CN112708689B - InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof - Google Patents
InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof Download PDFInfo
- Publication number
- CN112708689B CN112708689B CN202011568598.6A CN202011568598A CN112708689B CN 112708689 B CN112708689 B CN 112708689B CN 202011568598 A CN202011568598 A CN 202011568598A CN 112708689 B CN112708689 B CN 112708689B
- Authority
- CN
- China
- Prior art keywords
- strain
- primer
- lefp
- indel
- mushroom
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an InDel marker fingerprint of a mushroom TW1151 strain and a construction method thereof, wherein the fingerprint consists of 7 InDel markers developed after sequencing based on a mushroom whole genome. The InDel marked fingerprint of the lentinus edodes TW1151 strain can be used for the specificity identification of the lentinus edodes TW1151 strain, has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the lentinus edodes TW1151 strain in 44 collected lentinus edodes strains.
Description
Technical Field
The invention belongs to the field of detection of lentinus edodes strains, and particularly relates to an InDel marker fingerprint spectrum of a lentinus edodes TW1151 strain and a construction method thereof.
Background
Lentinus edodes (Lentinula edodes (Berk.) Pegler) is popular among consumers because of its high nutritional and medicinal value. China is the earliest country for artificially cultivating the mushrooms in the world, the cultivation history has been over 800 years, and the mushrooms are the most widely cultivated and highest-yield mushroom seeds in China at present. According to statistics of the China edible fungus society, the total yield of Chinese edible fungi in 2018 is 3842.04 ten thousand tons, wherein the total yield of the mushrooms is 1043.12 ten thousand tons, accounts for 27.15 percent of the total yield of domestic edible fungi and accounts for more than 90 percent of the total yield of the mushrooms in the world. In recent years, the shiitake mushroom industry becomes an important hand grip for domestic accurate poverty relief, shiitake mushrooms are selected as an important industry from national poor counties of more than 50% of China according to statistics, the cultivation scale of the shiitake mushrooms in China is further expanded, but with the rapid development of the shiitake mushroom industry in China, the problem that the shiitake mushroom production is similar and different in name and is also similar is increasingly prominent, so that the intellectual property of shiitake mushroom breeders is damaged, producers are greatly risky, and hidden dangers are caused for the further development of the shiitake mushroom industry. In order to guarantee the rights and interests of breeders, reduce the risks of producers and promote the healthy, stable and sustainable development of the shiitake mushroom industry in China, a simple, convenient, rapid and reliable shiitake mushroom strain specificity identification technology is urgently established.
With the rapid development of bioinformatics and the continuous maturation of DNA sequencing technology, the sequencing throughput is increasing and the cost is decreasing. The DNA molecular marker technology can detect the genetic specificity of the mushroom strains from the gene level, and the completion of the sequencing of the whole genome of the mushroom provides convenience for the development of InDel markers. The InDel molecular marker is an application based on a high-throughput sequencing technology, reduces the cost of InDel marker development, and is suitable for the development of lentinus edodes whole genome sequencing molecular markers. And the InDel marker has the advantages of abundant quantity, high accuracy, good stability, rapidness, convenience and the like, and can be used for molecular marker assisted breeding and mushroom strain identification.
Disclosure of Invention
The invention aims to solve the technical problem of providing an InDel marked fingerprint of a lentinus edodes TW1151 strain as well as a construction method and application thereof.
The fingerprint of the InDel marker of the TW1151 strain of the lentinus edodes is composed of 7 pairs of InDel markers, is an InDel marker primer developed based on lentinus edodes genome insertion/deletion fragments, and has the advantages of good amplification band type, high repeatability and detailed marker information shown in Table 1.
TABLE 1 InDel tagged primer information List
The invention also provides an application of the InDel marked fingerprint of the TW1151 strain of the mushroom, which is to utilize 7 pairs of InDel marked primers developed by the insertion/deletion segments of the mushroom genome to carry out InDel marked amplification on the mushroom strain, compare the obtained banding pattern with the banding pattern of the TW1151 strain, and obtain the TW1151 strain of the mushroom if the banding pattern is consistent with the banding pattern;
the band type number of the strain TW1151 of the lentinus edodes is as follows: 12 (1+2) 1 (1+2) (1+2) (1+2).
Through the banding amplification of the InDel marker primers of the collected 44 mushroom varieties, the invention determines the number and the serial number of allelic fragments amplified by 7 pairs of InDel marker primers in the 44 mushroom varieties (table 2), and the TW1151 strain can be effectively identified through the serial number combination of different InDel allelic sites (figures 2-8). The relative molecular weight of the amplified allelic locus of each InDel marker primer can be determined by DNA molecular weight control D2000bp DNA ladder, a strain with TW1151 strain specific InDel allelic fragment combination exists, namely the strain of the mushroom TW1151, and the numbering combination of the strain is as follows: 12 (1+2) 1 (1+2) (1+2) (1+2).
TABLE 2 summary of allelic fragment information for InDel primer amplification
The invention also provides a construction method of the InDel marked fingerprint of the TW1151 strain of the shiitake mushroom, which comprises the following steps:
(1) Hypha culture: transferring the mushroom hyphae into a potato glucose culture medium PDA, culturing at 23-25 ℃ in the dark, and collecting the hyphae after 10 days;
(2) Extraction of genomic DNA: extracting genome DNA of the hypha by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:
(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
(3) adding 2 × CTAB extractive solution preheated at 65 deg.C for 1 hr, maintaining at 65 deg.C for 60min, and shaking gently once every 20 min;
(4) centrifuging at 12000rpm and 4 deg.C for 20min, packaging supernatant, and packaging into two tubes each at 800uL;
(5) adding the supernatant into a mixture with a volume ratio of 25:24:1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring supernatant into a new centrifuge tube;
(6) adding the centrifuge tube into a reactor with the volume ratio of 24:1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant (recording volume) and transferring the supernatant into another centrifugal tube;
(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube with volume being 2/3 of that of the supernatant in the step (6), uniformly mixing, standing and precipitating for 1h at-20 ℃, centrifuging for 10min at 8000rpm and 4 ℃, and discarding the supernatant;
(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5min;
(9) removing ethanol, and drying in an ultra-clean workbench; adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C;
detection of InDel molecular marker: performing whole genome InDe on the extracted DNAl PCR amplification of the marker; the PCR amplification system is as follows: total volume 20 μ Ι _, comprising: premix Taq TM (1.25U/25. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel labeled forward primer and reverse primer each 1. Mu.L, 2. Mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. Mu.L 2 O 6μL;
And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃,35 cycles; 7min at 72 ℃; storing at 10 deg.C;
electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 XTAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;
performing PCR amplification on the mushroom strain by adopting 7 pairs of InDel labeled primers, determining the number and relative molecular weight of allelic fragments amplified by each InDel labeled primer by using a DNA molecular weight control D2000bp DNA ladder, and finding a combination of matched numbers: 12 (1 + 2) 1 (1 + 2) to determine that the strain is the strain TW1151 of lentinus edodes.
The invention has the advantages of
The InDel marked fingerprint of the TW1151 strain of the lentinus edodes can be used for identifying the TW1151 strain, and has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test. The detection time only needs 3-4 days, while the conventional antagonism test needs at least two weeks, and the fruiting test needs at least 3 months; the method has specificity of TW1151 strains in the collected 44 lentinus edodes strains in China, and has good application prospect.
Drawings
FIG. 1 is the fingerprint of the InDel marker of the TW1151 strain of Lentinus edodes, wherein M is D2000bp DNA ladder, the numbers 1-7 represent the 7 pairs of InDel marker primers used, and the arrow indicates the specific InDel allelic fragment combination of the TW1151 strain of Lentinus edodes;
FIG. 2 is an amplification map of a primer Lefp _ id001 in 44 selected mushroom materials;
FIG. 3 is an amplification map of primer Lefp _ id002 in 44 selected shiitake mushroom materials;
FIG. 4 is an amplification map of primer Lefp _ id003 in 44 selected mushroom materials;
FIG. 5 is an amplification map of a primer Lefp _ id004 in 44 selected mushroom materials;
FIG. 6 is an amplification map of primer Lefp _ id005 in selected 44 shiitake mushroom materials;
FIG. 7 shows the amplification pattern of primer Lefp _ id006 in 44 selected mushroom materials;
FIG. 8 shows the amplification pattern of primer Lefp _ id007 in 44 selected mushroom materials.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.
Marker、Premix Taq TM All purchased from Takala Bio physician technology Co., ltd
The rest materials and reagents are all common commercial products.
44 strains were derived:
1. CV108 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 2. xiangjiu strain, available from institute of microorganisms of Guangdong province; 3. the L7402 strain is originated from edible and medicinal fungi research institute in Songyang county; 4. 8404 strain from edible fungus of Yichangsen origin, inc., hubei province; 5. huaxiang No. 5 strain, sourced from university of agriculture in Huazhong; 6. CV442 strain, available from institute of domestic fungus, academy of agricultural sciences, shanghai city; 7. guangxi incense strain, sourced from Guangdong institute for microbiology; 8. l135 strain, available from Sanming fungus institute of Fujian province; 9. the L9319 strain is from the research and development company Limited of the large mountain mushroom industry of Lishui city, zhejiang province; 10. minfeng No. 1 strain, san Ming fungus institute of Fujian province; 11. senyuan No. 1 strain, available from Limited liability company of edible fungi from Yichangsen sources, hubei province; 12. shenxiang No. 18 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 13. incense such as strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 14. the Shenxiang No. 15 strain is obtained from edible fungus institute of academy of agricultural sciences in Shanghai city; 15. CV105 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 16. the L241 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 17. 26 fragrant impurities, sourced from Guangdong institute for microorganisms; 18. l9608 strain, research center of edible fungi family, xi xia county, he nan; 19. the Z3244 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 20. the Shenxiang No. 16 strain is originated from edible fungus institute of academy of agricultural sciences of Shanghai city; 21. huaxiang No. 8 strain, sourced from university of agriculture in Huazhong; 22. the N7 strain is sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 23. the RBL1 strain is sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 24. the strain Z3210 is obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 25. the Shanghai fragrant F2 strain is obtained from edible fungus institute of academy of agricultural sciences of Shanghai city; 26. l241-4 strain, sourced from technical research center of edible fungi in Qingyuan county, zhejiang province; 27. l26 strain, available from Sanming fungus institute of Fujian province; 28. the Junxing No. 8 strain is sourced from research and development centers of edible fungi in Lishui city, zhejiang province; 29. CV501 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 30. the source of the suxiang strain is edible fungus institute of academy of agricultural sciences of Shanghai city; 31. l952 strain, source university of agriculture in china; 32. the Z3239 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 33. the Z3243 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 34. HK3161 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 35. l212 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 36. l868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 37. the TW1151 strain is from edible fungi institute 38 and L9105 strain of agricultural academy of sciences of Shanghai city, and is from technical research center of edible fungi of Qingyuan county of Zhejiang province; 39. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences, shanghai city; 40. j868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 41. senyuan No. 10 strain, yichangsen source edible fungus, limited liability company, hubei province; 42. WD4204 strain, available from institute of edible fungi, academy of agricultural sciences, shanghai city; 43. WD5140 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 44. 931 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city.
Wherein 7 pairs of InDel labeled primer sequences (5 '-3') are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCCACTTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGGTTGTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACCATTTGAA
Lefp _ id004 forward primer: AGCCTTTCAAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCACAACC
Reverse primer: ACCAAATGTCACACAGCACAGG
Lefp _ id006 forward primer: ACATTGGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGTGCGCTGC
Reverse primer: CATGATCAGATCACACAGAGCG.
The primers were synthesized by Shanghai Bioengineering Co., ltd.
Example 1
(1) Hypha culture: transferring the mushroom hyphae into a potato glucose culture medium PDA, culturing at 23-25 ℃ in the dark, and collecting the hyphae after 10 days;
(2) Extraction of genomic DNA: extracting genome DNA of the hypha by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:
(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
(3) adding 2 × CTAB extractive solution preheated at 65 deg.C for 1 hr, maintaining at 65 deg.C for 60min, and shaking gently once every 20 min;
(4) centrifuging at 12000rpm and 4 deg.C for 20min, subpackaging the supernatant, and subpackaging two tubes each with 800uL;
(5) adding the supernatant into a mixture with a volume ratio of 25:24:1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring supernatant into a new centrifuge tube;
(6) adding the centrifuge tube with the volume ratio of 24:1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant (recording volume) and transferring the supernatant into another centrifugal tube;
(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube in an amount which is 2/3 of the volume of the supernatant in the step (6), uniformly mixing, standing and precipitating at-20 ℃ for 1h, centrifuging at 8000rpm and 4 ℃ for 10min, and removing the supernatant;
(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5min;
(9) and (5) discarding the ethanol, and drying in an ultra-clean workbench. Adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
(3) Detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA;
the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq TM (1.25U/25. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel labeled forward primer and reverse primer each 1. Mu.L, 2. Mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. Mu.L 2 O 6μL;
And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃,35 cycles; 7min at 72 ℃; storing at 10 deg.C;
(4) And (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;
the mushroom strains are respectively subjected to PCR amplification by adopting 7 pairs of InDel labeled primers, the number and the relative molecular weight of allelic fragments amplified by each InDel labeled primer can be determined by DNA molecular weight control D2000bp DNA ladder, and as shown in figure 1, the combination meeting the number is found as follows: 12 (1 + 2) the strain 1 (1 + 2) can determine that the strain is the strain TW1151 of the mushroom, the number 37 in the figure 2-8 is the strain TW1151, and the band is the same as that in the figure 1.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> InDel mark fingerprint spectrum of mushroom TW1151 strain and construction method thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
accaaatgtc acagcacagg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
Claims (1)
1. A method for identifying the TW1151 strain of the mushroom, characterized by that to InDel mark primer combination with the following 7, amplify the mushroom strain, the banding pattern got is compared with the banding pattern of the TW1151 strain, it is the TW1151 strain of the mushroom to accord with the banding pattern; the band type number of the strain TW1151 of the lentinus edodes is as follows: 1/2/(1 + 2)/1/(1 + 2); the number corresponding to the primer Lefp _ id001 is a first pair of band types 1, wherein 1 corresponds to 203bp; the number corresponding to the primer Lefp _ id002 is a second pair of band types 2, wherein 2 corresponds to 214bp; primer Lefp _ id003 corresponds to the number of the third pair of bands (1 + 2), wherein 1 corresponds to 265bp, and 2 corresponds to 248p; the number corresponding to the primer Lefp _ id004 is a fourth pair of band types 1, wherein 1 corresponds to 270bp; the primer Lefp _ id005 corresponds to a fifth pair of band types (1 + 2), wherein 1 corresponds to 378bp, and 2 corresponds to 346bp; the number corresponding to the primer Lefp _ id006 is the sixth pair of band types (1 + 2), wherein 1 corresponds to 277bp, and 2 corresponds to 262bp; the number corresponding to the primer Lefp _ id007 is a seventh pair of band patterns (1 + 2), wherein 1 corresponds to 284bp, and 2 corresponds to 264bp;
the 7 pairs of InDel labeled primer sequences 5'-3' are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCCACTTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGGTTGTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACCATTTGAA
Lefp _ id004 forward primer: AGCCTTTCAAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCACAACC
Reverse primer: ACCAAATGTCACACAGCACAGG
Lefp _ id006 forward primer: ACATTGGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGTGCGCTGC
Reverse primer: CATGATCAGATCACACAGCG.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011568598.6A CN112708689B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011568598.6A CN112708689B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112708689A CN112708689A (en) | 2021-04-27 |
CN112708689B true CN112708689B (en) | 2023-02-03 |
Family
ID=75545484
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011568598.6A Active CN112708689B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112708689B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102936628A (en) * | 2012-11-16 | 2013-02-20 | 上海市农业科学院 | Simple sequence repeat (SSR) marker finger print spectrum of Senyuan No.1 mushroom strain and application |
-
2020
- 2020-12-25 CN CN202011568598.6A patent/CN112708689B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102936628A (en) * | 2012-11-16 | 2013-02-20 | 上海市农业科学院 | Simple sequence repeat (SSR) marker finger print spectrum of Senyuan No.1 mushroom strain and application |
Non-Patent Citations (1)
Title |
---|
"InDel 标记及其在食用菌研究中的应用与展望";沈秀芬等;<上海农业学报>;20200530;第137页第2、6段,第138页第1-2段 * |
Also Published As
Publication number | Publication date |
---|---|
CN112708689A (en) | 2021-04-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112626253B (en) | InDel marked fingerprint spectrum of champignon Guangxi strain and construction method thereof | |
CN112575110B (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 8 strain and construction method thereof | |
CN112593003B (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof | |
CN112593002B (en) | InDel marker fingerprint spectrum of mushroom L135 strain and construction method thereof | |
CN112646916A (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 5 strain and construction method thereof | |
CN112725492A (en) | InDel marker fingerprint spectrum of mushroom CV501 strain and construction method thereof | |
CN112522435A (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 15 strain and construction method thereof | |
CN112538546A (en) | InDel marker fingerprint spectrum of mushroom L952 strain and construction method thereof | |
CN112646915A (en) | InDel marker fingerprint spectrum of shiitake fungus WD4204 strain and construction method thereof | |
CN112695118A (en) | InDel marked fingerprint spectrum of shiitake mushroom Shenxiang No. 18 strain and construction method thereof | |
CN112708689B (en) | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof | |
CN112626254B (en) | InDel marker fingerprint spectrum of shiitake mushroom L9319 strain and construction method thereof | |
CN113215294B (en) | InDel marker fingerprint spectrum of shiitake mushroom L868 strain and construction method thereof | |
CN112626255B (en) | InDel marker fingerprint spectrum of mushroom CV108 strain and construction method thereof | |
CN112626252B (en) | InDel marker fingerprint spectrum of mushroom CV105 strain and construction method thereof | |
CN112575111B (en) | InDel marker fingerprint spectrum of mushroom L26 strain and construction method thereof | |
CN112553366B (en) | InDel marked fingerprint spectrum of Senyuan No. 1 strain of lentinus edodes and construction method thereof | |
CN112899388B (en) | InDel marked fingerprint of shiitake mushroom like strain and construction method thereof | |
CN112593004B (en) | InDel marker fingerprint spectrum of mushroom fragrant hybrid 26 strain and construction method thereof | |
CN112725491B (en) | InDel marker fingerprint spectrum of shiitake mushroom Z3239 strain and construction method thereof | |
CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
CN112522436A (en) | InDel marker fingerprint spectrum of shiitake 8404 strain and construction method thereof | |
CN112760398A (en) | InDel marker fingerprint spectrum of mushroom L241-4 strain and construction method thereof | |
CN112708688A (en) | InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof | |
CN112553365A (en) | InDel marker fingerprint spectrum of shiitake fungus WD5140 strain and construction method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |