CN112899388B - InDel marked fingerprint of shiitake mushroom like strain and construction method thereof - Google Patents

Abstract

The invention relates to an InDel marker fingerprint of mushroom like strains and a construction method thereof, wherein the fingerprint consists of 7 InDel markers developed after sequencing based on the whole genome of mushroom. The InDel marked fingerprint of lentinus edodes strains can be used for identifying the specificity of the lentinus edodes strains, has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the lentinus edodes strains in the collected 44 lentinus edodes strains.

Description

InDel marked fingerprint of shiitake mushroom like strain and construction method thereof

Technical Field

The invention belongs to the field of detection of mushroom strains, and particularly relates to an InDel marked fingerprint of mushroom strains and a construction method thereof.

Background

Lentinus edodes (Lentinula edodes (Berk.) Pegler) is popular among consumers because of its high nutritional and medicinal value. China is the earliest country for artificially cultivating the mushrooms in the world, the cultivation history has been over 800 years, and the mushrooms are the most widely cultivated and highest-yield mushroom seeds in China at present. According to statistics of the China edible fungus society, the total yield of Chinese edible fungi in 2018 is 3842.04 ten thousand tons, wherein the total yield of the mushrooms is 1043.12 ten thousand tons, accounts for 27.15 percent of the total yield of domestic edible fungi and accounts for more than 90 percent of the total yield of the mushrooms in the world. The cultivation scale of the mushrooms in China is further enlarged, but with the rapid development of the mushroom industry in China, the problem that the production seeds of the mushrooms are same in species, different in name and same in name is increasingly prominent, so that not only is the intellectual property of mushroom breeders damaged, but also producers are greatly risked, and the hidden danger is caused for the further development of the mushroom industry. In order to guarantee the rights and interests of breeders, reduce the risks of producers and promote the healthy, stable and sustainable development of the shiitake mushroom industry in China, a simple, convenient, rapid and reliable shiitake mushroom strain specificity identification technology is urgently established.

With the rapid development of bioinformatics and the continuous maturation of DNA sequencing technology, the sequencing throughput is increasing and the cost is decreasing. The DNA molecular marker technology can detect the genetic specificity of mushroom strains on the gene level, and the completion of mushroom whole genome sequencing provides convenience for the development of InDel markers. The InDel molecular marker is an application based on a high-throughput sequencing technology, reduces the cost of InDel marker development, and is suitable for developing lentinus edodes whole genome sequencing molecular markers. And the InDel marker has the advantages of abundant quantity, high accuracy, good stability, rapidness, convenience and the like, and can be used for molecular marker assisted breeding and mushroom strain identification.

Disclosure of Invention

The invention aims to solve the technical problem of providing an InDel marked fingerprint of shiitake mushrooms such as strains and a construction method and application thereof.

The fingerprint of the InDel marker of lentinus edodes like strains consists of 7 pairs of InDel markers, is an InDel marker primer developed based on lentinus edodes genome insertion/deletion fragments, and has the advantages of good amplification band type, high repeatability and detailed marking information shown in Table 1.

TABLE 1InDel tagged primer information List

The invention also provides an application of the InDel marked fingerprint of the mushroom such as strains, which is to utilize 7 pairs of InDel marked primers developed by the insertion/deletion segments of the mushroom genome to carry out InDel marked amplification on the mushroom strains, compare the obtained banding pattern with the banding pattern of the mushroom such as strains, and obtain the mushroom such as strains if the banding pattern is consistent with the banding pattern;

wherein the combination of the lentinus edodes such as the band type number of the strain comprises: (1+2) 211 (1+2) 1 (1+2).

Through the banding amplification of the collected InDel marked primers of 44 mushroom varieties, the invention determines the number and the numbering of the allelic fragments of 7 pairs of InDel marked primers amplified in 44 mushroom varieties (table 2), and the incense strains can be effectively identified through the combination of the numbering of different InDel allelic sites (figures 2-8). The relative molecular weight of the allelic locus amplified by each InDel marker primer can be determined by DNA molecular weight control D2000bp DNA ladder, strains with specific InDel allelic fragment combination such as strains exist, namely lentinus edodes such as strains, and the number combination of the strains is as follows: (1+2) 211 (1+2) 1 (1+2).

TABLE 2 summary of allelic fragment information from InDel primer amplification

The invention also provides a construction method of the InDel marked fingerprint of the mushroom such as a strain, which comprises the following steps:

(1) Hypha culture: transferring the mycelium of Lentinus Edodes into potato glucose culture medium PDA, culturing at 23225 deg.C in dark place, and collecting mycelium after 10 days;

(2) Extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20230ng/uL;

the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:

(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;

(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;

(3) adding 2 × CTAB extractive solution preheated at 65 deg.C for 1 hr, keeping the temperature at 65 deg.C for 60min, and shaking gently once every 20 min;

(4) centrifuging at 12000rpm and 4 deg.C for 20min, subpackaging the supernatant, and subpackaging two tubes each with 800uL;

(5) adding a volume ratio of 25:24:1, gently mixing the mixed solution of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernate and transferring the supernate into a new centrifugal tube;

(6) adding the centrifuge tube into a reactor with the volume ratio of 24:1, gently mixing the mixture of chloroform and isoamylol uniformly for 10min at 10min,12000rpm and 4 ℃, centrifuging for 10min, taking supernatant (recording volume) and transferring the supernatant into another centrifuge tube;

(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube in an amount which is 2/3 of the volume of the supernatant in the step (6), uniformly mixing, standing and precipitating at-20 ℃ for 1h, centrifuging at 8000rpm and 4 ℃ for 10min, and removing the supernatant;

(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5min;

(9) removing ethanol, and drying in an ultra-clean workbench; adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in a water bath at 37 ℃ for 1h, and removing RNA;

storing the obtained DNA extract in refrigerator at-20 deg.C;

detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA; the PCR amplification system is as follows: total volume 20 μ Ι _, comprising: premix Taq ^TM (1.25U/25. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel marker 10. Mu.L total volume of forward primer and reverse primer 1. Mu.L each, 2. Mu.L ddH extracted template DNA with concentration of 20-30 ng/. Mu.L ₂ O 6μL；

And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃,35 cycles; 7min at 72 ℃; storing at 10 deg.C;

and (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;

performing PCR amplification on the mushroom strain by adopting 7 pairs of InDel marker primers, determining the number and relative molecular weight of allelic fragments amplified by each InDel marker primer by using a DNA molecular weight control D2000bp DNA ladder, and finding a combination meeting the number: (1 + 2) 211 (1 + 2) 1 (1 + 2) to determine the strain as shiitake mushroom like strain.

The invention has the advantages of

The InDel marked fingerprint of the lentinus edodes like strains can be used for identifying the lentinus edodes like strains, and has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonism test and fruiting test. The detection time only needs 3-4 days, while the conventional antagonism test needs at least two weeks, and the fruiting test needs at least 3 months; the method has specificity of fragrance like strains in the collected 44 lentinus edodes strains in China, and has good application prospect.

Drawings

FIG. 1 is fingerprint of mushroom such as strain InDel marker, wherein M is D2000bp DNA ladder, numerals 1-7 represent 7 pairs of InDel marker primers used, and arrow indicates the mushroom such as the specific InDel allelic fragment combination of the strain;

FIG. 2 is an amplification map of a primer Lefp _ id001 in 44 selected mushroom materials;

FIG. 3 is an amplification map of primer Lefp _ id002 in 44 selected shiitake mushroom materials;

FIG. 4 is an amplification map of primer Lefp _ id003 in 44 selected mushroom materials;

FIG. 5 is an amplification map of primer Lefp _ id004 in selected 44 shiitake mushroom materials;

FIG. 6 is an amplification map of primer Lefp _ id005 in selected 44 shiitake mushroom materials;

FIG. 7 shows the amplification pattern of primer Lefp _ id006 in 44 selected mushroom materials;

FIG. 8 shows the amplification pattern of the primer Lefp _ id007 in the selected 44 shiitake mushroom materials.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.

Marker、Premix Taq ^TM All purchased from Takala Bio physician technology Co., ltd

The remaining materials and reagents were all common commercial products.

Source of 44 strains:

1. CV108 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 2. xiangjiu strain, from institute for microorganisms of Guangdong province; 3. the L7402 strain is originated from edible and medicinal fungi research institute in Songyang county; 4. 8404 strain from edible fungus of Yichangsen origin, inc., hubei province; 5. huaxiang No. 5 strain, sourced from university of agriculture in Huazhong; 6. CV442 strain, available from institute of domestic fungus, academy of agricultural sciences, shanghai city; 7. guangxi incense strain, sourced from Guangdong institute for microbiology; 8. l135 strain, available from Sanming fungus institute of Fujian province; 9. the L9319 strain is obtained from Dashan mushroom industry research and development Limited company of Lishui city, zhejiang province; 10. minfeng No. 1 strain, san Ming fungus institute of Fujian province; 11. senyuan No. 1 strain, available from edible fungus of Yichangsen source, limited liability company, hubei province; 12. shenxiang No. 18 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 13. incense such as bacterial strain, obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 14. shenxiang No. 15 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 15. CV105 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 16. the L241 strain is obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 17. 26 fragrant impurities, sourced from Guangdong institute for microorganisms; 18. l9608 strain, research center of edible fungi of Xixia county, henan; 19. the Z3244 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 20. the Shenxiang No. 16 strain is originated from edible fungus institute of academy of agricultural sciences of Shanghai city; 21. huaxiang No. 8 strain, sourced from university of agriculture in Huazhong; 22. the N7 strain is sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 23. RBL1 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 24. the strain Z3210 is obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 25. the Shanghai fragrant F2 strain is sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 26. l241-4 strain, sourced from technical research center of edible fungi in Qingyuan county, zhejiang province; 27. l26 strain, available from Sanming fungus institute of Fujian province; 28. the Junxing No. 8 strain is sourced from research and development centers of edible fungi in Lishui city, zhejiang province; 29. CV501 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 30. the source of the suxiang strain is edible fungus institute of academy of agricultural sciences of Shanghai city; 31. l952 strain, sourced from university of agriculture in china; 32. the Z3239 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 33. the Z3243 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 34. HK3161 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 35. the L212 strain is obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 36. l868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 37. the TW1151 strain is from edible fungi institute 38 and L9105 strain of agricultural academy of sciences of Shanghai city, and is from technical research center of edible fungi of Qingyuan county of Zhejiang province; 39. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 40. j868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 41. senyuan No. 10 strain, available from edible fungus of Yichangsen source, limited liability company, hubei province; 42. WD4204 strain, available from institute of edible fungi, academy of agricultural sciences, shanghai city; 43. WD5140 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 44. 931 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city.

Wherein 7 pairs of InDel marked primer sequences (5 '-3') are as follows:

lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA

Reverse primer: TGCCCACTTTACTCTCAACC

Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG

Reverse primer: GGGAGTGGGGTTGTTGGATA

Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG

Reverse primer: CGTACGGTTGGACCATTTGAA

Lefp _ id004 forward primer: AGCCTTTCAAGTCAGCTCG

Reverse primer: GTCAACGGAGGGAAACAGAG

Lefp _ id005 forward primer: GTAGCACTCCTCACAACC

Reverse primer: ACCAAATGTCACACAGCACAGG

Lefp _ id006 forward primer: ACATTGGGCGAAGGCTGTACG

Reverse primer: CCCTTTTGCCTATAAGGCG

Lefp _ id007 forward primer: AACAGTAACCTGTGTGTGCACTGC

Reverse primer: CATGATCAGATCACACAGCG.

The primers were synthesized by Shanghai Bioengineering Co., ltd.

Example 1

(1) Hypha culture: transferring the mycelium of Lentinus Edodes into potato glucose culture medium PDA, culturing at 23225 deg.C in dark place, and collecting mycelium after 10 days;

(2) Extraction of genomic DNA: extracting genome DNA of the hyphae by a CTAB method, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to 20230ng/uL;

the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:

(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;

(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;

(3) adding 2 × CTAB extractive solution preheated at 65 deg.C for 1 hr, maintaining at 65 deg.C for 60min, and shaking gently once every 20 min;

(4) centrifuging at 12000rpm and 4 deg.C for 20min, subpackaging the supernatant, and subpackaging two tubes each with 800uL;

(5) adding the supernatant into a mixture with a volume ratio of 25:24:1, gently mixing the mixed solution of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernate and transferring the supernate into a new centrifugal tube;

(6) adding the centrifuge tube with the volume ratio of 24:1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant (recording volume) and transferring the supernatant into another centrifugal tube;

(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube in an amount which is 2/3 of the volume of the supernatant in the step (6), uniformly mixing, standing and precipitating at-20 ℃ for 1h, centrifuging at 8000rpm and 4 ℃ for 10min, and removing the supernatant;

(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5min;

(9) and (5) discarding the ethanol, and drying in an ultra-clean workbench. Adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;

storing the obtained DNA extract in refrigerator at-20 deg.C for use;

(3) Detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA;

the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq ^TM (1.25U/25. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel labeled forward primer and reverse primer each 1. Mu.L, 2. Mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. Mu.L ₂ O 6μL；

And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃,35 cycles; 7min at 72 ℃; storing at 10 deg.C;

(4) And (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;

the mushroom strains are respectively subjected to PCR amplification by adopting 7 pairs of InDel labeled primers, the number and the relative molecular weight of allelic fragments amplified by each InDel labeled primer can be determined by DNA molecular weight control D2000bp DNA ladder, and as shown in figure 1, the combination meeting the number is found as follows: (1 + 2) 211 (1 + 2) 1 (1 + 2) to determine that the strain is shiitake mushroom like strain, and the number 13 in the figures 2-8 is shiitake mushroom like strain, and the bands are the same as those in figure 1.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> InDel mark fingerprint of shiitake mushroom like bacterial strain and construction method thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acggatggag agacacagga 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgccccactt actctcaacc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cctttctcaa aagcggactg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gggagtgggt tgtttggata 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cggatgttat gcactggaag 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgtacggttg gacatttgaa 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcctttcac agtcagctcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtcaacggag ggaaacagag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtagcactcc tcatacaacc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

accaaatgtc acagcacagg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acattggcga aggctgtacg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cccttttgcc ctataaggcg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aacagtaacc tgtgcactgc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

catgatcaga tcacacagcg 20

Claims (1)

1. A method for identifying mushroom fragrance such as strain is characterized in that InDel labeled primer combination is utilized as follows 7, mushroom strain is amplified, the obtained banding pattern is compared with the banding pattern of the fragrance such as strain, and the mushroom fragrance such as strain is obtained when the banding pattern is consistent with the banding pattern; the combination of the strip type numbers of the mushroom fragrances such as strains is as follows: (1 + 2)/2/1/1/(1 + 2); the number corresponding to primer Lefp _ id001 is the first pair of banding patterns (1 + 2), wherein 1 corresponds to 203bp, and 2 corresponds to 149bp; the number corresponding to the primer Lefp _ id002 is a second pair of band types 2, wherein 2 corresponds to 214bp; the number corresponding to the primer Lefp _ id003 is a third pair of banding patterns 1, wherein 1 corresponds to 265bp; the number corresponding to the primer Lefp _ id004 is a fourth pair of band types 1, wherein 1 corresponds to 270bp; the primer Lefp _ id005 corresponds to a fifth pair of band types (1 + 2), wherein 1 corresponds to 378bp, and 2 corresponds to 346bp; the number corresponding to the primer Lefp _ id006 is a sixth pair of band types 1, wherein 1 corresponds to 277bp; the number corresponding to primer Lefp _ id007 is a seventh pair of banding patterns (1 + 2), wherein 1 corresponds to 284bp, and 2 corresponds to 264bp;

the 7 pairs of InDel labeled primer sequences 5'-3' are as follows:

lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA

Reverse primer: TGCCCCCACTTTACTCTCAACC

Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG

Reverse primer: GGGAGTGGGGTTGTTGGATA

Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG

Reverse primer: CGTACGGTTGGACCATTTGAA

Lefp _ id004 forward primer: AGCCTTTCAAGTCAGCTCG

Reverse primer: GTCAACGGAGGGAAACAGAG

Lefp _ id005 forward primer: GTAGCACTCCTCACAACC

Reverse primer: ACCAAATGTCACACAGCACAGG

Lefp _ id006 forward primer: ACATTGGGCGAAGGCTGTACG

Reverse primer: CCCTTTTGCCTATAAGGCG

Lefp _ id007 forward primer: AACAGTAACCTGTGTGCGCTGC

Reverse primer: CATGATCAGATCACACAGAGCG.

Images