CN112708688A - InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof - Google Patents
InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof Download PDFInfo
- Publication number
- CN112708688A CN112708688A CN202011567208.3A CN202011567208A CN112708688A CN 112708688 A CN112708688 A CN 112708688A CN 202011567208 A CN202011567208 A CN 202011567208A CN 112708688 A CN112708688 A CN 112708688A
- Authority
- CN
- China
- Prior art keywords
- strain
- mushroom
- indel
- lefp
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an InDel mark fingerprint of mushroom L7402 strain and a construction method thereof, wherein the fingerprint consists of 7 InDel marks developed after sequencing based on mushroom whole genome. The InDel marked fingerprint of the mushroom L7402 strain can be used for the specificity identification of the mushroom L7402 strain, has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the mushroom L7402 strain in the collected 44 mushroom strains.
Description
Technical Field
The invention belongs to the field of detection of mushroom strains, and particularly relates to an InDel marked fingerprint of a mushroom L7402 strain and a construction method thereof.
Background
Lentinus edodes (Lentinula edodes (Berk.) Pegler) is popular among consumers because of its high nutritional and medicinal value. China is the earliest country for artificially cultivating the mushrooms in the world, the cultivation history has been over 800 years, and the mushrooms are the most widely cultivated and highest-yield mushroom seeds in China at present. According to statistics of the edible fungus society of China, the total yield of the edible fungi of China in 2018 is 3842.04 ten thousand tons, wherein the total yield of the mushrooms is 1043.12 ten thousand tons, accounts for 27.15 percent of the total yield of the edible fungi in China and accounts for more than 90 percent of the total yield of the mushrooms in the world. In recent years, the shiitake mushroom industry becomes an important hand grip for domestic accurate poverty relief, shiitake mushrooms are selected as an important industry from national poor counties of more than 50% of China according to statistics, the cultivation scale of the shiitake mushrooms in China is further expanded, but with the rapid development of the shiitake mushroom industry in China, the problem that the shiitake mushroom production is similar and different in name and is also similar is increasingly prominent, so that the intellectual property of shiitake mushroom breeders is damaged, producers are greatly risky, and hidden dangers are caused for the further development of the shiitake mushroom industry. In order to guarantee the rights and interests of breeders, reduce the risks of producers and promote the healthy, stable and sustainable development of the shiitake mushroom industry in China, a simple, convenient, rapid and reliable shiitake mushroom strain specificity identification technology is urgently established.
With the rapid development of bioinformatics and the continuous maturation of DNA sequencing technology, the sequencing throughput is increasing and the cost is decreasing. The DNA molecular marker technology can detect the genetic specificity of the mushroom strains from the gene level, and the completion of the sequencing of the whole genome of the mushroom provides convenience for the development of InDel markers. The InDel molecular marker is an application based on a high-throughput sequencing technology, reduces the cost of InDel marker development, and is suitable for the development of lentinus edodes whole genome sequencing molecular markers. And the InDel marker has the advantages of abundant quantity, high accuracy, good stability, rapidness, convenience and the like, and can be used for molecular marker assisted breeding and mushroom strain identification.
Disclosure of Invention
The invention aims to solve the technical problem of providing an InDel marked fingerprint of a mushroom L7402 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.
The fingerprint of the InDel marker of the mushroom L7402 strain consists of 7 pairs of InDel markers, is an InDel marker primer developed based on an insertion/deletion fragment of a mushroom genome, has good amplification band type and high repeatability, and has detailed marking information shown in Table 1.
TABLE 1 InDel tagged primer information List
The invention also provides an application of the InDel marked fingerprint of the mushroom L7402 strain, which is to utilize 7 pairs of InDel marked primers developed by the insertion/deletion fragment of the mushroom genome to carry out InDel marked amplification on the mushroom strain, compare the obtained banding pattern with the banding pattern of the L7402 strain, and obtain the mushroom L7402 strain if the banding pattern is consistent with the banding pattern;
the combination of the band type numbers of the mushroom L7402 strain is as follows: (1+2)0(1+2)1221.
Through the banding amplification of the collected InDel marked primers of 44 mushroom varieties, the invention determines the number and the serial number of the allelic fragments of 7 pairs of InDel marked primers amplified in 44 mushroom varieties (table 2), and the L7402 strain can be effectively identified through the serial number combination of different InDel allelic loci (figures 2-8). The relative molecular weight of the amplified allelic locus of each InDel marker primer can be determined by DNA molecular weight control D2000bp DNA ladder, and the strains of L7402 strain specific InDel allelic fragment combination exist, namely the shiitake mushroom L7402 strain, and the numbering combination of the strains is as follows: (1+2)0(1+2)1221.
TABLE 2 summary of allelic fragment information for InDel primer amplification
The invention also provides a construction method of the InDel marked fingerprint of the mushroom L7402 strain, which comprises the following steps:
(1) hypha culture: transferring the mushroom mycelia into a potato glucose culture medium PDA, culturing at 23-25 ℃ in a dark place, and collecting the mycelia after 10 days;
(2) extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
secondly, putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
③ adding 2 xCTAB extract preheated for 1h at 65 ℃, preserving the temperature for 60min at 65 ℃, and shaking gently and mixing uniformly once at intervals of 20 min;
fourthly, centrifuging at 12000rpm and 4 ℃ for 20min, subpackaging the supernatant and two tubes of 800uL each;
adding the supernatant into a mixture with a volume ratio of 25: 24: 1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant and transferring into a new centrifugal tube;
sixthly, adding the mixture into the centrifugal tube according to the volume ratio of 24: 1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging the mixture for 10min at 12000rpm and 4 ℃, and transferring supernatant (recording volume) into another centrifugal tube;
seventhly, adding pre-cooled isopropanol at 20 ℃ below zero into the centrifugal tube, which is equal to the volume of the supernatant 2/3 in the step sixteenth, uniformly mixing, standing and precipitating for 1h at 20 ℃ below zero, centrifuging for 10min at 8000rpm and 4 ℃, and removing the supernatant;
adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5 min;
ninthly, removing the ethanol, and drying in an ultra-clean workbench; adding 100. mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA; the PCR amplification system is as follows: total volume 20 μ L, including: premix TaqTM(1.25U/25. mu.L Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer) 10. mu.L InDel/L InDel labeled forward primer and reverse primer each 1. mu.L, 2. mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. mu.L2O 6μL;
And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃ for 35 cycles; 7min at 72 ℃; storing at 10 deg.C;
and (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;
performing PCR amplification on the mushroom strain by adopting 7 pairs of InDel labeled primers, determining the number and relative molecular weight of allelic fragments amplified by each InDel labeled primer by using a DNA molecular weight control D2000bp DNA ladder, and finding a combination meeting the number: (1+2)0(1+2)1221, namely determining the strain to be the mushroom L7402 strain.
The invention has the advantages of
The InDel marked fingerprint of the mushroom L7402 strain can be used for identifying the L7402 strain, and has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test. The detection time only needs 3-4 days, while the conventional antagonism test needs at least two weeks, and the fruiting test needs at least 3 months; the method has the specificity of the L7402 strain in the collected 44 lentinus edodes strains in China, and has good application prospect.
Drawings
FIG. 1 is an InDel marker fingerprint of Lentinus edodes L7402 strain, wherein M is D2000bp DNA ladder, numerals 1-7 represent 7 pairs of InDel marker primers, and an arrow indicates the specific InDel allelic fragment combination of Lentinus edodes L7402 strain;
FIG. 2 is an amplification map of a primer Lefp _ id001 in 44 selected mushroom materials;
FIG. 3 is an amplification map of primer Lefp _ id002 in 44 selected shiitake mushroom materials;
FIG. 4 is an amplification map of primer Lefp _ id003 in 44 selected mushroom materials;
FIG. 5 is an amplification map of primer Lefp _ id004 in selected 44 shiitake mushroom materials;
FIG. 6 is an amplification map of primer Lefp _ id005 in selected 44 shiitake mushroom materials;
FIG. 7 shows the amplification pattern of primer Lefp _ id006 in 44 selected mushroom materials;
FIG. 8 shows the amplification pattern of the primer Lefp _ id007 in the selected 44 shiitake mushroom materials.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.
Marker、Premix TaqTMAll purchased from Takala Bio physician technology Co., Ltd
The rest materials and reagents are all common commercial products.
44 strains were derived:
1. CV108 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 2. xiangjiu strain, available from institute of microorganisms of Guangdong province; 3. the L7402 strain is originated from edible and medicinal fungi research institute in Songyang county; 4. 8404 strain, from edible fungus of Yichangsen origin, Hubei province; 5. huaxiang No. 5 strain, sourced from university of agriculture in Huazhong; 6. CV442 strain, available from institute of domestic fungus, academy of agricultural sciences, Shanghai city; 7. guangxi incense strain, sourced from Guangdong institute for microbiology; 8. l135 strain, available from Sanming fungus institute of Fujian province; 9. the L9319 strain is from the research and development company Limited of the large mountain mushroom industry of Lishui city, Zhejiang province; 10. minfeng No. 1 strain, san Ming fungus institute of Fujian province; 11. senyuan No. 1 strain, available from edible fungus of Yichangsen source, Limited liability company, Hubei province; 12. shenxiang No. 18 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 13. incense such as strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 14. shenxiang No. 15 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 15. CV105 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 16. the L241 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 17. 26 fragrant impurities, sourced from Guangdong institute for microorganisms; 18. l9608 strain, research center of edible fungi of Xixia county, Henan; 19. the Z3244 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 20. shenxiang No. 16 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 21. huaxiang No. 8 strain, sourced from university of agriculture in Huazhong; 22. the N7 strain is sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 23. RBL1 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 24. the Z3210 strain originated from edible fungus institute of academy of agricultural sciences of Shanghai city; 25. shanghai Xiang F2 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 26. l241-4 strain, sourced from technical research center of edible fungi in Qingyuan county, Zhejiang province; 27. the L26 strain, available from Sanming fungus institute of Fujian province; 28. the Junxing No. 8 strain is sourced from research and development centers of edible fungi in Lishui city, Zhejiang province; 29. CV501 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 30. the source of the suxiang strain is edible fungus institute of academy of agricultural sciences of Shanghai city; 31. l952 strain, source university of agriculture in china; 32. the Z3239 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 33. the Z3243 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 34. HK3161 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 35. l212 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 36. l868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 37. the TW1151 strain is from edible fungi institute 38 and L9105 strain of agricultural academy of sciences of Shanghai city, and is from technical research center of edible fungi of Qingyuan county of Zhejiang province; 39. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 40. j868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 41. senyuan No. 10 strain, available from edible fungus of Yichangsen source, Limited liability company, Hubei province; 42. WD4204 strain, available from institute of edible fungi, academy of agricultural sciences, Shanghai city; 43. WD5140 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 44. 931 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city.
Wherein 7 pairs of InDel labeled primer sequences (5 '-3') are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCACTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGTTGTTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACATTTGAA
Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCATACAACC
Reverse primer: ACCAAATGTCACAGCACAGG
Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC
Reverse primer: CATGATCAGATCACACAGCG are provided.
The primers were synthesized by Shanghai Bioengineering Co., Ltd.
Example 1
(1) Hypha culture: transferring the mushroom mycelia into a potato glucose culture medium PDA, culturing at 23-25 ℃ in a dark place, and collecting the mycelia after 10 days;
(2) extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
secondly, putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
③ adding 2 xCTAB extract preheated for 1h at 65 ℃, preserving the temperature for 60min at 65 ℃, and shaking gently and mixing uniformly once at intervals of 20 min;
fourthly, centrifuging at 12000rpm and 4 ℃ for 20min, subpackaging the supernatant and two tubes of 800uL each;
adding the supernatant into a mixture with a volume ratio of 25: 24: 1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant and transferring into a new centrifugal tube;
sixthly, adding the mixture into the centrifugal tube according to the volume ratio of 24: 1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging the mixture for 10min at 12000rpm and 4 ℃, and transferring supernatant (recording volume) into another centrifugal tube;
seventhly, adding pre-cooled isopropanol at 20 ℃ below zero relative to the volume of 2/3 parts of the supernatant in the step sixty into the centrifugal tube, uniformly mixing, standing and precipitating for 1h at 20 ℃ below zero, centrifuging for 10min at 8000rpm and 4 ℃, and removing the supernatant;
adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5 min;
ninthly, abandoning the ethanol and drying in the ultra-clean workbench. Adding 100 μ L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1 μ L of 10mg/mL RNaseA in water bath at 37 deg.C for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
(3) detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA;
the PCR amplification system is as follows: total volume 20 μ L, including: premix TaqTM(1.25U/25. mu.L Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer) 10. mu.L 10. mu. mol/L InDel labeled forward primerAnd 2 muL of template DNA and ddH extracted from the reverse primer in the total volume of 1 muL and the concentration of 20-30 ng/muL2O 6μL;
And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃ for 35 cycles; 7min at 72 ℃; storing at 10 deg.C;
(4) and (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;
the mushroom strains are respectively subjected to PCR amplification by adopting 7 pairs of InDel labeled primers, the number and the relative molecular weight of the allelic fragments amplified by each InDel labeled primer can be determined by DNA molecular weight control D2000bp DNA ladder, and as shown in figure 1, the combination of the matched numbers is found as follows: (1+2)0(1+2)1221, namely determining the strain to be shiitake mushroom L7402 strain, wherein the number 3 in figures 2-8 is L7402 strain, and the strip is the same as that in figure 1.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> InDel marked fingerprint spectrum of mushroom L7402 strain and construction method thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
accaaatgtc acagcacagg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
Claims (3)
1. A method for constructing an InDel mark fingerprint of a mushroom L7402 strain comprises the following steps:
(1) hypha culture: transferring the mycelium of Lentinus Edodes onto PDA plate, culturing at 25 deg.C in dark, and collecting mycelium after 10 days;
(2) extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL; the CTAB method for extracting genome DNA of hyphae comprises the following steps:
putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
secondly, putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
③ adding 2 xCTAB extract preheated for 1h at 65 ℃, preserving the temperature for 60min at 65 ℃, and shaking gently and mixing uniformly once at intervals of 20 min;
fourthly, centrifuging at 12000rpm and 4 ℃ for 20min, and subpackaging the supernatant into two tubes of 800 mu L each;
adding the supernatant into a mixture with a volume ratio of 25: 24: 1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant and transferring into a new centrifugal tube;
sixthly, adding the mixture into the centrifugal tube according to the volume ratio of 24: 1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring the supernatant into another centrifuge tube;
seventhly, adding pre-cooled isopropanol at 20 ℃ below zero relative to the volume of 2/3 parts of the supernatant in the step sixty into the centrifugal tube, uniformly mixing, standing and precipitating for 1h at 20 ℃ below zero, centrifuging for 10min at 8000rpm and 4 ℃, and removing the supernatant;
adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 5 min;
ninthly, removing the ethanol, and drying in an ultra-clean workbench; adding 100. mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
(3) detection of InDel molecular marker: performing PCR amplification of the InDel marker for developing the extracted DNA;
the PCR amplification system is as follows: total volume 20 μ L, including: premix TaqTM(1.25U/25. mu.L Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer)10uL, 10. mu. mol/L InDel labeled forward primer and reverse primer Total2 mu L, ddH of template DNA extracted at a concentration of 20-30 ng/. mu.L in a volume of 1 mu.L each2O 6μL;
And (3) PCR reaction conditions: 5min at 94 ℃; 45second at 94 ℃, 45second at 55-60 ℃, 30second at 72 ℃ for 35 cycles; 7min at 72 ℃; storing at 10 deg.C;
(4) and (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.5 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 5h, and the result is photographed and analyzed;
selecting 7 pairs of InDel marker primers to carry out PCR amplification on the mushroom strains, determining the number and relative molecular weight of allelic fragments amplified by each InDel marker primer by contrasting DNA molecular weight with D2000bp DNA ladder, and finding out a combination meeting the number: (1+2)0(1+2)1221, namely determining the strain to be a mushroom L7402 strain;
wherein 7 pairs of InDel labeled primer sequences (5 '-3') are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCACTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGTTGTTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACATTTGAA
Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCATACAACC
Reverse primer: ACCAAATGTCACAGCACAGG
Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC
Reverse primer: CATGATCAGATCACACAGCG are provided.
2. An InDel marking fingerprint map of mushroom L7402 strain is characterized in that the fingerprint map consists of 7 pairs of InDel marks, and is an InDel marking primer developed based on an insertion/deletion fragment of mushroom genome, and the 7 pairs of InDel marking primer sequences (5 '-3') are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCACTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGTTGTTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACATTTGAA
Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCATACAACC
Reverse primer: ACCAAATGTCACAGCACAGG
Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC
Reverse primer: CATGATCAGATCACACAGCG are provided.
3. The application of the InDel marked fingerprint of the L7402 strain of the mushroom as claimed in claim 2, which is to utilize 7 pairs of InDel marked primers developed by the insertion/deletion fragment of the mushroom genome to carry out InDel marked amplification on the mushroom strain, and compare the obtained banding pattern with the banding pattern of the L7402 strain, and the banding pattern is the L7402 strain of the mushroom; the combination of the band type numbers of the mushroom L7402 strain is as follows: (1+2)0(1+2)1221.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011567208.3A CN112708688A (en) | 2020-12-25 | 2020-12-25 | InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011567208.3A CN112708688A (en) | 2020-12-25 | 2020-12-25 | InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN112708688A true CN112708688A (en) | 2021-04-27 |
Family
ID=75546903
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011567208.3A Withdrawn CN112708688A (en) | 2020-12-25 | 2020-12-25 | InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112708688A (en) |
-
2020
- 2020-12-25 CN CN202011567208.3A patent/CN112708688A/en not_active Withdrawn
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112575110B (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 8 strain and construction method thereof | |
CN112626253B (en) | InDel marked fingerprint spectrum of champignon Guangxi strain and construction method thereof | |
CN112593003B (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof | |
CN112593002B (en) | InDel marker fingerprint spectrum of mushroom L135 strain and construction method thereof | |
CN112522435A (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 15 strain and construction method thereof | |
CN112725492A (en) | InDel marker fingerprint spectrum of mushroom CV501 strain and construction method thereof | |
CN112646915A (en) | InDel marker fingerprint spectrum of shiitake fungus WD4204 strain and construction method thereof | |
CN112538546A (en) | InDel marker fingerprint spectrum of mushroom L952 strain and construction method thereof | |
CN112646916A (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 5 strain and construction method thereof | |
CN112695118A (en) | InDel marked fingerprint spectrum of shiitake mushroom Shenxiang No. 18 strain and construction method thereof | |
CN112626252B (en) | InDel marker fingerprint spectrum of mushroom CV105 strain and construction method thereof | |
CN113215294B (en) | InDel marker fingerprint spectrum of shiitake mushroom L868 strain and construction method thereof | |
CN112575111B (en) | InDel marker fingerprint spectrum of mushroom L26 strain and construction method thereof | |
CN112626255B (en) | InDel marker fingerprint spectrum of mushroom CV108 strain and construction method thereof | |
CN112626254B (en) | InDel marker fingerprint spectrum of shiitake mushroom L9319 strain and construction method thereof | |
CN112708689B (en) | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof | |
CN112553366B (en) | InDel marked fingerprint spectrum of Senyuan No. 1 strain of lentinus edodes and construction method thereof | |
CN112593004B (en) | InDel marker fingerprint spectrum of mushroom fragrant hybrid 26 strain and construction method thereof | |
CN112899388B (en) | InDel marked fingerprint of shiitake mushroom like strain and construction method thereof | |
CN112725491B (en) | InDel marker fingerprint spectrum of shiitake mushroom Z3239 strain and construction method thereof | |
CN112708688A (en) | InDel mark fingerprint spectrum of mushroom L7402 strain and construction method thereof | |
CN112760398A (en) | InDel marker fingerprint spectrum of mushroom L241-4 strain and construction method thereof | |
CN112522436A (en) | InDel marker fingerprint spectrum of shiitake 8404 strain and construction method thereof | |
CN112553365A (en) | InDel marker fingerprint spectrum of shiitake fungus WD5140 strain and construction method thereof | |
CN112725493A (en) | InDel marked fingerprint spectrum of mushroom CV442 strain and construction method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20210427 |
|
WW01 | Invention patent application withdrawn after publication |