CN112941186A

CN112941186A - Breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof

Info

Publication number: CN112941186A
Application number: CN202110360597.0A
Authority: CN
Inventors: 王学东; 王玥苹; 周道平; 郑国沛; 唐海林; 顾娟
Original assignee: Wuxi Fifth Peoples Hospital
Current assignee: Wuxi Fifth Peoples Hospital
Priority date: 2021-04-02
Filing date: 2021-04-02
Publication date: 2021-06-11
Anticipated expiration: 2041-04-02
Also published as: CN112941186B

Abstract

The invention discloses a breast cancer susceptibility gene BRCA2-K2305N mutant and a specific primer thereof, belonging to the technical field of molecular biology. A primer sequence containing the mutant gene changed is designed by using a PCR-specific primer technology, and PCR amplification detection is carried out on the g.32344631G > T mutation site of the specific BRCA2 gene. The invention provides a new mutation site of a breast cancer related gene, which can be used for screening early breast cancer.

Description

Breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a T site mutant of breast cancer susceptibility gene BRCA2g.32344631G and a specific primer thereof.

Background

In recent years, the incidence and mortality of cancer in China are rising, and malignant tumors become a great public health problem in China. According to 2016 published results in the national tumor registration center, 358.6 thousands of new cases, 218.7 thousands of cases of death, 265/10 thousands of gross morbidity and 161.5/10 ten thousands of mortality of the tumors in 2012 are shown. In the current situation of malignant tumor, breast cancer is the first in female malignant tumor, is about 27.3 thousands of new breast cancer every year, and the onset age of breast cancer continuously shows the trend of younger development, and is the first killer seriously threatening the life of women.

Breast cancer is a malignant tumor with a strong genetic background, and existing studies show that 5-10% of breast cancers are caused by genetic factors. Genes such as BRCA1, BRCA2, TP53, PALB2, PTEN, CHEK2, ATM and RAD0 are currently identified as susceptibility genes of breast cancer, wherein BRCA and BRCA2 genes are main susceptibility genes of hereditary breast cancer. Research shows that the probability of the people carrying the pathogenic mutation of the BCA1 and BRCA2 genes to have breast cancer before the age of 70 years can reach 40-80% and 20-85%, and the probability of the recurrence and metastasis of the patients diagnosed with hereditary breast cancer is higher than that of the ordinary people.

BRCA1 and BRCA2 belong to cancer suppressor genes, are both autosomal dominant inheritance, and mutations are likely to cause early onset. The BRCA2 gene is located in human chromosome 13q12, contains 27 exons, and codes BRCA2 protein containing 3418 amino acids, which plays an important role in regulating cell growth. The protein expressed after the BRCA2 gene is mutated loses the function of repairing DNA damage, causes chromosome instability and promotes tumorigenesis. The probability of prostate cancer, breast cancer and pancreatic cancer in the life-long carrier of BRCA2 is 20%, 6% and 3%, respectively, while the probability of breast cancer in the life-long carrier of BRCA2 is 26% -84%, and the probability of ovarian cancer is 20%. Tumors associated with mutations in the BRCA2 gene tend to express ER (estrogen receptor) and PR (progesterone receptor) and exhibit similar characteristics as sporadic breast cancer. The BRCA2 mutation is mainly reported to be a frameshift mutation and also can generate a large number of missense mutations, but most missense mutations belong to unknown mutation, so that the discovery of a new pathogenic mutation of BRCA2 has important significance for developing molecular diagnosis of hereditary breast cancer.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides a T site mutant of a breast cancer susceptibility gene BRCA2g.32344631G and a specific primer thereof, provides a new mutation site causing breast cancer, and can be used for screening early breast cancer.

The technical scheme is as follows: in order to achieve the purpose, the technical scheme of the invention is as follows:

a breast cancer susceptibility gene BRCA2-K2305N mutant, the mutant gene has g.32344631G > T site mutation compared with BRCA2 normal gene sequence; the BRCA2 gene g.32344631G > T site mutation means that the mutation site is mutated into T at the 277 th base G of the SEQ ID NO. 1 sequence.

A specific primer for detecting the breast cancer susceptibility gene BRCA2-K2305N as claimed in claim 1, wherein the sequence of the upstream primer of the specific primer is shown as SEQ ID NO. 3, and the sequence of the downstream primer is shown as SEQ ID NO. 4, and the specific primer is used for detecting the G.32344631G > T site mutation of the BRCA2-K2305N gene.

Has the advantages that: the mutation site is found in Chinese Han family female breast cancer patients for the first time in the research, the mutation does not exist in normal population, and the database shows that the mutation site is not found in the scanning of the region of European and American population.

According to the invention, by controlling the influence factors of age on disease development, the application prospect of the mutation site in breast cancer auxiliary diagnosis is researched, the influence of the mutation site on breast cancer progress is explained, and the diagnosis value of the mutation site is disclosed. Therefore, the invention obtains the mutation site spectrum and the specific marker related to the breast cancer.

Through detection of the mutation sites, diagnosis of breast cancer can be more convenient and feasible, a clinician can quickly and accurately master the state of illness of a patient, a foundation is laid for evaluation of clinical treatment effect, and help is provided for finding a novel micromolecular drug target with potential treatment value.

Therefore, the research enriches the pathogenic mutation spectrum of the BRCA2 gene, and has important significance for developing molecular diagnosis and high risk group screening of hereditary breast cancer.

Drawings

FIG. 1 is a gel electrophoresis diagram of the g.32344631G > T mutation of BRCA2 gene;

FIG. 2 is a sequence diagram of the g.32344631G > T mutation of BRCA2 gene.

Detailed Description

The present invention will be further described with reference to the accompanying drawings.

The invention aims to provide a BRCA2-K2305N mutant with a novel mutation site.

The high-specificity mutation site related to the breast cancer is searched by separating and researching the mutation in the DNA of the breast cancer patient and the healthy control peripheral blood matched with the breast cancer patient in age, and a breast cancer auxiliary diagnosis kit applicable to clinic or people is developed to provide support for screening and diagnosing the breast cancer.

A BRCA2 mutant gene for auxiliary diagnosis of breast cancer, which has g.32344631G > T site mutation compared with the sequence of BRCA2 normal gene. The BRCA2 gene g.32344631G > T site mutation means that the mutation site is mutated into T at the 277 th base G of the SEQ ID NO. 1 sequence.

The DNA sequence of the wild type gene is shown as SEQ ID NO. 1, and the DNA sequence of the mutant type gene is shown as SEQ ID NO. 2.

SEQ ID NO:1

AGTGGTCAAAACAGAACAAAAATGTAATTGACATTGAAGACTGACTTTACTCTTTCAAACATTAGGTCACTATTTGTTGTAAGTATTTTTGTTTAACATTTAAAGAGTCAATACTTTAGCTTTAAAAAAATGGTCTATAGACTTTTGAGAAATAAAACTGATATTATTTGCCTTAAAAACATATATGAAATATTTCTTTTTAGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTTGACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGTAAAATTAGCTTTTTATTTATATCTGTTCTCCCTCTATAGGTATGGTATATAATATTCTGACCTCAGGTGATCCACCTGCCTCTCAAAGTGCTGGGATTACAG

SEQ ID NO:2

AGTGGTCAAAACAGAACAAAAATGTAATTGACATTGAAGACTGACTTTACTCTTTCAAACATTAGGTCACTATTTGTTGTAAGTATTTTTGTTTAACATTTAAAGAGTCAATACTTTAGCTTTAAAAAAATGGTCTATAGACTTTTGAGAAATAAAACTGATATTATTTGCCTTAAAAACATATATGAAATATTTCTTTTTAGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTTGACAGGATAATAGAAAATCAAGAAAAATCCTTAAATGCTTCAAAAAGCACTCCAGATGGTAAAATTAGCTTTTTATTTATATCTGTTCTCCCTCTATAGGTATGGTATATAATATTCTGACCTCAGGTGATCCACCTGCCTCTCAAAGTGCTGGGATTACAG

In 71 Han female Chinese breast cancer patients with family history of breast cancer, PCR amplification and Sanger sequencing technologies are adopted in the research, and 1 patient is found to have mutation from base G to base T at the 32344631 position of chromosome 13 of BRCA2 genome. The gene is numbered NC-000013.11 (32315480-32399672) in the NCBl reference database GRCh38. p13. No mutant individuals were found in 1370 age-matched normal female control populations without family history of tumors. The mutation site is found in Chinese Han family female breast cancer patients for the first time in the research, and the mutation does not exist in normal people.

The invention provides a g.32344631G > T site mutant BRCA2-K2305N of a breast cancer related BRCA2 gene. The mutation occurs at position 32344631 on chromosome 13. The gene is numbered NC-000013.11 (32315480-32399672) in the NCBl reference database GRCh38. p13. A partial base sequence containing the wild type at that site in the database is shown here for reference as SEQ ID NO 1; the sequence corresponding to BRCA2 gene mutation is shown in SEQ ID NO. 2; wherein the mutation site is mutated from a base G to a base T at the 277 th site of the SEQ ID NO. 1 sequence. The wild-type amino acid sequence of the BRCA2 gene coding sequence is shown as SEQ ID NO: 5, wherein the amino acid change is as set forth in SEQ ID NO: the 2305 th position in the 6-sequence is converted from lysine (K) to asparagine (N).

SEQ ID NO:5

MPIGSKERPTFFEIFKTRCNKADLGPISLNWFEELSSEAPPYNSEPAEESEHKNNNYEPNLFKTPQRKPSYNQLASTPIIFKEQGLTLPLYQSPVKELDKFKLDLGRNVPNSRHKSLRTVKTKMDQADDVSCPLLNSCLSESPVVLQCTHVTPQRDKSVVCGSLFHTPKFVKGRQTPKHISESLGAEVDPDMSWSSSLATPPTLSSTVLIVRNEEASETVFPHDTTANVKSYFSNHDESLKKNDRFIASVTDSENTNQREAASHGFGKTSGNSFKVNSCKDHIGKSMPNVLEDEVYETVVDTSEEDSFSLCFSKCRTKNLQKVRTSKTRKKIFHEANADECEKSKNQVKEKYSFVSEVEPNDTDPLDSNVANQKPFESGSDKISKEVVPSLACEWSQLTLSGLNGAQMEKIPLLHISSCDQNISEKDLLDTENKRKKDFLTSENSLPRISSLPKSEKPLNEETVVNKRDEEQHLESHTDCILAVKQAISGTSPVASSFQGIKKSIFRIRESPKETFNASFSGHMTDPNFKKETEASESGLEIHTVCSQKEDSLCPNLIDNGSWPATTTQNSVALKNAGLISTLKKKTNKFIYAIHDETSYKGKKIPKDQKSELINCSAQFEANAFEAPLTFANADSGLLHSSVKRSCSQNDSEEPTLSLTSSFGTILRKCSRNETCSNNTVISQDLDYKEAKCNKEKLQLFITPEADSLSCLQEGQCENDPKSKKVSDIKEEVLAAACHPVQHSKVEYSDTDFQSQKSLLYDHENASTLILTPTSKDVLSNLVMISRGKESYKMSDKLKGNNYESDVELTKNIPMEKNQDVCALNENYKNVELLPPEKYMRVASPSRKVQFNQNTNLRVIQKNQEETTSISKITVNPDSEELFSDNENNFVFQVANERNNLALGNTKELHETDLTCVNEPIFKNSTMVLYGDTGDKQATQVSIKKDLVYVLAEENKNSVKQHIKMTLGQDLKSDISLNIDKIPEKNNDYMNKWAGLLGPISNHSFGGSFRTASNKEIKLSEHNIKKSKMFFKDIEEQYPTSLACVEIVNTLALDNQKKLSKPQSINTVSAHLQSSVVVSDCKNSHITPQMLFSKQDFNSNHNLTPSQKAEITELSTILEESGSQFEFTQFRKPSYILQKSTFEVPENQMTILKTTSEECRDADLHVIMNAPSIGQVDSSKQFEGTVEIKRKFAGLLKNDCNKSASGYLTDENEVGFRGFYSAHGTKLNVSTEALQKAVKLFSDIENISEETSAEVHPISLSSSKCHDSVVSMFKIENHNDKTVSEKNNKCQLILQNNIEMTTGTFVEEITENYKRNTENEDNKYTAASRNSHNLEFDGSDSSKNDTVCIHKDETDLLFTDQHNICLKLSGQFMKEGNTQIKEDLSDLTFLEVAKAQEACHGNTSNKEQLTATKTEQNIKDFETSDTFFQTASGKNISVAKESFNKIVNFFDQKPEELHNFSLNSELHSDIRKNKMDILSYEETDIVKHKILKESVPVGTGNQLVTFQGQPERDEKIKEPTLLGFHTASGKKVKIAKESLDKVKNLFDEKEQGTSEITSFSHQWAKTLKYREACKDLELACETIEITAAPKCKEMQNSLNNDKNLVSIETVVPPKLLSDNLCRQTENLKTSKSIFLKVKVHENVEKETAKSPATCYTNQSPYSVIENSALAFYTSCSRKTSVSQTSLLEAKKWLREGIFDGQPERINTADYVGNYLYENNSNSTIAENDKNHLSEKQDTYLSNSSMSNSYSYHSDEVYNDSGYLSKNKLDSGIEPVLKNVEDQKNTSFSKVISNVKDANAYPQTVNEDICVEELVTSSSPCKNKNAAIKLSISNSNNFEVGPPAFRIASGKIVCVSHETIKKVKDIFTDSFSKVIKENNENKSKICQTKIMAGCYEALDDSEDILHNSLDNDECSTHSHKVFADIQSEEILQHNQNMSGLEKVSKISPCDVSLETSDICKCSIGKLHKSVSSANTCGIFSTASGKSVQVSDASLQNARQVFSEIEDSTKQVFSKVLFKSNEHSDQLTREENTAIRTPEHLISQKGFSYNVVNSSAFSGFSTASGKQVSILESSLHKVKGVLEEFDLIRTEHSLHYSPTSRQNVSKILPRVDKRNPEHCVNSEMEKTCSKEFKLSNNLNVEGGSSENNHSIKVSPYLSQFQQDKQQLVLGTKVSLVENIHVLGKEQASPKNVKMEIGKTETFSDVPVKTNIEVCSTYSKDSENYFETEAVEIAKAFMEDDELTDSKLPSHATHSLFTCPENEEMVLSNSRIGKRRGEPLILVGEPSIKRNLLNEFDRIIENQEKSLKASKSTPD

SEQ ID NO:6

MPIGSKERPTFFEIFKTRCNKADLGPISLNWFEELSSEAPPYNSEPAEESEHKNNNYEPNLFKTPQRKPSYNQLASTPIIFKEQGLTLPLYQSPVKELDKFKLDLGRNVPNSRHKSLRTVKTKMDQADDVSCPLLNSCLSESPVVLQCTHVTPQRDKSVVCGSLFHTPKFVKGRQTPKHISESLGAEVDPDMSWSSSLATPPTLSSTVLIVRNEEASETVFPHDTTANVKSYFSNHDESLKKNDRFIASVTDSENTNQREAASHGFGKTSGNSFKVNSCKDHIGKSMPNVLEDEVYETVVDTSEEDSFSLCFSKCRTKNLQKVRTSKTRKKIFHEANADECEKSKNQVKEKYSFVSEVEPNDTDPLDSNVANQKPFESGSDKISKEVVPSLACEWSQLTLSGLNGAQMEKIPLLHISSCDQNISEKDLLDTENKRKKDFLTSENSLPRISSLPKSEKPLNEETVVNKRDEEQHLESHTDCILAVKQAISGTSPVASSFQGIKKSIFRIRESPKETFNASFSGHMTDPNFKKETEASESGLEIHTVCSQKEDSLCPNLIDNGSWPATTTQNSVALKNAGLISTLKKKTNKFIYAIHDETSYKGKKIPKDQKSELINCSAQFEANAFEAPLTFANADSGLLHSSVKRSCSQNDSEEPTLSLTSSFGTILRKCSRNETCSNNTVISQDLDYKEAKCNKEKLQLFITPEADSLSCLQEGQCENDPKSKKVSDIKEEVLAAACHPVQHSKVEYSDTDFQSQKSLLYDHENASTLILTPTSKDVLSNLVMISRGKESYKMSDKLKGNNYESDVELTKNIPMEKNQDVCALNENYKNVELLPPEKYMRVASPSRKVQFNQNTNLRVIQKNQEETTSISKITVNPDSEELFSDNENNFVFQVANERNNLALGNTKELHETDLTCVNEPIFKNSTMVLYGDTGDKQATQVSIKKDLVYVLAEENKNSVKQHIKMTLGQDLKSDISLNIDKIPEKNNDYMNKWAGLLGPISNHSFGGSFRTASNKEIKLSEHNIKKSKMFFKDIEEQYPTSLACVEIVNTLALDNQKKLSKPQSINTVSAHLQSSVVVSDCKNSHITPQMLFSKQDFNSNHNLTPSQKAEITELSTILEESGSQFEFTQFRKPSYILQKSTFEVPENQMTILKTTSEECRDADLHVIMNAPSIGQVDSSKQFEGTVEIKRKFAGLLKNDCNKSASGYLTDENEVGFRGFYSAHGTKLNVSTEALQKAVKLFSDIENISEETSAEVHPISLSSSKCHDSVVSMFKIENHNDKTVSEKNNKCQLILQNNIEMTTGTFVEEITENYKRNTENEDNKYTAASRNSHNLEFDGSDSSKNDTVCIHKDETDLLFTDQHNICLKLSGQFMKEGNTQIKEDLSDLTFLEVAKAQEACHGNTSNKEQLTATKTEQNIKDFETSDTFFQTASGKNISVAKESFNKIVNFFDQKPEELHNFSLNSELHSDIRKNKMDILSYEETDIVKHKILKESVPVGTGNQLVTFQGQPERDEKIKEPTLLGFHTASGKKVKIAKESLDKVKNLFDEKEQGTSEITSFSHQWAKTLKYREACKDLELACETIEITAAPKCKEMQNSLNNDKNLVSIETVVPPKLLSDNLCRQTENLKTSKSIFLKVKVHENVEKETAKSPATCYTNQSPYSVIENSALAFYTSCSRKTSVSQTSLLEAKKWLREGIFDGQPERINTADYVGNYLYENNSNSTIAENDKNHLSEKQDTYLSNSSMSNSYSYHSDEVYNDSGYLSKNKLDSGIEPVLKNVEDQKNTSFSKVISNVKDANAYPQTVNEDICVEELVTSSSPCKNKNAAIKLSISNSNNFEVGPPAFRIASGKIVCVSHETIKKVKDIFTDSFSKVIKENNENKSKICQTKIMAGCYEALDDSEDILHNSLDNDECSTHSHKVFADIQSEEILQHNQNMSGLEKVSKISPCDVSLETSDICKCSIGKLHKSVSSANTCGIFSTASGKSVQVSDASLQNARQVFSEIEDSTKQVFSKVLFKSNEHSDQLTREENTAIRTPEHLISQKGFSYNVVNSSAFSGFSTASGKQVSILESSLHKVKGVLEEFDLIRTEHSLHYSPTSRQNVSKILPRVDKRNPEHCVNSEMEKTCSKEFKLSNNLNVEGGSSENNHSIKVSPYLSQFQQDKQQLVLGTKVSLVENIHVLGKEQASPKNVKMEIGKTETFSDVPVKTNIEVCSTYSKDSENYFETEAVEIAKAFMEDDELTDSKLPSHATHSLFTCPENEEMVLSNSRIGKRRGEPLILVGEPSIKRNLLNEFDRIIENQEKSLNASKSTPD

Another objective of the invention is to provide a specific primer sequence for detecting the mutation site.

Specific primers for the mutation sites of the BRCA2 gene are used for PCR amplification, and the presence or absence of the mutation product fragment of the BRCA2 gene is detected; and detecting whether the site base mutation exists or not by adopting a Sanger sequencing method, wherein the sequence of an upstream primer of the PCR amplification primer is shown as SEQ ID NO. 3 in the table 1, and the sequence of a downstream primer is shown as SEQ ID NO. 4 in the table 1.

The detection method of the invention is completed by utilizing the change of specific sequence sites of different genotypes of the human BRCA2 gene to design a primer sequence aiming at the mutation sites and carrying out polymerase chain reaction.

The invention adopts a Sanger sequencing method and uses PCR amplification primers to carry out mutation detection on BRCA2 gene; wherein the sequence of the upstream primer of the PCR amplification primer is shown as SEQ ID NO. 3, and the sequence of the downstream primer is shown as SEQ ID NO. 4.

EXAMPLE 1 preparation of DNA template

The method adopts a purchased kit to extract the whole blood genome DNA, and comprises the following specific steps:

(1) one sterile 2.0mL centrifuge tube was added to 1mL of cell lysate.

(2) Gently shaking the whole blood sample anticoagulated by EDTA until the whole blood sample is thoroughly mixed; then, 500. mu.L of blood sample is sucked and added into the centrifuge tube containing the cell lysate, and the centrifuge tube is gently poured 5-6 times to mix evenly.

(3) Incubate for 10 minutes at room temperature (during which the tube is inverted for 2-3 rounds of mixing).

(4) Centrifuge at 12000rpm for 5 minutes at room temperature.

(5) The supernatant was removed as slowly as possible with a pipette, taking care not to aspirate the white material at the interface between the two phases.

(6) Mix vigorously using a vortex shaker (Votex) until the leukocytes are resuspended (10-15 seconds).

(7) To the resuspended cell solution was added 300. mu.L of the lysis solution. The solution was pipetted 5-6 times to lyse the leukocytes. At which point the solution should become very viscous. If a clump of cells is visible after mixing, the solution is incubated at 37 ℃ until the clump dissipates. If cell clumps remain visible after 1 hour of incubation, an additional 100. mu.L of nuclear lysate is added and incubation at 37 ℃ is repeated.

(8) To the nuclear lysate, 100. mu.L of protein precipitation solution was added, and vigorously shaken with a vortex shaker for 10-20 seconds.

(9) Centrifuge at 12000rpm for 5 minutes at room temperature.

(10) The supernatant was transferred to a correspondingly numbered 2.0mL centrifuge tube to which 300. mu.L of room temperature isopropanol had been added.

(11) The solution was mixed by gentle inversion until a white linear DNA precipitate formed.

(12) Centrifuge at 12000rpm for 1 min at room temperature.

(13) The supernatant was discarded, and a volume of room temperature 70% ethanol equal to the volume of the sample was added, and the tube was gently inverted several times.

(14) The ethanol solution was removed as slowly as possible by pipette. And (3) baking the centrifugal tube at 50 ℃ for 5-10 minutes to completely volatilize residual ethanol liquid as far as possible.

(15) Add 50-100. mu.L of DNA lysis solution to the tube and mix gently.

(16) The DNA extraction effect was evaluated by 1% agarose gel electrophoresis, and the content was quantified to 20-50 ng/. mu.L using a Nanodrop nucleic acid analyzer and stored at-20 ℃.

Example 2BRCA2 gene g.32344631g > T mutant gene detection protocol:

the instrument comprises the following steps: veriti 96 type PCR instrument, BIO-RAD Gel Doc XR + type Gel imager (Berle, USA), Gel electrophoresis instrument (Hex, Beijing).

Reagent: QIAamp DNA extraction kit (Qiagen, Germany); DNA Isolation Kit extraction Kit (Beijing PELFREEZ company); PCR buffer, dNTP, Taq enzyme (ABI, USA); the primers were synthesized by Shanghai Biometrics, Inc.

(1) Designing a primer: designing primers according to BRCA2 gene (sequence number: NC-000013.11) recorded by GenBank of National Center for Biological Information (NCBI) through Oligo 6.0 primer software, and finally determining 1 pair of specific oligonucleotide primer sequences, wherein the forward primer sequence is shown as SEQID NO. 3 in Table 1; the reverse primer sequence is shown as SEQID NO. 4, and the length of the amplified product fragment is 172 bp.

TABLE 1 related mutation site oligonucleotide primer sequences

Note: f ═ forward primer sequence; r ═ reverse primer sequence

(2) Total volume of reaction: 50 μ L, 10 μ L containing PCR 5 Xbuffer, 5.0 μ L DNA template, 1.0 μ L Taq polymerase (1U/. mu.L), 2.0mmol/L MgCl2, 200nmol dNTP, and 200nmol specific upper and lower primers, and sterile double distilled water to a total volume of 50 μ L.

(3) Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min followed by subsequent denaturation at 95 ℃ for 30 sec, followed by annealing at 58 ℃ for 30 sec, and extension at 72 ℃ for 1 min for 35 cycles.

(4) BRCA2 gene g.32344631G > T mutant gene detection: the amplified product obtained in step (2) was electrophoresed using 1.5% agarose gel to detect the intended fragment. And observing and photographing the result by a gel imager, and displaying the PCR product as a single band after electrophoresis without a miscellaneous band, thus prompting that the PCR product is single and has no non-specific amplification. If the position of the stripe is in a position with proper size, the target segment is obtained. As shown in fig. 1, M: DNA Marker, 1: blank control, 2: wild-type control, 3: BRCA2 gene g.32344631G > T mutant sample.

(5) And (3) purifying an amplification product: in the research, an Agarose Gel DNA Purification Kit of Takara company is adopted, and a PCR product subjected to Agarose Gel electrophoresis is purified and recovered to prepare sequencing.

(6) Sanger sequencing and result judgment: the purified PCR product was sequenced on an ABI3730 type fully automatic DNA sequencer. The sequencing results were aligned to the BRCA2 wild-type Reference Sequence (NCBI Reference Sequence: NC-000013.11), and the results were reported as a function of the actual mutation. The gene mutation is shown in FIG. 2, and the arrow in the figure shows that the BRCA2 gene site g.32344631G > T mutation.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Sequence listing

<110> fifth people hospital in Wuxi city

<120> breast cancer susceptibility gene BRCA2-K2305N mutant and specific primer thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 403

<212> DNA

<213> Homo sapiens

<400> 1

agtggtcaaa acagaacaaa aatgtaattg acattgaaga ctgactttac tctttcaaac 60

attaggtcac tatttgttgt aagtattttt gtttaacatt taaagagtca atactttagc 120

tttaaaaaaa tggtctatag acttttgaga aataaaactg atattatttg ccttaaaaac 180

atatatgaaa tatttctttt taggagaacc ctcaatcaaa agaaacttat taaatgaatt 240

tgacaggata atagaaaatc aagaaaaatc cttaaaggct tcaaaaagca ctccagatgg 300

taaaattagc tttttattta tatctgttct ccctctatag gtatggtata taatattctg 360

acctcaggtg atccacctgc ctctcaaagt gctgggatta cag 403

<210> 2

<211> 403

<212> DNA

<213> Homo sapiens

<400> 2

agtggtcaaa acagaacaaa aatgtaattg acattgaaga ctgactttac tctttcaaac 60

attaggtcac tatttgttgt aagtattttt gtttaacatt taaagagtca atactttagc 120

tttaaaaaaa tggtctatag acttttgaga aataaaactg atattatttg ccttaaaaac 180

atatatgaaa tatttctttt taggagaacc ctcaatcaaa agaaacttat taaatgaatt 240

tgacaggata atagaaaatc aagaaaaatc cttaaatgct tcaaaaagca ctccagatgg 300

taaaattagc tttttattta tatctgttct ccctctatag gtatggtata taatattctg 360

acctcaggtg atccacctgc ctctcaaagt gctgggatta cag 403

<210> 3

<211> 26

<212> DNA

<213> Homo sapiens

<400> 3

tagaaaatca agaaaaatcc ttaaat 26

<210> 4

<211> 24

<212> DNA

<213> Homo sapiens

<400> 4

ttaggcacag tggctcatgt ctgt 24

<210> 5

<211> 2312

<212> PRT

<213> Homo sapiens

<400> 5

Met Pro Ile Gly Ser Lys Glu Arg Pro Thr Phe Phe Glu Ile Phe Lys

1 5 10 15

Thr Arg Cys Asn Lys Ala Asp Leu Gly Pro Ile Ser Leu Asn Trp Phe

20 25 30

Glu Glu Leu Ser Ser Glu Ala Pro Pro Tyr Asn Ser Glu Pro Ala Glu

35 40 45

Glu Ser Glu His Lys Asn Asn Asn Tyr Glu Pro Asn Leu Phe Lys Thr

50 55 60

Pro Gln Arg Lys Pro Ser Tyr Asn Gln Leu Ala Ser Thr Pro Ile Ile

65 70 75 80

Phe Lys Glu Gln Gly Leu Thr Leu Pro Leu Tyr Gln Ser Pro Val Lys

85 90 95

Glu Leu Asp Lys Phe Lys Leu Asp Leu Gly Arg Asn Val Pro Asn Ser

100 105 110

Arg His Lys Ser Leu Arg Thr Val Lys Thr Lys Met Asp Gln Ala Asp

115 120 125

Asp Val Ser Cys Pro Leu Leu Asn Ser Cys Leu Ser Glu Ser Pro Val

130 135 140

Val Leu Gln Cys Thr His Val Thr Pro Gln Arg Asp Lys Ser Val Val

145 150 155 160

Cys Gly Ser Leu Phe His Thr Pro Lys Phe Val Lys Gly Arg Gln Thr

165 170 175

Pro Lys His Ile Ser Glu Ser Leu Gly Ala Glu Val Asp Pro Asp Met

180 185 190

Ser Trp Ser Ser Ser Leu Ala Thr Pro Pro Thr Leu Ser Ser Thr Val

195 200 205

Leu Ile Val Arg Asn Glu Glu Ala Ser Glu Thr Val Phe Pro His Asp

210 215 220

Thr Thr Ala Asn Val Lys Ser Tyr Phe Ser Asn His Asp Glu Ser Leu

225 230 235 240

Lys Lys Asn Asp Arg Phe Ile Ala Ser Val Thr Asp Ser Glu Asn Thr

245 250 255

Asn Gln Arg Glu Ala Ala Ser His Gly Phe Gly Lys Thr Ser Gly Asn

260 265 270

Ser Phe Lys Val Asn Ser Cys Lys Asp His Ile Gly Lys Ser Met Pro

275 280 285

Asn Val Leu Glu Asp Glu Val Tyr Glu Thr Val Val Asp Thr Ser Glu

290 295 300

Glu Asp Ser Phe Ser Leu Cys Phe Ser Lys Cys Arg Thr Lys Asn Leu

305 310 315 320

Gln Lys Val Arg Thr Ser Lys Thr Arg Lys Lys Ile Phe His Glu Ala

325 330 335

Asn Ala Asp Glu Cys Glu Lys Ser Lys Asn Gln Val Lys Glu Lys Tyr

340 345 350

Ser Phe Val Ser Glu Val Glu Pro Asn Asp Thr Asp Pro Leu Asp Ser

355 360 365

Asn Val Ala Asn Gln Lys Pro Phe Glu Ser Gly Ser Asp Lys Ile Ser

370 375 380

Lys Glu Val Val Pro Ser Leu Ala Cys Glu Trp Ser Gln Leu Thr Leu

385 390 395 400

Ser Gly Leu Asn Gly Ala Gln Met Glu Lys Ile Pro Leu Leu His Ile

405 410 415

Ser Ser Cys Asp Gln Asn Ile Ser Glu Lys Asp Leu Leu Asp Thr Glu

420 425 430

Asn Lys Arg Lys Lys Asp Phe Leu Thr Ser Glu Asn Ser Leu Pro Arg

435 440 445

Ile Ser Ser Leu Pro Lys Ser Glu Lys Pro Leu Asn Glu Glu Thr Val

450 455 460

Val Asn Lys Arg Asp Glu Glu Gln His Leu Glu Ser His Thr Asp Cys

465 470 475 480

Ile Leu Ala Val Lys Gln Ala Ile Ser Gly Thr Ser Pro Val Ala Ser

485 490 495

Ser Phe Gln Gly Ile Lys Lys Ser Ile Phe Arg Ile Arg Glu Ser Pro

500 505 510

Lys Glu Thr Phe Asn Ala Ser Phe Ser Gly His Met Thr Asp Pro Asn

515 520 525

Phe Lys Lys Glu Thr Glu Ala Ser Glu Ser Gly Leu Glu Ile His Thr

530 535 540

Val Cys Ser Gln Lys Glu Asp Ser Leu Cys Pro Asn Leu Ile Asp Asn

545 550 555 560

Gly Ser Trp Pro Ala Thr Thr Thr Gln Asn Ser Val Ala Leu Lys Asn

565 570 575

Ala Gly Leu Ile Ser Thr Leu Lys Lys Lys Thr Asn Lys Phe Ile Tyr

580 585 590

Ala Ile His Asp Glu Thr Ser Tyr Lys Gly Lys Lys Ile Pro Lys Asp

595 600 605

Gln Lys Ser Glu Leu Ile Asn Cys Ser Ala Gln Phe Glu Ala Asn Ala

610 615 620

Phe Glu Ala Pro Leu Thr Phe Ala Asn Ala Asp Ser Gly Leu Leu His

625 630 635 640

Ser Ser Val Lys Arg Ser Cys Ser Gln Asn Asp Ser Glu Glu Pro Thr

645 650 655

Leu Ser Leu Thr Ser Ser Phe Gly Thr Ile Leu Arg Lys Cys Ser Arg

660 665 670

Asn Glu Thr Cys Ser Asn Asn Thr Val Ile Ser Gln Asp Leu Asp Tyr

675 680 685

Lys Glu Ala Lys Cys Asn Lys Glu Lys Leu Gln Leu Phe Ile Thr Pro

690 695 700

Glu Ala Asp Ser Leu Ser Cys Leu Gln Glu Gly Gln Cys Glu Asn Asp

705 710 715 720

Pro Lys Ser Lys Lys Val Ser Asp Ile Lys Glu Glu Val Leu Ala Ala

725 730 735

Ala Cys His Pro Val Gln His Ser Lys Val Glu Tyr Ser Asp Thr Asp

740 745 750

Phe Gln Ser Gln Lys Ser Leu Leu Tyr Asp His Glu Asn Ala Ser Thr

755 760 765

Leu Ile Leu Thr Pro Thr Ser Lys Asp Val Leu Ser Asn Leu Val Met

770 775 780

Ile Ser Arg Gly Lys Glu Ser Tyr Lys Met Ser Asp Lys Leu Lys Gly

785 790 795 800

Asn Asn Tyr Glu Ser Asp Val Glu Leu Thr Lys Asn Ile Pro Met Glu

805 810 815

Lys Asn Gln Asp Val Cys Ala Leu Asn Glu Asn Tyr Lys Asn Val Glu

820 825 830

Leu Leu Pro Pro Glu Lys Tyr Met Arg Val Ala Ser Pro Ser Arg Lys

835 840 845

Val Gln Phe Asn Gln Asn Thr Asn Leu Arg Val Ile Gln Lys Asn Gln

850 855 860

Glu Glu Thr Thr Ser Ile Ser Lys Ile Thr Val Asn Pro Asp Ser Glu

865 870 875 880

Glu Leu Phe Ser Asp Asn Glu Asn Asn Phe Val Phe Gln Val Ala Asn

885 890 895

Glu Arg Asn Asn Leu Ala Leu Gly Asn Thr Lys Glu Leu His Glu Thr

900 905 910

Asp Leu Thr Cys Val Asn Glu Pro Ile Phe Lys Asn Ser Thr Met Val

915 920 925

Leu Tyr Gly Asp Thr Gly Asp Lys Gln Ala Thr Gln Val Ser Ile Lys

930 935 940

Lys Asp Leu Val Tyr Val Leu Ala Glu Glu Asn Lys Asn Ser Val Lys

945 950 955 960

Gln His Ile Lys Met Thr Leu Gly Gln Asp Leu Lys Ser Asp Ile Ser

965 970 975

Leu Asn Ile Asp Lys Ile Pro Glu Lys Asn Asn Asp Tyr Met Asn Lys

980 985 990

Trp Ala Gly Leu Leu Gly Pro Ile Ser Asn His Ser Phe Gly Gly Ser

995 1000 1005

Phe Arg Thr Ala Ser Asn Lys Glu Ile Lys Leu Ser Glu His Asn Ile

1010 1015 1020

Lys Lys Ser Lys Met Phe Phe Lys Asp Ile Glu Glu Gln Tyr Pro Thr

1025 1030 1035 1040

Ser Leu Ala Cys Val Glu Ile Val Asn Thr Leu Ala Leu Asp Asn Gln

1045 1050 1055

Lys Lys Leu Ser Lys Pro Gln Ser Ile Asn Thr Val Ser Ala His Leu

1060 1065 1070

Gln Ser Ser Val Val Val Ser Asp Cys Lys Asn Ser His Ile Thr Pro

1075 1080 1085

Gln Met Leu Phe Ser Lys Gln Asp Phe Asn Ser Asn His Asn Leu Thr

1090 1095 1100

Pro Ser Gln Lys Ala Glu Ile Thr Glu Leu Ser Thr Ile Leu Glu Glu

1105 1110 1115 1120

Ser Gly Ser Gln Phe Glu Phe Thr Gln Phe Arg Lys Pro Ser Tyr Ile

1125 1130 1135

Leu Gln Lys Ser Thr Phe Glu Val Pro Glu Asn Gln Met Thr Ile Leu

1140 1145 1150

Lys Thr Thr Ser Glu Glu Cys Arg Asp Ala Asp Leu His Val Ile Met

1155 1160 1165

Asn Ala Pro Ser Ile Gly Gln Val Asp Ser Ser Lys Gln Phe Glu Gly

1170 1175 1180

Thr Val Glu Ile Lys Arg Lys Phe Ala Gly Leu Leu Lys Asn Asp Cys

1185 1190 1195 1200

Asn Lys Ser Ala Ser Gly Tyr Leu Thr Asp Glu Asn Glu Val Gly Phe

1205 1210 1215

Arg Gly Phe Tyr Ser Ala His Gly Thr Lys Leu Asn Val Ser Thr Glu

1220 1225 1230

Ala Leu Gln Lys Ala Val Lys Leu Phe Ser Asp Ile Glu Asn Ile Ser

1235 1240 1245

Glu Glu Thr Ser Ala Glu Val His Pro Ile Ser Leu Ser Ser Ser Lys

1250 1255 1260

Cys His Asp Ser Val Val Ser Met Phe Lys Ile Glu Asn His Asn Asp

1265 1270 1275 1280

Lys Thr Val Ser Glu Lys Asn Asn Lys Cys Gln Leu Ile Leu Gln Asn

1285 1290 1295

Asn Ile Glu Met Thr Thr Gly Thr Phe Val Glu Glu Ile Thr Glu Asn

1300 1305 1310

Tyr Lys Arg Asn Thr Glu Asn Glu Asp Asn Lys Tyr Thr Ala Ala Ser

1315 1320 1325

Arg Asn Ser His Asn Leu Glu Phe Asp Gly Ser Asp Ser Ser Lys Asn

1330 1335 1340

Asp Thr Val Cys Ile His Lys Asp Glu Thr Asp Leu Leu Phe Thr Asp

1345 1350 1355 1360

Gln His Asn Ile Cys Leu Lys Leu Ser Gly Gln Phe Met Lys Glu Gly

1365 1370 1375

Asn Thr Gln Ile Lys Glu Asp Leu Ser Asp Leu Thr Phe Leu Glu Val

1380 1385 1390

Ala Lys Ala Gln Glu Ala Cys His Gly Asn Thr Ser Asn Lys Glu Gln

1395 1400 1405

Leu Thr Ala Thr Lys Thr Glu Gln Asn Ile Lys Asp Phe Glu Thr Ser

1410 1415 1420

Asp Thr Phe Phe Gln Thr Ala Ser Gly Lys Asn Ile Ser Val Ala Lys

1425 1430 1435 1440

Glu Ser Phe Asn Lys Ile Val Asn Phe Phe Asp Gln Lys Pro Glu Glu

1445 1450 1455

Leu His Asn Phe Ser Leu Asn Ser Glu Leu His Ser Asp Ile Arg Lys

1460 1465 1470

Asn Lys Met Asp Ile Leu Ser Tyr Glu Glu Thr Asp Ile Val Lys His

1475 1480 1485

Lys Ile Leu Lys Glu Ser Val Pro Val Gly Thr Gly Asn Gln Leu Val

1490 1495 1500

Thr Phe Gln Gly Gln Pro Glu Arg Asp Glu Lys Ile Lys Glu Pro Thr

1505 1510 1515 1520

Leu Leu Gly Phe His Thr Ala Ser Gly Lys Lys Val Lys Ile Ala Lys

1525 1530 1535

Glu Ser Leu Asp Lys Val Lys Asn Leu Phe Asp Glu Lys Glu Gln Gly

1540 1545 1550

Thr Ser Glu Ile Thr Ser Phe Ser His Gln Trp Ala Lys Thr Leu Lys

1555 1560 1565

Tyr Arg Glu Ala Cys Lys Asp Leu Glu Leu Ala Cys Glu Thr Ile Glu

1570 1575 1580

Ile Thr Ala Ala Pro Lys Cys Lys Glu Met Gln Asn Ser Leu Asn Asn

1585 1590 1595 1600

Asp Lys Asn Leu Val Ser Ile Glu Thr Val Val Pro Pro Lys Leu Leu

1605 1610 1615

Ser Asp Asn Leu Cys Arg Gln Thr Glu Asn Leu Lys Thr Ser Lys Ser

1620 1625 1630

Ile Phe Leu Lys Val Lys Val His Glu Asn Val Glu Lys Glu Thr Ala

1635 1640 1645

Lys Ser Pro Ala Thr Cys Tyr Thr Asn Gln Ser Pro Tyr Ser Val Ile

1650 1655 1660

Glu Asn Ser Ala Leu Ala Phe Tyr Thr Ser Cys Ser Arg Lys Thr Ser

1665 1670 1675 1680

Val Ser Gln Thr Ser Leu Leu Glu Ala Lys Lys Trp Leu Arg Glu Gly

1685 1690 1695

Ile Phe Asp Gly Gln Pro Glu Arg Ile Asn Thr Ala Asp Tyr Val Gly

1700 1705 1710

Asn Tyr Leu Tyr Glu Asn Asn Ser Asn Ser Thr Ile Ala Glu Asn Asp

1715 1720 1725

Lys Asn His Leu Ser Glu Lys Gln Asp Thr Tyr Leu Ser Asn Ser Ser

1730 1735 1740

Met Ser Asn Ser Tyr Ser Tyr His Ser Asp Glu Val Tyr Asn Asp Ser

1745 1750 1755 1760

Gly Tyr Leu Ser Lys Asn Lys Leu Asp Ser Gly Ile Glu Pro Val Leu

1765 1770 1775

Lys Asn Val Glu Asp Gln Lys Asn Thr Ser Phe Ser Lys Val Ile Ser

1780 1785 1790

Asn Val Lys Asp Ala Asn Ala Tyr Pro Gln Thr Val Asn Glu Asp Ile

1795 1800 1805

Cys Val Glu Glu Leu Val Thr Ser Ser Ser Pro Cys Lys Asn Lys Asn

1810 1815 1820

Ala Ala Ile Lys Leu Ser Ile Ser Asn Ser Asn Asn Phe Glu Val Gly

1825 1830 1835 1840

Pro Pro Ala Phe Arg Ile Ala Ser Gly Lys Ile Val Cys Val Ser His

1845 1850 1855

Glu Thr Ile Lys Lys Val Lys Asp Ile Phe Thr Asp Ser Phe Ser Lys

1860 1865 1870

Val Ile Lys Glu Asn Asn Glu Asn Lys Ser Lys Ile Cys Gln Thr Lys

1875 1880 1885

Ile Met Ala Gly Cys Tyr Glu Ala Leu Asp Asp Ser Glu Asp Ile Leu

1890 1895 1900

His Asn Ser Leu Asp Asn Asp Glu Cys Ser Thr His Ser His Lys Val

1905 1910 1915 1920

Phe Ala Asp Ile Gln Ser Glu Glu Ile Leu Gln His Asn Gln Asn Met

1925 1930 1935

Ser Gly Leu Glu Lys Val Ser Lys Ile Ser Pro Cys Asp Val Ser Leu

1940 1945 1950

Glu Thr Ser Asp Ile Cys Lys Cys Ser Ile Gly Lys Leu His Lys Ser

1955 1960 1965

Val Ser Ser Ala Asn Thr Cys Gly Ile Phe Ser Thr Ala Ser Gly Lys

1970 1975 1980

Ser Val Gln Val Ser Asp Ala Ser Leu Gln Asn Ala Arg Gln Val Phe

1985 1990 1995 2000

Ser Glu Ile Glu Asp Ser Thr Lys Gln Val Phe Ser Lys Val Leu Phe

2005 2010 2015

Lys Ser Asn Glu His Ser Asp Gln Leu Thr Arg Glu Glu Asn Thr Ala

2020 2025 2030

Ile Arg Thr Pro Glu His Leu Ile Ser Gln Lys Gly Phe Ser Tyr Asn

2035 2040 2045

Val Val Asn Ser Ser Ala Phe Ser Gly Phe Ser Thr Ala Ser Gly Lys

2050 2055 2060

Gln Val Ser Ile Leu Glu Ser Ser Leu His Lys Val Lys Gly Val Leu

2065 2070 2075 2080

Glu Glu Phe Asp Leu Ile Arg Thr Glu His Ser Leu His Tyr Ser Pro

2085 2090 2095

Thr Ser Arg Gln Asn Val Ser Lys Ile Leu Pro Arg Val Asp Lys Arg

2100 2105 2110

Asn Pro Glu His Cys Val Asn Ser Glu Met Glu Lys Thr Cys Ser Lys

2115 2120 2125

Glu Phe Lys Leu Ser Asn Asn Leu Asn Val Glu Gly Gly Ser Ser Glu

2130 2135 2140

Asn Asn His Ser Ile Lys Val Ser Pro Tyr Leu Ser Gln Phe Gln Gln

2145 2150 2155 2160

Asp Lys Gln Gln Leu Val Leu Gly Thr Lys Val Ser Leu Val Glu Asn

2165 2170 2175

Ile His Val Leu Gly Lys Glu Gln Ala Ser Pro Lys Asn Val Lys Met

2180 2185 2190

Glu Ile Gly Lys Thr Glu Thr Phe Ser Asp Val Pro Val Lys Thr Asn

2195 2200 2205

Ile Glu Val Cys Ser Thr Tyr Ser Lys Asp Ser Glu Asn Tyr Phe Glu

2210 2215 2220

Thr Glu Ala Val Glu Ile Ala Lys Ala Phe Met Glu Asp Asp Glu Leu

2225 2230 2235 2240

Thr Asp Ser Lys Leu Pro Ser His Ala Thr His Ser Leu Phe Thr Cys

2245 2250 2255

Pro Glu Asn Glu Glu Met Val Leu Ser Asn Ser Arg Ile Gly Lys Arg

2260 2265 2270

Arg Gly Glu Pro Leu Ile Leu Val Gly Glu Pro Ser Ile Lys Arg Asn

2275 2280 2285

Leu Leu Asn Glu Phe Asp Arg Ile Ile Glu Asn Gln Glu Lys Ser Leu

2290 2295 2300

Lys Ala Ser Lys Ser Thr Pro Asp

2305 2310

<210> 6

<211> 2312

<212> PRT

<213> Homo sapiens

<400> 6

Met Pro Ile Gly Ser Lys Glu Arg Pro Thr Phe Phe Glu Ile Phe Lys

1 5 10 15

Thr Arg Cys Asn Lys Ala Asp Leu Gly Pro Ile Ser Leu Asn Trp Phe

20 25 30

Glu Glu Leu Ser Ser Glu Ala Pro Pro Tyr Asn Ser Glu Pro Ala Glu

35 40 45

Glu Ser Glu His Lys Asn Asn Asn Tyr Glu Pro Asn Leu Phe Lys Thr

50 55 60

Pro Gln Arg Lys Pro Ser Tyr Asn Gln Leu Ala Ser Thr Pro Ile Ile

65 70 75 80

Phe Lys Glu Gln Gly Leu Thr Leu Pro Leu Tyr Gln Ser Pro Val Lys

85 90 95

Glu Leu Asp Lys Phe Lys Leu Asp Leu Gly Arg Asn Val Pro Asn Ser

100 105 110

Arg His Lys Ser Leu Arg Thr Val Lys Thr Lys Met Asp Gln Ala Asp

115 120 125

Asp Val Ser Cys Pro Leu Leu Asn Ser Cys Leu Ser Glu Ser Pro Val

130 135 140

Val Leu Gln Cys Thr His Val Thr Pro Gln Arg Asp Lys Ser Val Val

145 150 155 160

Cys Gly Ser Leu Phe His Thr Pro Lys Phe Val Lys Gly Arg Gln Thr

165 170 175

Pro Lys His Ile Ser Glu Ser Leu Gly Ala Glu Val Asp Pro Asp Met

180 185 190

Ser Trp Ser Ser Ser Leu Ala Thr Pro Pro Thr Leu Ser Ser Thr Val

195 200 205

Leu Ile Val Arg Asn Glu Glu Ala Ser Glu Thr Val Phe Pro His Asp

210 215 220

Thr Thr Ala Asn Val Lys Ser Tyr Phe Ser Asn His Asp Glu Ser Leu

225 230 235 240

Lys Lys Asn Asp Arg Phe Ile Ala Ser Val Thr Asp Ser Glu Asn Thr

245 250 255

Asn Gln Arg Glu Ala Ala Ser His Gly Phe Gly Lys Thr Ser Gly Asn

260 265 270

Ser Phe Lys Val Asn Ser Cys Lys Asp His Ile Gly Lys Ser Met Pro

275 280 285

Asn Val Leu Glu Asp Glu Val Tyr Glu Thr Val Val Asp Thr Ser Glu

290 295 300

Glu Asp Ser Phe Ser Leu Cys Phe Ser Lys Cys Arg Thr Lys Asn Leu

305 310 315 320

Gln Lys Val Arg Thr Ser Lys Thr Arg Lys Lys Ile Phe His Glu Ala

325 330 335

Asn Ala Asp Glu Cys Glu Lys Ser Lys Asn Gln Val Lys Glu Lys Tyr

340 345 350

Ser Phe Val Ser Glu Val Glu Pro Asn Asp Thr Asp Pro Leu Asp Ser

355 360 365

Asn Val Ala Asn Gln Lys Pro Phe Glu Ser Gly Ser Asp Lys Ile Ser

370 375 380

Lys Glu Val Val Pro Ser Leu Ala Cys Glu Trp Ser Gln Leu Thr Leu

385 390 395 400

Ser Gly Leu Asn Gly Ala Gln Met Glu Lys Ile Pro Leu Leu His Ile

405 410 415

Ser Ser Cys Asp Gln Asn Ile Ser Glu Lys Asp Leu Leu Asp Thr Glu

420 425 430

Asn Lys Arg Lys Lys Asp Phe Leu Thr Ser Glu Asn Ser Leu Pro Arg

435 440 445

Ile Ser Ser Leu Pro Lys Ser Glu Lys Pro Leu Asn Glu Glu Thr Val

450 455 460

Val Asn Lys Arg Asp Glu Glu Gln His Leu Glu Ser His Thr Asp Cys

465 470 475 480

Ile Leu Ala Val Lys Gln Ala Ile Ser Gly Thr Ser Pro Val Ala Ser

485 490 495

Ser Phe Gln Gly Ile Lys Lys Ser Ile Phe Arg Ile Arg Glu Ser Pro

500 505 510

Lys Glu Thr Phe Asn Ala Ser Phe Ser Gly His Met Thr Asp Pro Asn

515 520 525

Phe Lys Lys Glu Thr Glu Ala Ser Glu Ser Gly Leu Glu Ile His Thr

530 535 540

Val Cys Ser Gln Lys Glu Asp Ser Leu Cys Pro Asn Leu Ile Asp Asn

545 550 555 560

Gly Ser Trp Pro Ala Thr Thr Thr Gln Asn Ser Val Ala Leu Lys Asn

565 570 575

Ala Gly Leu Ile Ser Thr Leu Lys Lys Lys Thr Asn Lys Phe Ile Tyr

580 585 590

Ala Ile His Asp Glu Thr Ser Tyr Lys Gly Lys Lys Ile Pro Lys Asp

595 600 605

Gln Lys Ser Glu Leu Ile Asn Cys Ser Ala Gln Phe Glu Ala Asn Ala

610 615 620

Phe Glu Ala Pro Leu Thr Phe Ala Asn Ala Asp Ser Gly Leu Leu His

625 630 635 640

Ser Ser Val Lys Arg Ser Cys Ser Gln Asn Asp Ser Glu Glu Pro Thr

645 650 655

Leu Ser Leu Thr Ser Ser Phe Gly Thr Ile Leu Arg Lys Cys Ser Arg

660 665 670

Asn Glu Thr Cys Ser Asn Asn Thr Val Ile Ser Gln Asp Leu Asp Tyr

675 680 685

Lys Glu Ala Lys Cys Asn Lys Glu Lys Leu Gln Leu Phe Ile Thr Pro

690 695 700

Glu Ala Asp Ser Leu Ser Cys Leu Gln Glu Gly Gln Cys Glu Asn Asp

705 710 715 720

Pro Lys Ser Lys Lys Val Ser Asp Ile Lys Glu Glu Val Leu Ala Ala

725 730 735

Ala Cys His Pro Val Gln His Ser Lys Val Glu Tyr Ser Asp Thr Asp

740 745 750

Phe Gln Ser Gln Lys Ser Leu Leu Tyr Asp His Glu Asn Ala Ser Thr

755 760 765

Leu Ile Leu Thr Pro Thr Ser Lys Asp Val Leu Ser Asn Leu Val Met

770 775 780

Ile Ser Arg Gly Lys Glu Ser Tyr Lys Met Ser Asp Lys Leu Lys Gly

785 790 795 800

Asn Asn Tyr Glu Ser Asp Val Glu Leu Thr Lys Asn Ile Pro Met Glu

805 810 815

Lys Asn Gln Asp Val Cys Ala Leu Asn Glu Asn Tyr Lys Asn Val Glu

820 825 830

Leu Leu Pro Pro Glu Lys Tyr Met Arg Val Ala Ser Pro Ser Arg Lys

835 840 845

Val Gln Phe Asn Gln Asn Thr Asn Leu Arg Val Ile Gln Lys Asn Gln

850 855 860

Glu Glu Thr Thr Ser Ile Ser Lys Ile Thr Val Asn Pro Asp Ser Glu

865 870 875 880

Glu Leu Phe Ser Asp Asn Glu Asn Asn Phe Val Phe Gln Val Ala Asn

885 890 895

Glu Arg Asn Asn Leu Ala Leu Gly Asn Thr Lys Glu Leu His Glu Thr

900 905 910

Asp Leu Thr Cys Val Asn Glu Pro Ile Phe Lys Asn Ser Thr Met Val

915 920 925

Leu Tyr Gly Asp Thr Gly Asp Lys Gln Ala Thr Gln Val Ser Ile Lys

930 935 940

Lys Asp Leu Val Tyr Val Leu Ala Glu Glu Asn Lys Asn Ser Val Lys

945 950 955 960

Gln His Ile Lys Met Thr Leu Gly Gln Asp Leu Lys Ser Asp Ile Ser

965 970 975

Leu Asn Ile Asp Lys Ile Pro Glu Lys Asn Asn Asp Tyr Met Asn Lys

980 985 990

Trp Ala Gly Leu Leu Gly Pro Ile Ser Asn His Ser Phe Gly Gly Ser

995 1000 1005

Phe Arg Thr Ala Ser Asn Lys Glu Ile Lys Leu Ser Glu His Asn Ile

1010 1015 1020

Lys Lys Ser Lys Met Phe Phe Lys Asp Ile Glu Glu Gln Tyr Pro Thr

1025 1030 1035 1040

Ser Leu Ala Cys Val Glu Ile Val Asn Thr Leu Ala Leu Asp Asn Gln

1045 1050 1055

Lys Lys Leu Ser Lys Pro Gln Ser Ile Asn Thr Val Ser Ala His Leu

1060 1065 1070

Gln Ser Ser Val Val Val Ser Asp Cys Lys Asn Ser His Ile Thr Pro

1075 1080 1085

Gln Met Leu Phe Ser Lys Gln Asp Phe Asn Ser Asn His Asn Leu Thr

1090 1095 1100

Pro Ser Gln Lys Ala Glu Ile Thr Glu Leu Ser Thr Ile Leu Glu Glu

1105 1110 1115 1120

Ser Gly Ser Gln Phe Glu Phe Thr Gln Phe Arg Lys Pro Ser Tyr Ile

1125 1130 1135

Leu Gln Lys Ser Thr Phe Glu Val Pro Glu Asn Gln Met Thr Ile Leu

1140 1145 1150

Lys Thr Thr Ser Glu Glu Cys Arg Asp Ala Asp Leu His Val Ile Met

1155 1160 1165

Asn Ala Pro Ser Ile Gly Gln Val Asp Ser Ser Lys Gln Phe Glu Gly

1170 1175 1180

Thr Val Glu Ile Lys Arg Lys Phe Ala Gly Leu Leu Lys Asn Asp Cys

1185 1190 1195 1200

Asn Lys Ser Ala Ser Gly Tyr Leu Thr Asp Glu Asn Glu Val Gly Phe

1205 1210 1215

Arg Gly Phe Tyr Ser Ala His Gly Thr Lys Leu Asn Val Ser Thr Glu

1220 1225 1230

Ala Leu Gln Lys Ala Val Lys Leu Phe Ser Asp Ile Glu Asn Ile Ser

1235 1240 1245

Glu Glu Thr Ser Ala Glu Val His Pro Ile Ser Leu Ser Ser Ser Lys

1250 1255 1260

Cys His Asp Ser Val Val Ser Met Phe Lys Ile Glu Asn His Asn Asp

1265 1270 1275 1280

Lys Thr Val Ser Glu Lys Asn Asn Lys Cys Gln Leu Ile Leu Gln Asn

1285 1290 1295

Asn Ile Glu Met Thr Thr Gly Thr Phe Val Glu Glu Ile Thr Glu Asn

1300 1305 1310

Tyr Lys Arg Asn Thr Glu Asn Glu Asp Asn Lys Tyr Thr Ala Ala Ser

1315 1320 1325

Arg Asn Ser His Asn Leu Glu Phe Asp Gly Ser Asp Ser Ser Lys Asn

1330 1335 1340

Asp Thr Val Cys Ile His Lys Asp Glu Thr Asp Leu Leu Phe Thr Asp

1345 1350 1355 1360

Gln His Asn Ile Cys Leu Lys Leu Ser Gly Gln Phe Met Lys Glu Gly

1365 1370 1375

Asn Thr Gln Ile Lys Glu Asp Leu Ser Asp Leu Thr Phe Leu Glu Val

1380 1385 1390

Ala Lys Ala Gln Glu Ala Cys His Gly Asn Thr Ser Asn Lys Glu Gln

1395 1400 1405

Leu Thr Ala Thr Lys Thr Glu Gln Asn Ile Lys Asp Phe Glu Thr Ser

1410 1415 1420

Asp Thr Phe Phe Gln Thr Ala Ser Gly Lys Asn Ile Ser Val Ala Lys

1425 1430 1435 1440

Glu Ser Phe Asn Lys Ile Val Asn Phe Phe Asp Gln Lys Pro Glu Glu

1445 1450 1455

Leu His Asn Phe Ser Leu Asn Ser Glu Leu His Ser Asp Ile Arg Lys

1460 1465 1470

Asn Lys Met Asp Ile Leu Ser Tyr Glu Glu Thr Asp Ile Val Lys His

1475 1480 1485

Lys Ile Leu Lys Glu Ser Val Pro Val Gly Thr Gly Asn Gln Leu Val

1490 1495 1500

Thr Phe Gln Gly Gln Pro Glu Arg Asp Glu Lys Ile Lys Glu Pro Thr

1505 1510 1515 1520

Leu Leu Gly Phe His Thr Ala Ser Gly Lys Lys Val Lys Ile Ala Lys

1525 1530 1535

Glu Ser Leu Asp Lys Val Lys Asn Leu Phe Asp Glu Lys Glu Gln Gly

1540 1545 1550

Thr Ser Glu Ile Thr Ser Phe Ser His Gln Trp Ala Lys Thr Leu Lys

1555 1560 1565

Tyr Arg Glu Ala Cys Lys Asp Leu Glu Leu Ala Cys Glu Thr Ile Glu

1570 1575 1580

Ile Thr Ala Ala Pro Lys Cys Lys Glu Met Gln Asn Ser Leu Asn Asn

1585 1590 1595 1600

Asp Lys Asn Leu Val Ser Ile Glu Thr Val Val Pro Pro Lys Leu Leu

1605 1610 1615

Ser Asp Asn Leu Cys Arg Gln Thr Glu Asn Leu Lys Thr Ser Lys Ser

1620 1625 1630

Ile Phe Leu Lys Val Lys Val His Glu Asn Val Glu Lys Glu Thr Ala

1635 1640 1645

Lys Ser Pro Ala Thr Cys Tyr Thr Asn Gln Ser Pro Tyr Ser Val Ile

1650 1655 1660

Glu Asn Ser Ala Leu Ala Phe Tyr Thr Ser Cys Ser Arg Lys Thr Ser

1665 1670 1675 1680

Val Ser Gln Thr Ser Leu Leu Glu Ala Lys Lys Trp Leu Arg Glu Gly

1685 1690 1695

Ile Phe Asp Gly Gln Pro Glu Arg Ile Asn Thr Ala Asp Tyr Val Gly

1700 1705 1710

Asn Tyr Leu Tyr Glu Asn Asn Ser Asn Ser Thr Ile Ala Glu Asn Asp

1715 1720 1725

Lys Asn His Leu Ser Glu Lys Gln Asp Thr Tyr Leu Ser Asn Ser Ser

1730 1735 1740

Met Ser Asn Ser Tyr Ser Tyr His Ser Asp Glu Val Tyr Asn Asp Ser

1745 1750 1755 1760

Gly Tyr Leu Ser Lys Asn Lys Leu Asp Ser Gly Ile Glu Pro Val Leu

1765 1770 1775

Lys Asn Val Glu Asp Gln Lys Asn Thr Ser Phe Ser Lys Val Ile Ser

1780 1785 1790

Asn Val Lys Asp Ala Asn Ala Tyr Pro Gln Thr Val Asn Glu Asp Ile

1795 1800 1805

Cys Val Glu Glu Leu Val Thr Ser Ser Ser Pro Cys Lys Asn Lys Asn

1810 1815 1820

Ala Ala Ile Lys Leu Ser Ile Ser Asn Ser Asn Asn Phe Glu Val Gly

1825 1830 1835 1840

Pro Pro Ala Phe Arg Ile Ala Ser Gly Lys Ile Val Cys Val Ser His

1845 1850 1855

Glu Thr Ile Lys Lys Val Lys Asp Ile Phe Thr Asp Ser Phe Ser Lys

1860 1865 1870

Val Ile Lys Glu Asn Asn Glu Asn Lys Ser Lys Ile Cys Gln Thr Lys

1875 1880 1885

Ile Met Ala Gly Cys Tyr Glu Ala Leu Asp Asp Ser Glu Asp Ile Leu

1890 1895 1900

His Asn Ser Leu Asp Asn Asp Glu Cys Ser Thr His Ser His Lys Val

1905 1910 1915 1920

Phe Ala Asp Ile Gln Ser Glu Glu Ile Leu Gln His Asn Gln Asn Met

1925 1930 1935

Ser Gly Leu Glu Lys Val Ser Lys Ile Ser Pro Cys Asp Val Ser Leu

1940 1945 1950

Glu Thr Ser Asp Ile Cys Lys Cys Ser Ile Gly Lys Leu His Lys Ser

1955 1960 1965

Val Ser Ser Ala Asn Thr Cys Gly Ile Phe Ser Thr Ala Ser Gly Lys

1970 1975 1980

Ser Val Gln Val Ser Asp Ala Ser Leu Gln Asn Ala Arg Gln Val Phe

1985 1990 1995 2000

Ser Glu Ile Glu Asp Ser Thr Lys Gln Val Phe Ser Lys Val Leu Phe

2005 2010 2015

Lys Ser Asn Glu His Ser Asp Gln Leu Thr Arg Glu Glu Asn Thr Ala

2020 2025 2030

Ile Arg Thr Pro Glu His Leu Ile Ser Gln Lys Gly Phe Ser Tyr Asn

2035 2040 2045

Val Val Asn Ser Ser Ala Phe Ser Gly Phe Ser Thr Ala Ser Gly Lys

2050 2055 2060

Gln Val Ser Ile Leu Glu Ser Ser Leu His Lys Val Lys Gly Val Leu

2065 2070 2075 2080

Glu Glu Phe Asp Leu Ile Arg Thr Glu His Ser Leu His Tyr Ser Pro

2085 2090 2095

Thr Ser Arg Gln Asn Val Ser Lys Ile Leu Pro Arg Val Asp Lys Arg

2100 2105 2110

Asn Pro Glu His Cys Val Asn Ser Glu Met Glu Lys Thr Cys Ser Lys

2115 2120 2125

Glu Phe Lys Leu Ser Asn Asn Leu Asn Val Glu Gly Gly Ser Ser Glu

2130 2135 2140

Asn Asn His Ser Ile Lys Val Ser Pro Tyr Leu Ser Gln Phe Gln Gln

2145 2150 2155 2160

Asp Lys Gln Gln Leu Val Leu Gly Thr Lys Val Ser Leu Val Glu Asn

2165 2170 2175

Ile His Val Leu Gly Lys Glu Gln Ala Ser Pro Lys Asn Val Lys Met

2180 2185 2190

Glu Ile Gly Lys Thr Glu Thr Phe Ser Asp Val Pro Val Lys Thr Asn

2195 2200 2205

Ile Glu Val Cys Ser Thr Tyr Ser Lys Asp Ser Glu Asn Tyr Phe Glu

2210 2215 2220

Thr Glu Ala Val Glu Ile Ala Lys Ala Phe Met Glu Asp Asp Glu Leu

2225 2230 2235 2240

Thr Asp Ser Lys Leu Pro Ser His Ala Thr His Ser Leu Phe Thr Cys

2245 2250 2255

Pro Glu Asn Glu Glu Met Val Leu Ser Asn Ser Arg Ile Gly Lys Arg

2260 2265 2270

Arg Gly Glu Pro Leu Ile Leu Val Gly Glu Pro Ser Ile Lys Arg Asn

2275 2280 2285

Leu Leu Asn Glu Phe Asp Arg Ile Ile Glu Asn Gln Glu Lys Ser Leu

2290 2295 2300

Asn Ala Ser Lys Ser Thr Pro Asp

2305 2310

Claims

1. A breast cancer susceptibility gene BRCA2-K2305N mutant, which is characterized in that: the mutant gene has g.32344631G > T site mutation compared with the normal gene sequence of BRCA 2; the BRCA2 gene g.32344631G > T site mutation means that the mutation site is mutated into T at the 277 th base G of the SEQ ID NO. 1 sequence.

2. A specific primer for detecting the breast cancer susceptibility gene BRCA2-K2305N of claim 1, characterized in that: the sequence of the upstream primer of the specific primer is shown as SEQ ID NO. 3, the sequence of the downstream primer is shown as SEQ ID NO. 4, and the specific primer is used for detecting the G.32344631G > T site mutation of BRCA2-K2305N gene.