CN112961937A - Primer for detecting apocynum venetum septoria, kit and detection method thereof - Google Patents
Primer for detecting apocynum venetum septoria, kit and detection method thereof Download PDFInfo
- Publication number
- CN112961937A CN112961937A CN202110446045.1A CN202110446045A CN112961937A CN 112961937 A CN112961937 A CN 112961937A CN 202110446045 A CN202110446045 A CN 202110446045A CN 112961937 A CN112961937 A CN 112961937A
- Authority
- CN
- China
- Prior art keywords
- primer
- apocynum venetum
- sequence
- detecting
- septoria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention is applicable to the technical field of biological detection, and provides a primer for detecting apocynum venetum septorium, a kit and a detection method thereof.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a primer for detecting apocynum venetum septorium, a kit and a detection method thereof.
Background
Apocynum venetum (Apocynum venetum) also called as wild hemp, wild tea, kenaf, safflower, tea, and the like is mainly divided into two types of white hemp and kenaf, and is a herbaceous plant with erect half shrub or perennial root of Apocynaceae (Apocynaceae). From the global distribution, the distribution of the ministers is in the north of 36 ° north latitude, and the distribution is in the north sea of japan, the central asia, north america, russia, the mediterranean coast, and korea and mongolia, etc. China is the world with the largest distribution area of apocynum venetum, three main distribution areas are a white hemp and red hemp drought distribution area in northwest inland, a red hemp semi-arid distribution area in north, and a red hemp semi-moist and moist distribution area in coastal and inland, and are widely distributed in more than ten provinces and autonomous areas such as Xinjiang, Jilin, Qinghai, Henan, Shanxi and the like, wherein the apocynum venetum distribution area in Uygur autonomous area of Xinjiang is the widest. The apocynum venetum has extremely strong viability because of having special tissues and organs, such as a lower cavity formed by air porous devices distributed on the lower epidermis of a thin blade, deep-color storage substances in the cortex of roots and stems, the stems surround the endogenous phloem, the root system is strong, the xylem is developed, and the like, and grows in desert areas with cold, drought and saline-alkali environment mostly, has the characteristics of saline-alkali resistance, drought resistance, high temperature resistance, frost resistance, sand erosion resistance and the like, becomes one of desert plants for maintaining water and soil, conserving water sources, improving soil, regulating climate, preventing wind and fixing sand, plays an important role in pharmacy, tea making, textile and the like, and has good economic value and ecological benefit.
The spot blight caused by apocynum venetum (Septoria apocyni) is a disease seriously threatening the output and quality of apocynum venetum, and the development of the apocynum venetum industry is seriously hindered. The research on disease general survey and fungal flora of apocynum venetum in Aletai, Xinjiang university teams discovers that the incidence of spot blight of wild apocynum venetum in Aletai, Xinjiang is high and can reach 13.8% at most, the disease mainly damages leaves and stems of the apocynum venetum, ring-shaped disease spots are formed on plants, the disease spots are connected in the later period, the leaves of infected parts are easy to wither, and the apocynum venetum scorched and died seriously in severe cases, so that the production performance of the plants and the wind-proof and sand-fixing effects are seriously affected. The spot blight can also obviously affect the physiological and biochemical functions of the apocynum venetum, and the research on the severity grading and the photosynthetic physiological characteristics of the spot blight discovers that intercellular CO is removed2In addition to the concentration, with the increase of the severity of the spot blight, the net photosynthetic rate, the transpiration rate and the stomatal conductance of the apocynum venetum leaves are obviously reduced, when the severity reaches more than 4 grades, the net photosynthetic loss rate is more than 50 percent, and the relative scab area and the relative discoloration area of the leaves can reach the levelsMore than 30 percent.
At present, the measures for preventing and treating the spot blight disease are mainly based on the investigation of the field morbidity and the disease index at regular intervals and on a large scale. The disease center is found, the disease center can be controlled as much as possible to prevent the disease from being rapidly spread, and the effects of prevention, prediction and forecast are achieved; secondly, bactericide is used for prevention and treatment. Research also shows that the control efficiency is improved by more than 80 percent compared with the control efficiency in the later period of the disease when the control is carried out in the early period of the colonization of pathogenic bacteria. However, the regular and large-scale field disease investigation method is time-consuming and labor-consuming, and cannot accurately predict the occurrence of diseases, the accuracy and reliability of the result depend on the technical level and experience of the investigation and forecast staff to a great extent, and the actual requirements of rapid and efficient diagnosis and detection are difficult to meet.
Therefore, the existing method for preventing and controlling the spot blight disease has the problems of low diagnosis efficiency, accuracy and reliability.
Disclosure of Invention
The embodiment of the invention aims to provide a primer for detecting apocynum venetum septoria, aiming at solving the problems of low diagnosis efficiency, accuracy and reliability of the existing method for preventing and treating the blight disease.
The embodiment of the invention is realized by that the primers for detecting the apocynum venetum septorium comprise a forward primer and a reverse primer; the primer sequence of the forward primer is SEQ ID NO. 1 or the nucleotide complementary sequence of the primer sequence, and the primer sequence of the reverse primer is SEQ ID NO. 2 or the nucleotide complementary sequence of the primer sequence.
The embodiment of the invention also aims at a kit for detecting the apocynum venetum septoria, which contains the primer.
Another object of an embodiment of the present invention is to provide a method for detecting apocynum venetum septorium, which includes:
obtaining a DNA template of a sample to be detected;
will dd H2O, preparing a PCR reaction system by the primer, the DNA template and the Mix enzyme according to a predetermined preparation method;
and carrying out PCR reaction on the PCR reaction system under a preset amplification condition, and observing an amplification result based on an electrophoresis test so as to detect the apocynum venetum conidiospore.
The embodiment of the invention utilizes a molecular biological method to rapidly detect the apocynum venetum conidiophore, particularly designs the primer for rapidly detecting the apocynum venetum conidiophore based on the apocynum venetum conidiophore rDNA-ITS sequence, has the advantages of good specificity, high sensitivity and simple and rapid operation, and provides guarantee for the production of the apocynum venetum.
Drawings
FIG. 1 is a diagram showing the results of detection of two samples Sa-1 and Sa-2 by primers ITS-SepF and ITS-SepR provided in the example of the present invention;
FIG. 2 is a diagram showing the results of sensitivity detection of primers ITS-SepF and ITS-SepR for Sa-1 and Sa-2 provided in the embodiment of the present invention;
FIG. 3 is a graph showing the results of detection of primers ITS-SepF and ITS-SepR on Septoria frutescens in Sa-3, Sa-4 overt and non-overt dry-like Apocynum venetum.
Detailed Description
In order to clearly illustrate the technical content of the present invention, the detailed description is given in conjunction with specific examples, and it is obvious that the examples are only the preferred embodiments of the technical solution, and other technical solutions which can be obviously derived by those skilled in the art from the technical content disclosed still belong to the protection scope of the present invention.
In order to solve the problems of low diagnosis efficiency, accuracy and reliability of the existing spot blight disease control method, the embodiment of the invention provides a primer for rapidly detecting the apocynum venetum conidiophores based on an apocynum venetum conidiophores rDNA-ITS sequence, has the advantages of good specificity, high sensitivity and simplicity and rapidness in operation, and provides guarantee for the production of the apocynum venetum.
In the embodiment of the invention, the primer is designed based on the apocynum venetum conidium rDNA-ITS sequence; the sequence of apocynum venetum needle spore rDNA-ITS is SEQ ID NO. 3.
SEQ ID NO:3
GACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCTGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGCCGCGGTCAATCCGCGCGCCTCAAAGTCTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGTGCGGGCGGCCGCGGCCGTTAAATCTTTCACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC
In the embodiment of the invention, the primer sequence for rapidly detecting the septoria Xinjiang Aletalonum is SEQ ID NO. 4.
SEQ ID NO:4
GTGAATACTTAACCTGCATCTTTGCGTCGGAAGTTTTCAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGTAAGTAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGCATTTTCACCACTC
In the embodiment of the invention, the rapid detection primer sequence of the apocynum venetum conidium in Ulmus Gansu is SEQ ID NO. 5.
SEQ ID NO:5
GTCAACGCTCACCTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTA
According to the embodiment of the invention, DNA templates of marked and unobvious leaves of septoria and apocynum venetum spot blight are amplified by the rapid detection primers.
The primers used above were:
based on the rDNA-ITS sequence,
the primer sequence of the forward primer is SEQ ID NO. 1.
SEQ ID NO:1 GCGACCCTGCCGTTTCTGAC
The primer sequence of the reverse primer is SEQ ID NO. 2.
SEQ ID NO:2 AGTGGTGAAATGACGCTCGAACAG
The detection process is as follows:
and (3) PCR reaction system: a25 ul PCR reaction system is adopted, and the mixture ratio is as follows: dd H2O 9ul, 1ul each of primers, 1.5ul of DNA template or PCR product template, 12.5ul of Mix enzyme. Amplification was carried out on a bench PCR instrument model T100 Thermal Cycler.
Amplification conditions: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, 35 cycles, annealing at 60 deg.C (set according to optimal primer temperature) for 30s, extension at 72 deg.C for 30s, and preservation at 72 deg.C for 8 min.
Electrophoresis: after PCR amplification, 5ul of the amplified product was spotted on 1% agarose gel containing 10ul of nucleic acid staining solution, electrophoresed at 120V for 25min using 1 XTAE as the electrophoresis buffer, and then observed and photographed in a gel imaging system model RS 232.
The sterilized pcr tubes were placed on pcr racks, which were placed in an ice box to ensure that the reaction system was in a low temperature environment. Then add ddH2O 9ul, 1ul each of primers, 1.5ul of DNA template, 12.5ul of Mix enzyme in sequence, cover them, place them in a palm centrifuge for 30s, and transfer the PCR tubes to a bench PCR instrument model T100 Thermal Cycler. The PCR program was set to pre-denaturation 95 ℃ for 5min, denaturation 95 ℃ for 30s, 35 cycles, annealing temperature 60 ℃ (set to the optimal temperature for the primers) for 30s, extension at 72 ℃ for 30s, and storage at 72 ℃ for 8 min. The PCR product was stored at-4 ℃. Then, electrophoresis was performed on the PCR products, and 5. mu.l of the PCR products were spotted on 1% agarose gel to which 10. mu.l of nucleic acid staining solution was added, and after electrophoresis at 120V for 25min using 1 XTAE as an electrophoresis buffer, the gel was placed in a gel imaging system of RS232 to observe whether or not a band was present and photographed.
The embodiment of the invention focuses on fast detection of apocynum venetum septorium, and the used test strains are Septoria (Septoria apocyni) on apocynum venetum at the present stage, wherein the apocynum venetum septorium sample comprises Septoria separated from a disease strain of Xinjiang Alternata in 2020, Septoria separated from a disease strain of apocynum venetum in Yuzhong county in 2020, apocynum venetum leaves with striatum lesion collected in Xinjiang Alternata in 2020, and apocynum venetum leaves with striatum lesion collected in Yu county in Gansu in 2020, and the strains are used for fast detection of primers ITS-SepF and ITS-SepR. The result shows that primers ITS-SepF and ITS-SepR can rapidly detect the apocynum venetum conidiophore.
The sensitivity detection of the primers adopts septoria (Sa-1) separated from a patient suffering from apocynum venetum in Xinjiang in 2020, septoria (Sa-2) separated from a patient suffering from apocynum venetum in Ulmus pumila in 2020, apocynum venetum leaves (Sa-3) with ring-shaped disease spots collected in Aluta in Xinjiang in 2020, and apocynum venetum leaves (Sa-4) with ring-shaped disease spots collected in Ulmus pumila in 2020.
Firstly, the DNA (50 μ g) of the Sa-1 and Sa-2 samples is amplified by using primers ITS-SepF and ITS-SepR, and the amplification results of Sa-1 and Sa-2 are shown in FIG. 1, wherein lanes 1-2 are the amplification of Sa-1 sample by using the rapid detection primer, lanes 3-4 are the amplification of Sa-2 sample by using the rapid detection primer, and lanes 5-6 are dd water as a control.
Next, the DNAs of Sa-1 and Sa-2 were diluted by 7 concentration gradients, respectively: 10. mu.g, 1. mu.g, 100pg, 10pg, 1pg, 100fg, 10 fg. The 14 samples are respectively subjected to PCR amplification by using primers ITS-SepF and ITS-SepR, the primers ITS-SepF and ITS-SepR can detect the DNA concentration of 10fg or lower of the apocynum venetum, and the results are shown in figure 2, wherein lanes 1-7 and lanes 8-14 are respectively the amplification of 7 DNA dilution concentrations of the rapid detection primer pairs Sa-1 and Sa-2.
Finally, the DNAs (50. mu.g) of the Sa-3, Sa-4 overt and non-overt portions were amplified by using primers ITS-SepF and ITS-SepR, and the amplification results are shown in FIG. 3, wherein lanes 1-2 are the amplification of Sa-3 overt samples by the rapid detection primers; 3-4 lanes are the amplification of the rapid detection primer pair Sa-3 non-symptomatic sample; lanes 5-6 are the amplification results of the sample for rapid detection of the primer pair Sa-4 manifestation; lanes 7-8 are the amplification results of the rapid detection primer pair Sa-4 non-symptomatic samples (presuming that the non-symptomatic leaves in Ulmus kansuensis do not contain Septoria apocynum); lanes 9-10 are dd water as a control.
Biological material:
the studied target bacterial sources: septoria (Septoria apocyni). The plants of apocynum venetum in greenhouses from Xinjiang field and elm were isolated and stored in an incubator at 25 ℃.
Host: apocynum venetum (Apocynum venetum). In 2020, leaf of Apocynum venetum with ring-shaped lesion is collected in Aleptai of Xinjiang, and leaf of Apocynum venetum with ring-shaped lesion is collected in Yuzhong county of Gansu province, and all the leaves are stored in a refrigerator at 4 ℃.
Test consumables: omega Bio-Tek (Norcross, GA) model D2485-01 kit
Test equipment: DNA concentration detector (ND-one), echelon PCR instrument (T100 Thermal Cycler), electrophoresis instrument (WIX-EP 600), gel imaging instrument (RS 232), pipette gun (Eppendorf), and the like. Reagents and equipment not described in the invention are all reagents and equipment commonly used in the laboratory in the field. The specification is only pure grade in a laboratory.
Example 1 extraction of genomic DNA of pathogenic fungi
The method comprises the following steps: fungus is extracted by adopting an Ezup column type fungus genome DNA extraction kit of a Sangon Biotech B518259-010 model.
A: scraping 10-50mg of hypha or spore with glass slide into 1.5ml centrifuge tube, and breaking with ball mill. Adding 200ul of Buffer diagnostic and 2ul of beta-mercaptoethanol, adding 20ul of ProteinaseK solution, fully shaking and uniformly mixing, and carrying out water bath at 56 ℃ for 1h until the cells are completely lysed;
b: adding 100ul Buffer PF, fully reversing and mixing uniformly, and standing in a refrigerator at-20 ℃ for 5 min;
c: centrifuging at room temperature at 10000rpm for 5min, and transferring the supernatant into a new 1.5ml centrifuge tube;
d: adding 200ul Buffer BD, fully reversing and uniformly mixing;
e: adding 200ul of absolute ethyl alcohol, fully reversing and uniformly mixing;
f: putting the adsorption column into a collecting pipe, adding the solution and the semitransparent fibrous suspended matters into the adsorption column by using a liquid transfer device, standing for 2min, centrifuging at 10000rpm at room temperature for 1min, and pouring off waste liquid in the collecting pipe;
g: putting the adsorption column back to the collecting pipe, adding 500ul PW Solution, centrifuging at 10000rpm for 30s, and pouring off the waste liquid in the collecting pipe;
h: putting the adsorption column back to the collecting pipe, adding 500ul of Wash Solution, centrifuging at 10000rpm for 30s, and pouring out waste liquid in the collecting pipe;
i: putting the adsorption column back into the collection tube again, centrifuging at 12000rpm for 2min at room temperature, and leaving residual Wash Solution;
j: taking out the adsorption column, placing into a new 1.5ml centrifuge tube, adding 50ul TE Buffer, standing for 3min, centrifuging at 12000rpm at room temperature for 2min, and collecting DNA solution;
k: the extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
Example 2 extraction of DNA from leaves of Apocynum venetum plants
The method comprises the following steps: extracted by using a plant kit model D2485-01 of Omega Bio-Tek.
A: and (6) grinding. Placing 50mg of the dried sample in a sterilized mortar, adding liquid nitrogen, fully grinding, and transferring to a 2ul microcentrifuge tube;
b: 600ul CSPL Buffer was added. Mix by vortexing vigorously. Ensure dispersion of all agglomerates;
c: water bath at 65 ℃ for 30 minutes. The sample was turned over twice during the water bath;
d: 600ul of chloroform/isoamyl alcohol (24: 1) was added. Mixing by intense vortex;
e: centrifuging at 10000xg for 10 min;
f: transfer 300ul of supernatant to a new microcentrifuge tube to ensure that the pellet is not aspirated or any debris is transferred;
g: 150ul of CXD Buffer and 300ul of absolute ethanol were added. Vortex and mix evenly;
h: inserting the HiBind DNA miniature chromatographic columns into 2 mL collecting pipes;
i: transferring the whole sample (including any precipitate that may have formed) to HiBind DNA mini chromatography columns;
j: centrifuging at 10000Xg for 1 min;
k: discarding the filtrate and collection tube;
l: transferring the HiBind DNA miniature chromatographic column into a new 2 mL collecting pipe;
m: adding 700ul of DNA Wash Buffer;
n: centrifuging at 10000Xg for 1 min;
o: discarding the filtrate and reusing the collection tube;
p: repeating the step M-O, and performing a second DNA Wash Buffer washing step;
q: centrifuging the empty HiBind DNA miniature chromatographic columns at the maximum rotating speed for 2 min;
r: transferring the HiBind DNA miniature chromatographic column into a new 1.5 or 2 mL microcentrifuge tube (not provided);
s: adding 50-100ul of Elution Buffer (or sterile deionized water), and heating to 65 deg.C;
t: centrifuging at 10000Xg for 1 min;
u: repeating step S-T, and performing a second elution step;
v: the DNA was stored at-20 ℃.
Example 3 amplification of the apocynum venetum samples (Sa-1, Sa-2) by primers ITS-SepF and ITS-SepR
The primers ITS-SepF and ITS-SepR adopted in the embodiment of the invention are synthesized by Shanghai bioengineering company and stored in a refrigerator at-20 ℃.
Reaction system: a25 ul PCR reaction system is adopted, and the mixture ratio is as follows: dd H2O9 ul, 1ul of each primer, 1.5ul of DNA template and 12.5ul of Mix enzyme. Amplification was carried out on a bench PCR instrument model T100 Thermal Cycler.
Amplification conditions: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s and 35 cycles, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, and preservation at 72 deg.C for 8 min.
Electrophoresis: after PCR amplification, 5ul of the amplified product was spotted on 1% agarose gel containing 10ul of nucleic acid staining solution, 1 XTAE was used as the electrophoresis buffer, after electrophoresis at 120V for 25min, the gel was placed in a gel imaging system model RS232 for observation and photography, and the amplification results are shown in FIG. 1.
Example 4 the rapid detection primers were designed based on the ITS sequence of Septoria apocynum.
The nucleic acid sequence is:
based on the rDNA-ITS sequence,
forward primer (ITS-SepF): GCGACCCTGCCGTTTCTGAC
Reverse primer (ITS-SepR): AGTGGTGAAATGACGCTCGAACAG
Primer synthesis: the synthesis was carried out by Shanghai bioengineering, Inc.
Reaction system: a25 ul PCR reaction system is adopted, and the mixture ratio is as follows: dd H2O9 ul, 1ul of each primer, 1.5ul of DNA template or PCR product template, and 12.5ul of Mix enzyme. Amplification was carried out on a bench PCR instrument model T100 Thermal Cycler.
Amplification conditions: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s and 35 cycles, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, and preservation at 72 deg.C for 8 min.
Electrophoresis: after PCR amplification, 5ul of the amplified product was spotted on 1% agarose gel containing 10ul of nucleic acid staining solution, electrophoresed at 120V for 25min using 1 XTAE as the electrophoresis buffer, and then observed and photographed in a gel imaging system model RS 232.
Example 5
Sequencing: the banded PCR products were sent to bioengineering for sequencing.
The primers are adopted to amplify 4 samples of apocynum venetum conidiophorum. The amplification results are shown in FIGS. 1 and 3.
Therefore, the designed primer can be used for rapidly detecting the apocynum venetum septorium.
And (3) sensitive detection of the primers:
the DNA concentration gradients of both Sa-1 and Sa-2 samples were diluted to 10ug, 1ug, 100pg, 10pg, 1pg, 100fg, and 10 fg. The diluted DNA was used as a template, and the 14 samples were subjected to PCR amplification using the rapid detection primers ITS-SepF and ITS-SepR, respectively, according to the optimized reaction system and cycling conditions in the above example, and the amplification results are shown in FIG. 2.
Example 6 detection results of Septoria pelustris (Sa-3, Sa-4) in Apocynum venetum with and without manifestation
The leaves of apocynum venetum with or without marked symptoms of apocynum venetum leaf blight are collected in Aletai area of Xinjiang and Ulcenter county of Lanzhou, and are detected by designed primers ITS-SepF and ITS-SepR. The method steps are as in example 4, and the detection results are shown in FIG. 3.
In summary, the embodiment of the invention utilizes a molecular biology method to rapidly detect the apocynum venetum, particularly designs the primer for rapidly detecting the apocynum venetum spore based on the rDNA-ITS sequence of the apocynum venetum spore, has the advantages of good specificity, high sensitivity and simple and rapid operation, and provides guarantee for the production of the apocynum venetum
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Claims (8)
1. The primers for detecting the apocynum venetum septorium are characterized by comprising a forward primer and a reverse primer; the primer sequence of the forward primer is SEQ ID NO. 1 or the nucleotide complementary sequence of the primer sequence, and the primer sequence of the reverse primer is SEQ ID NO. 2 or the nucleotide complementary sequence of the primer sequence.
2. The primer for detecting apocynum venetum conidium according to claim 1, wherein the primer is designed based on apocynum venetum conidium rDNA-ITS sequence; the sequence of apocynum venetum needle spore rDNA-ITS is SEQ ID NO. 3.
3. The primer for detecting apocynum venetum septoria as claimed in claim 1, wherein the primer is a primer for detecting apocynum venetum septoria in Xinjiang, and the sequence of the primer is SEQ ID NO. 4.
4. The primer for detecting the apocynum venetum septorium as claimed in claim 1, wherein the primer is an apocynum venetum septorium detection primer in Ulmus pumila, Gansu, and the sequence of the primer is SEQ ID NO. 5.
5. A kit for detecting apocynum venetum septoria, which is characterized by comprising the primer according to claim 1.
6. The apocynum venetum conidium kit according to claim 5, further comprising: dd H2O, primer, DNA template and Mix enzyme.
7. A detection method for detecting apocynum venetum septorium is characterized by comprising the following steps:
obtaining a DNA template of a sample to be detected;
will dd H2O, the primer, the DNA template and the Mix enzyme of claim 1 are prepared into a PCR reaction system according to a predetermined preparation method;
and carrying out PCR reaction on the PCR reaction system under a preset amplification condition, and observing an amplification result based on an electrophoresis test so as to detect the apocynum venetum conidiospore.
8. The method for detecting apocynum venetum conidium as claimed in claim 7, wherein said preset amplification conditions are: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s and 35 cycles, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, and preservation at 72 deg.C for 8 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110446045.1A CN112961937A (en) | 2021-04-25 | 2021-04-25 | Primer for detecting apocynum venetum septoria, kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110446045.1A CN112961937A (en) | 2021-04-25 | 2021-04-25 | Primer for detecting apocynum venetum septoria, kit and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112961937A true CN112961937A (en) | 2021-06-15 |
Family
ID=76281219
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110446045.1A Pending CN112961937A (en) | 2021-04-25 | 2021-04-25 | Primer for detecting apocynum venetum septoria, kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112961937A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609677A (en) * | 2018-12-26 | 2019-04-12 | 阿勒泰戈宝茶股份有限公司 | The quickly primer and its reagent and kit of detection bluish dogbane grid rest fungus |
| CN109652580A (en) * | 2018-12-21 | 2019-04-19 | 华南农业大学 | Toothed oak tree early dries ribosomal RNA sequences and its application of disease pathogen Septoria sp |
| CN110438011A (en) * | 2019-07-30 | 2019-11-12 | 浙江理工大学 | Superfine branch spore is mould and its promotes the purposes of Radix Salviae Miltiorrhizae root system effective component synthesis |
| PL431170A1 (en) * | 2019-09-16 | 2021-03-22 | Uniwersytet Przyrodniczy W Lublinie | Oligonucleotide primers hybridizing within the Cyp51 gene for detecting the wheat fungal pathogen Zymoseptoria tritici causing septoria leaf blotch, and method of its detection |
-
2021
- 2021-04-25 CN CN202110446045.1A patent/CN112961937A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109652580A (en) * | 2018-12-21 | 2019-04-19 | 华南农业大学 | Toothed oak tree early dries ribosomal RNA sequences and its application of disease pathogen Septoria sp |
| CN109609677A (en) * | 2018-12-26 | 2019-04-12 | 阿勒泰戈宝茶股份有限公司 | The quickly primer and its reagent and kit of detection bluish dogbane grid rest fungus |
| CN110438011A (en) * | 2019-07-30 | 2019-11-12 | 浙江理工大学 | Superfine branch spore is mould and its promotes the purposes of Radix Salviae Miltiorrhizae root system effective component synthesis |
| PL431170A1 (en) * | 2019-09-16 | 2021-03-22 | Uniwersytet Przyrodniczy W Lublinie | Oligonucleotide primers hybridizing within the Cyp51 gene for detecting the wheat fungal pathogen Zymoseptoria tritici causing septoria leaf blotch, and method of its detection |
Non-Patent Citations (5)
| Title |
|---|
| GAO,P.等: ""Septoria apocyni strain LB-02 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence"", 《NCBI》 * |
| J. E. WEILAND等: ""Cultural and PCR-based detection of Septoria musiva in inoculated hybrid poplar stems"", 《FOR. PATH.》 * |
| P GAO等: ""First Report of Septoria apocyni Causing Spot Blight on the Species of Apocynum venetum and Poacynum pictum in China"", 《PLANT DISEASE》 * |
| 何培新等: "《高级微生物学》", 31 August 2017 * |
| 高鹏等: ""罗布麻锈病病原菌鉴定"", 《植物保护学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110951838A (en) | Primer, probe, kit and application for detecting meloidogyne hapla based on RPA-LFD technology | |
| CN110567951A (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN104513860B (en) | A kind of method of quick diagnosis mulberry fruit scaled-down version sclerotiniose | |
| CN104762370B (en) | The nucleotide sequence and method of Chinese Taxus kind and kind are distinguished in identification | |
| CN108315471B (en) | Specific gene and specific primer for identifying plasmodiophora tumefaciens No.4 physiological race, kit containing primer and application of kit | |
| CN104830984B (en) | The fluorescence PCR detecting method and the primer and probe of melon anthrax bacteria | |
| CN111088395B (en) | LAMP (loop-mediated isothermal amplification) detection primer group and method for gaeumannomyces graminis gaeumannomyces | |
| CN104031997A (en) | LAMP (loop-mediated isothermal amplification) primer group for quickly detecting sporisorium scitamineum, kit and detection method thereof | |
| CN111321242A (en) | Rapid molecular detection method and application of rubber tree anthracnose pathogen Siamese anthrax | |
| CN112961937A (en) | Primer for detecting apocynum venetum septoria, kit and detection method thereof | |
| CN106957915B (en) | Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method | |
| CN113136442B (en) | Method and kit for detecting erwinia amylovora based on LFD-RPA technology and application of method and kit | |
| CN111996274B (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN110819734B (en) | Apple tree rot fungus LAMP amplification primer and apple tree rot disease detection kit | |
| CN113637779A (en) | Method for rapidly detecting vibrio mimicus in clinical blood sample | |
| CN101768632B (en) | Method for detecting aspergillus by polymerase chain reaction | |
| CN106222291B (en) | A kind of kit of Molecular Detection strain different with identification sugarcane red streak bacterium | |
| CN109609677A (en) | The quickly primer and its reagent and kit of detection bluish dogbane grid rest fungus | |
| CN111471793A (en) | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium sporotrichioides | |
| CN113789401B (en) | Primer for detecting phytophthora nicotianae by loop-mediated isothermal amplification method and detection method thereof | |
| CN114058731B (en) | Molecular marker for distinguishing rice blast fungus sources and application thereof | |
| CN114015800B (en) | SNP molecular marker linked with rice blast indica-japonica-derived traits and application thereof | |
| CN113430296B (en) | Dual PCR primer and detection method for synchronously and rapidly detecting peronophythora litchi and colletotrichum | |
| CN108396072B (en) | Method for rapidly identifying cichorium hirsutum and cichorium intybus | |
| CN116083640A (en) | Primer probe set, kit and method for detecting or identifying verticillium alfa by RPA and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210615 |
|
| RJ01 | Rejection of invention patent application after publication |