960
actcgttcac?tccgtcgttc?attactacca?tcggaatcga?cttcaaaata?cgtaccatcg 1020
aattggacgg?taaaagagta?aagctccaga?tatgggatac?agctgggcaa?gagcgattta 1080
gaactatcac?tactgcttac?tacagaggag?ccatgggcat?tcttcttgta?tacgatgtca 1140
ctgatgaaag?atcattccaa?agtgagaaac?gccttcctta?aacccgaggt?gggtcataag 1200
ataatttgat?gctaatgccc?aatcacctta?gacattcgca?cctggttctc?aaatgtcgaa 1260
caacatgcga?gcgaaggcgt?tcacaagatc?cttattggca?acaaatgtga?ttgggaagag 1320
aagagggctg?tgtcaaccga?gcaagggcag?caattggcta?atgagctggg?aataccattc 1380
cttgaagtat?cggctaagaa?caacatcaac?atcgagaaag?cgttttatga?tctcgcatcc 1440
gacatcaaaa?aaggaatgga?tacgtcgaag?tctgaacagg?tcggctctca?gggcgtgagc 1500
atagaccagc?aaggttccgg?gttgaatggc?agcgcaggtg?ggaagtgctg?ttgaatagat 1560
agtgcaccct?catttggtct?tcgggttata?tctttccatc?atgactctat?gtctttgcgc 1620
gttacaggtt?tgtgtcatgg?cttcagtaca?tcattacgtt?cacggttcga?atagatgctg 1680
ggaagctaat?tggctgattc?tgctcctatc?ctatgtatgt?tgataatgat?ggcaggggct 1740
tatggttttc?gtgattgcct?ttatccttct?ttctgttctg?tcttgggttc?tcatccattt 1800
actgcgatcg?aactttccca?ggtggcgtta?ttctgttata?ttcataactg?tgcaaatgat 1860
attcggtatg?gccataaaca?gtcttctgga?agtgcggtat?acatcaccct?ccagaatccc 1920
cttataaaca?tgaggaaaca?tggggcatgt?ccgtttttaa?atgatcttgg?caagagtt 1978
Claims (6)
1. extracting method with pseudomonas mendocina strain comprises:
(1) extracts the water sample of taming after cultivating
Get and extract the muddy water compound sample of having tamed after 7 months in sanitary sewage disposal engineering biopurification groove-intensified ecological floating bed;
(2) concentration and separation of bacterial strain and purifying
The muddy water compound sample of having tamed after 7 months is left standstill 30min, get upper strata water sample 1mL and do 10
-1～10
-10Gradient dilution, every kind of weaker concn is got 1mL bacterium liquid respectively and carried out enriching and purifying and cultivate in being inoculated into obligate denitrogenation solid medium then, guarantees to grow single bacterial strain, inoculates slant medium, preserves down in 4 ℃, and is standby;
(3) screening of bacterial strain
Above-mentioned bacterial strains is inoculated in the aseptic nutrient broth medium by 10% inoculum size, under 30～34 ℃, the condition of 110～120r/min, cultivated 12～16 hours, join the selection experiment that screening culture medium is carried out sole carbon source by 20% inoculum size then, pass through NO at last
3It is 90.1% bacterial strain that the detection of-N obtains denitrification percent.
2. a kind of extracting method with pseudomonas mendocina strain according to claim 1, it is characterized in that: the obligate denitrogenation isolation medium in the described step (2) is KNO
32g/L, K
2HPO
40.5g/L, MgSO
47H
2O 0.2g/L, distilled water 1000ml, pH 7.2～7.4, sodium acetate 50mmol/L; Solid medium need add the agar of 1.8%W/V in addition.
3. a kind of extracting method according to claim 1 with pseudomonas mendocina strain, it is characterized in that: the enriching and purifying cultivation in the described step (2) is meant cultivates 48h with bacterium liquid in 30 ℃ of incubators after being inoculated into the obligate solid medium, the single clearly bacterium colony of picking form, numbering is rule on solid medium, culture dish is inverted in 30 ℃ of incubators cultivates 48h, under electron microscope, observe colonial morphology, 2～4 times repeatedly, guarantee to grow pure single bacterial strain.
4. a kind of extracting method according to claim 1 with pseudomonas mendocina strain, it is characterized in that: aseptic nutrient broth medium is extractum carnis 3.0g/L in the described step (3), peptone 10.0g/L, NaCl 5.0g/L, distilled water 1000mL, pH=7.0～7.2, slant medium is got clean test tube for the solid medium heating is dissolved, and pours 4～6mL solid medium in the test tube into, to try nose end and be placed on the glass stick, and make in the pipe substratum form the inclined-plane and form.
5. a kind of extracting method according to claim 1 with pseudomonas mendocina strain, it is characterized in that: the screening culture medium in the described step (3) is based on obligate fixed nitrogen substratum, add a kind of in the sodium acetate, Sodium Propionate, ethanol, Sodium Glutamate, Trisodium Citrate, Seignette salt, methyl alcohol, Sulfothiorine, glucose, sodium bicarbonate of 3g/L, regulate pH to 7.7 as sole carbon source.
6. a kind of extracting method according to claim 1 with pseudomonas mendocina strain, it is characterized in that: described denitrifier is compared through 16S rDNA sequencing and analysis, identify that this bacterial strain is a pseudomonas mendocina, called after Pseudomonas MedocinaA-5; The bacterium colony of bacterial strain is faint yellow, circle, and bacterium colony becomes the oil droplet shape to climb to prolong phenomenon.Find that with electron microscope and scanning electron microscopic observation bacterial strain is a bacillus behind the gramstaining, the gramstaining reaction negative, one pole is given birth to flagellum, and is translucent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910199191A CN101812416A (en) | 2009-11-20 | 2009-11-20 | Method for extracting pseudomonas mendocina strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910199191A CN101812416A (en) | 2009-11-20 | 2009-11-20 | Method for extracting pseudomonas mendocina strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101812416A true CN101812416A (en) | 2010-08-25 |
Family
ID=42619783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910199191A Pending CN101812416A (en) | 2009-11-20 | 2009-11-20 | Method for extracting pseudomonas mendocina strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101812416A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103484398A (en) * | 2013-08-28 | 2014-01-01 | 温州大学 | Heterotrophic nitrification-aerobic denitrification pseudomonas mendocina as well as culture and application thereof |
| CN106520624A (en) * | 2016-12-07 | 2017-03-22 | 暨南大学 | Pseudomonas mendocina MKC-02 strain and application of pseudomonas mendocina MKC-02 strain to waste water denitrification |
| CN110656059A (en) * | 2018-06-29 | 2020-01-07 | 龙岩学院 | Pseudomonas strain YG8, seed liquid and preparation method and application thereof |
| CN115851540A (en) * | 2022-12-13 | 2023-03-28 | 广州大学 | Heterotrophic nitrification aerobic denitrification nitrogen and phosphorus removal strain with salt tolerance and application thereof |
-
2009
- 2009-11-20 CN CN200910199191A patent/CN101812416A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103484398A (en) * | 2013-08-28 | 2014-01-01 | 温州大学 | Heterotrophic nitrification-aerobic denitrification pseudomonas mendocina as well as culture and application thereof |
| CN103484398B (en) * | 2013-08-28 | 2015-08-05 | 温州大学 | The pseudomonas mendocina of heterotrophic nitrification-aerobic denitrification and cultivation thereof and application |
| CN106520624A (en) * | 2016-12-07 | 2017-03-22 | 暨南大学 | Pseudomonas mendocina MKC-02 strain and application of pseudomonas mendocina MKC-02 strain to waste water denitrification |
| CN110656059A (en) * | 2018-06-29 | 2020-01-07 | 龙岩学院 | Pseudomonas strain YG8, seed liquid and preparation method and application thereof |
| CN110656059B (en) * | 2018-06-29 | 2022-08-09 | 龙岩学院 | Pseudomonas strain YG8, seed liquid and preparation method and application thereof |
| CN115851540A (en) * | 2022-12-13 | 2023-03-28 | 广州大学 | Heterotrophic nitrification aerobic denitrification nitrogen and phosphorus removal strain with salt tolerance and application thereof |
| CN115851540B (en) * | 2022-12-13 | 2023-06-06 | 广州大学 | Heterotrophic nitrification aerobic denitrification nitrogen and phosphorus removal strain with salt tolerance characteristic and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103275891B (en) | Endophyte and application thereof | |
| Ishizawa et al. | Enhanced biomass production and nutrient removal capacity of duckweed via two-step cultivation process with a plant growth-promoting bacterium, Acinetobacter calcoaceticus P23 | |
| CN103243060B (en) | Quinclorac degrading bacteria and application thereof | |
| CN111154673B (en) | Prodigiosin producing strain and production method and application thereof | |
| CN100552019C (en) | One strain denitrogen paracoccus and cultural method thereof and application | |
| CN103266073A (en) | Sedum alfredii endophyte and an application thereof | |
| CN109456926A (en) | A kind of microbial bacterial agent and its application containing thermophilic salt denitrifying bacterium YL5-2 | |
| CN102796671A (en) | Paecilomyces lilacinus for degrading phoxim and application of Paecilomyces lilacinus | |
| CN104263682A (en) | Plant-growth-promoting endophytic bacterium having polycyclic aromatic hydrocarbons degrading function and application thereof | |
| CN101812416A (en) | Method for extracting pseudomonas mendocina strain | |
| CN104312957A (en) | Denitrifying bacterium and fermenting production method thereof | |
| CN108239610A (en) | One plant of low temperature resistant phosphate solubilizing bacteria and its method for carrying out farmland phosphorus decomposing | |
| CN102250776A (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN101974471A (en) | Sphingosine monad DX-T3-03 strain and extracting method thereof | |
| CN103981101A (en) | DSE (Dark Septate Endophyte) strain and application of DSE strain in production of sugarcane | |
| CN104560817B (en) | Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102 | |
| CN103173377B (en) | 2-methyl-4-chlorophenoxyacetic acid weedicide degrading bacterium SE08, and screening method and application thereof | |
| JP2009195124A (en) | Method for culturing hardly culturable microorganism | |
| CN106591173A (en) | Bacillus flexus HL-37 capable of activating soil heavy metal cadmium, and applications thereof | |
| CN109609414A (en) | One plant of uns-dimethylhydrazine degradation bacteria strains WP52 and its application | |
| CN102206605B (en) | Exiguobacterium sp. with alga-lysing activity and application thereof in cyanobacterial bloom control | |
| CN102533595B (en) | Starkeya sp. T-2 and application thereof | |
| CN105420167B (en) | A kind of Bacillus cercus and its application | |
| CN107217016A (en) | One plant has the endophytic Bacillus bacterial strain ZY122 for suppressing rice sheath blight disease and its application | |
| CN103614324B (en) | Short-chain fatty acid degradation bacteria and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100825 |