CN112593003B - InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof - Google Patents
InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof Download PDFInfo
- Publication number
- CN112593003B CN112593003B CN202011567295.2A CN202011567295A CN112593003B CN 112593003 B CN112593003 B CN 112593003B CN 202011567295 A CN202011567295 A CN 202011567295A CN 112593003 B CN112593003 B CN 112593003B
- Authority
- CN
- China
- Prior art keywords
- strain
- primer
- mushroom
- lefp
- shenxiang
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an InDel mark fingerprint of mushroom Shenxiang No. 16 strain and a construction method thereof, wherein the fingerprint consists of 7 InDel marks developed after sequencing based on a mushroom whole genome. The InDel marked fingerprint of the mushroom 16 strain can be used for the specificity identification of the mushroom 16 strain, has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the mushroom 16 strain in the collected 44 mushroom strains.
Description
Technical Field
The invention belongs to the field of detection of mushroom strains, and particularly relates to an InDel marked fingerprint map of mushroom Shenxiang No. 16 strain and a construction method thereof.
Background
Lentinus edodes (Lentinula edodes (Berk.) Pegler) is popular among consumers because of its high nutritive and medicinal value. China is the earliest country for artificially cultivating the mushrooms in the world, the cultivation history has been over 800 years, and the mushrooms are the most widely cultivated and highest-yield mushroom seeds in China at present. According to statistics of the China edible fungus Association, the total yield of the Chinese edible fungi in 2018 is 3842.04 ten thousand tons, wherein the total yield of the shiitake mushrooms is 1043.12 ten thousand tons, which accounts for 27.15% of the total yield of the domestic edible fungi and accounts for more than 90% of the total yield of the shiitake mushrooms in the world. The cultivation scale of the mushrooms in China is further enlarged, but with the rapid development of the mushroom industry in China, the problem that the mushrooms are produced by using the same species and different names is increasingly prominent, so that not only is the intellectual property of mushroom breeders damaged, but also great risk is caused for producers, and hidden danger is caused for the further development of the mushroom industry. In order to guarantee the rights and interests of breeders, reduce the risks of producers and promote the healthy, stable and sustainable development of the shiitake mushroom industry in China, a simple, convenient, rapid and reliable shiitake mushroom strain specificity identification technology is urgently established.
With the rapid development of bioinformatics and the continuous maturation of DNA sequencing technology, the sequencing throughput is increasing and the cost is decreasing. The DNA molecular marker technology can detect the genetic specificity of the mushroom strains from the gene level, and the completion of the sequencing of the whole genome of the mushroom provides convenience for the development of InDel markers. The InDel molecular marker is an application based on a high-throughput sequencing technology, reduces the cost of InDel marker development, and is suitable for the development of lentinus edodes whole genome sequencing molecular markers. And the InDel marker has the advantages of abundant quantity, high accuracy, good stability, rapidness, convenience and the like, and can be used for molecular marker assisted breeding and mushroom strain identification.
Disclosure of Invention
The invention aims to solve the technical problem of providing an InDel marked fingerprint of mushroom Shenxiang No. 16 strain and a construction method and application thereof.
The fingerprint of the InDel marker of shiitake mushroom Shenxiang No. 16 strain consists of 7 pairs of InDel markers, is an InDel marker primer developed based on insertion/deletion segments of a shiitake mushroom genome, has good amplification band type and high repeatability, and has detailed marking information shown in table 1.
TABLE 1 InDel tagged primer information List
The invention also provides an application of the InDel marked fingerprint of the shiitake mushroom Shenxiang No. 16 strain, which is characterized in that 7 pairs of InDel marked primers developed by the insertion/deletion fragment of the shiitake mushroom genome are utilized to carry out InDel marked amplification on the shiitake mushroom strain, the obtained banding pattern is compared with the banding pattern of the Shenxiang No. 16 strain, and the banding pattern is consistent with the banding pattern and is the shiitake mushroom Shenxiang No. 16 strain;
the band type number combination of shiitake mushroom Shenxiang No. 16 strain is as follows: 20121 (1+2) 2.
Through the banding amplification of the collected InDel marked primers of 44 mushroom varieties, the invention determines the number and the numbering of the allelic fragments of 7 pairs of InDel marked primers amplified in 44 mushroom varieties (table 2), and the species of Shenxiang No. 16 can be effectively identified through the combination of the numbering of different InDel allelic sites (figures 2-8). The relative molecular weight of the allelic locus amplified by each InDel marker primer can be determined by DNA molecular weight control D2000bp DNA ladder, and the strain with the specific InDel allelic fragment combination of the Shenxiang No. 16 strain exists, namely the shiitake mushroom Shenxiang No. 16 strain, wherein the numbering combination of the strain is as follows: 20121 (1+2) 2.
TABLE 2 summary of allelic fragment information from InDel primer amplification
The invention also provides a construction method of the InDel marked fingerprint of the shiitake mushroom Shenxiang No. 16 strain, which comprises the following steps:
(1) Hypha culture: transferring the mushroom hyphae into a potato glucose culture medium PDA, culturing at 23-22 ℃ in a dark place, and collecting the hyphae after 10 days;
(2) Extraction of genomic DNA: extracting genome DNA of the hypha by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry method, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:
(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
(3) adding 2 × CTAB extractive solution preheated at 62 deg.C for 1 hr, keeping the temperature at 62 deg.C for 60min, and shaking gently once at interval of 20 min;
(4) centrifuging at 12000rpm and 4 deg.C for 20min, subpackaging the supernatant, and subpackaging two tubes each with 800uL;
(5) adding a volume ratio of 22:24:1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant and transferring the supernatant into a new centrifugal tube;
(6) adding the centrifuge tube with the volume ratio of 24:1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging the mixture for 10min at 12000rpm and 4 ℃, and transferring supernatant (recording volume) into another centrifugal tube;
(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube, which is 2/3 of the volume of the supernatant in the step (6), uniformly mixing, standing and precipitating at-20 ℃ for 1h, centrifuging at 8000rpm and 4 ℃ for 10min, and removing the supernatant;
(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 2min;
(9) removing ethanol, and drying in an ultra-clean workbench; adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA; the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq TM (1.22U/22. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel labeled forward primer and reverse primer each 1. Mu.L, 2. Mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. Mu.L 2 O 6μL;
And (3) PCR reaction conditions: 94 ℃ for 2min; 42second at 94 ℃, 42second at 22-60 ℃, 30second at 72 ℃, 32 cycles; 7min at 72 ℃; storing at 10 deg.C;
and (3) electrophoresis detection: spotting 7 microlitres of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.2 percent, the electrophoresis buffer solution is 1 XTAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is carried out for 2h, and the result is photographed and analyzed;
performing PCR amplification on the mushroom strain by adopting 7 pairs of InDel labeled primers, determining the number and relative molecular weight of allelic fragments amplified by each InDel labeled primer by using a DNA molecular weight control D2000bp DNA ladder, and finding a combination of No. Fu Gebian: 20121 (1+2) 2, namely the strain is the mushroom 16.
The invention has the advantages of
The InDel marked fingerprint of the shiitake mushroom Shenxiang No. 16 strain can be used for identifying the Shenxiang No. 16 strain, and has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test. The detection time only needs 3-4 days, while the conventional antagonism test needs at least two weeks, and the fruiting test needs at least 3 months; the method has specificity of Shenxiang No. 16 strain in the collected 44 Lentinus Edodes strains in China, and has good application prospect.
Drawings
FIG. 1 is an InDel labeled fingerprint of Xianggu mushroom 16 strain, where M is D2000bp DNA ladder, numerals 1-7 represent 7 pairs of InDel labeled primers, and the arrow indicates the specific InDel allelic segment combination of Xianggu mushroom 16 strain;
FIG. 2 is an amplification map of a primer Lefp _ id001 in 44 selected mushroom materials;
FIG. 3 is an amplification map of primer Lefp _ id002 in 44 selected shiitake mushroom materials;
FIG. 4 is an amplification map of primer Lefp _ id003 in 44 selected mushroom materials;
FIG. 5 is an amplification map of primer Lefp _ id004 in selected 44 shiitake mushroom materials;
FIG. 6 shows the amplification pattern of primer Lefp _ id002 in 44 selected shiitake mushroom materials;
FIG. 7 is an amplification map of primer Lefp _ id006 in 44 selected mushroom materials;
FIG. 8 shows the amplification pattern of primer Lefp _ id007 in 44 selected mushroom materials.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined by the appended claims.
Marker、Premix Taq TM All purchased from Takala Bio physician technology Co., ltd
The rest materials and reagents are all common commercial products.
44 strains were derived:
1. CV108 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 2. xiangjiu strain, available from institute of microorganisms of Guangdong province; 3. the L7402 strain is from research institute of edible and medicinal fungi in Songyang county; 4. 8404 strain, from edible fungus of Yichangsen origin, hubei province; 2. huaxiang No. 2 strain, sourced from university of agriculture in Huazhong; 6. CV442 strain, available from institute of domestic fungus, academy of agricultural sciences, shanghai city; 7. guangxi incense strain, sourced from Guangdong institute for microbiology; 8. l132 strain, available from Sanming fungus institute of Fujian province; 9. the L9319 strain is from the research and development company Limited of the large mountain mushroom industry of Lishui city, zhejiang province; 10. minfeng No. 1 strain, san Ming fungus institute of Fujian province; 11. senyuan No. 1 strain, available from edible fungus of Yichangsen source, limited liability company, hubei province; 12. shenxiang No. 18 strain, sourced from edible fungus institute of agricultural science institute of Shanghai city; 13. incense such as strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 14. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 12. CV102 strain, sourced from edible fungus institute of agricultural science institute of Shanghai city; 16. the L241 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 17. 26 fragrant impurities, sourced from Guangdong institute for microorganisms; 18. l9608 strain, research center of edible fungi of Xixia county, henan; 19. the Z3244 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 20. shenxiang No. 16 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 21. huaxiang No. 8 strain, sourced from university of agriculture in Huazhong; 22. n7 strain, from institute of domestic fungus, academy of agricultural sciences, shanghai city; 23. RBL1 strain is originated from institute of edible fungi of academy of agricultural sciences of Shanghai city; 24. the Z3210 strain originated from edible fungus institute of academy of agricultural sciences of Shanghai city; 22. shanghai Xiang F2 Strain, edible fungus institute of Shanghai institute of agricultural sciences; 26. l241-4 strain, which is sourced from scientific and technical research center of edible fungi in Qingyuan county, zhejiang province; 27. l26 strain, available from Sanming fungus institute of Fujian province; 28. the 8 th strain of Junxing is sourced from research and development center of edible fungi in Lishui city, zhejiang province; 29. CV201 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 30. the source of the suxiang strain is edible fungus institute of academy of agricultural sciences of Shanghai city; 31. l922 strain, sourced from university of agriculture in china; 32. the Z3239 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 33. the Z3243 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 34. HK3161 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 32. l212 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 36. l868 strain, sourced from edible fungus institute of academy of agricultural sciences, shanghai city; 37. the TW1121 strain was derived from edible fungus institute 38, L9102 strain of agricultural academy of sciences of Shanghai city, and was derived from technical research center of edible fungus science of Qingyuan county, zhejiang province; 39. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 40. j868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 41. senyuan No. 10 strain, available from edible fungus of Yichangsen source, limited liability company, hubei province; 42. WD4204 strain, available from institute of edible fungi of academy of agricultural sciences, shanghai; 43. WD2140 strain from edible fungus institute of Shanghai institute of agricultural science; 44. 931 Strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city.
Wherein 7 pairs of InDel labeled primer sequences (2 '-3') are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCACTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGTTGTTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACATTTGAA
Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id002 forward primer: GTAGCACTCCTCATACAACC
Reverse primer: ACCAAATGTCACAGCACAGG
Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC
Reverse primer: CATGATCAGATCACACAGCG.
The primers were synthesized by Shanghai Bioengineering Co., ltd.
Example 1
(1) Hypha culture: transferring the mushroom hyphae into a potato glucose culture medium PDA, culturing at 23-22 ℃ in the dark, and collecting the hyphae after 10 days;
(2) Extraction of genomic DNA: extracting genome DNA of the hypha by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry method, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;
(2) putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;
(3) adding 2 × CTAB extractive solution preheated at 62 deg.C for 1 hr, keeping the temperature at 62 deg.C for 60min, and shaking gently once at interval of 20 min;
(4) centrifuging at 12000rpm and 4 deg.C for 20min, subpackaging the supernatant, and subpackaging two tubes each with 800uL;
(5) adding the supernatant into a mixture with a volume ratio of 22:24:1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring the supernatant into a new centrifuge tube;
(6) adding the centrifuge tube with the volume ratio of 24:1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging the mixture for 10min at 12000rpm and 4 ℃, and transferring supernatant (recording volume) into another centrifugal tube;
(7) adding pre-cooled isopropanol of-20 ℃ into the centrifuge tube in an amount which is 2/3 of the volume of the supernatant in the step (6), uniformly mixing, standing and precipitating at-20 ℃ for 1h, centrifuging at 8000rpm and 4 ℃ for 10min, and removing the supernatant;
(8) adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 2min;
(9) and (5) discarding the ethanol, and drying in an ultra-clean workbench. Adding 100. Mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. Mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;
storing the obtained DNA extract in refrigerator at-20 deg.C for use;
(3) Detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA;
the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq TM (1.22U/22. Mu.L Taq DNase, 0.4mM/L dNTP,0.3mM/L PCR buffer) 10. Mu.L InDel labeled forward primer and reverse primer each 1. Mu.L, 2. Mu.L ddH of template DNA extracted at a concentration of 20-30 ng/. Mu.L 2 O 6μL;
And (3) PCR reaction conditions: 94 ℃ for 2min; 42second at 94 ℃, 42second at 22-60 ℃, 30second at 72 ℃ for 32 cycles; 7min at 72 ℃; storing at 10 deg.C;
(4) And (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.2 percent, the electrophoresis buffer solution is 1 XTAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is performed for 2h, and the result is photographed and analyzed;
the mushroom strains are respectively subjected to PCR amplification by adopting 7 pairs of InDel labeled primers, the number and the relative molecular weight of the allelic fragments amplified by each InDel labeled primer can be determined by controlling a DNA ladder by DNA molecular weight D2000bp, and as shown in figure 1, a combination of No. Fu Gebian is found as follows: 20121 (1+2) 2, namely, the strain is mushroom 16, the number 20 in fig. 2-8 is mushroom 16, and the band is the same as that in fig. 1.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> InDel mark fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
accaaatgtc acagcacagg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
Claims (1)
1. A method for identifying shiitake mushroom Shenxiang No. 16 strain is characterized in that the following 7 pairs of InDel labeled primer combinations are utilized to amplify the shiitake mushroom strain, and the banding pattern obtained is compared with the banding pattern of the Shenxiang No. 16 strain and is the shiitake mushroom Shenxiang No. 16 strain; the band type number combination of shiitake mushroom Shenxiang No. 16 strain is as follows: 2/0/1/2/1/(1+2)/2; the number corresponding to the primer Lefp _ id001 is a first pair of band types 2, wherein 2 corresponds to 149bp; the number corresponding to the primer Lefp _ id002 is a second pair of banding patterns 0, wherein 0 corresponds to no banding; the number corresponding to the primer Lefp _ id003 is a third pair of banding patterns 1, wherein 1 corresponds to 265bp; the number corresponding to the primer Lefp _ id004 is a fourth pair of band types 2, wherein 2 corresponds to 232bp; the number corresponding to the primer Lefp _ id005 is a fifth pair of band types 1, wherein 1 corresponds to 378bp; the number corresponding to the primer Lefp _ id006 is the sixth band type (1+2), wherein 1 corresponds to 277bp, and 2 corresponds to 262bp; the number corresponding to the primer Lefp _ id007 is a seventh pair of band types 2, wherein 2 corresponds to 264bp;
the 7 pairs of InDel labeled primer sequences 5'-3' are as follows:
lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA
Reverse primer: TGCCCCACTTACTCTCAACC
Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG
Reverse primer: GGGAGTGGGTTGTTTGGATA
Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG
Reverse primer: CGTACGGTTGGACATTTGAA
Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG
Reverse primer: GTCAACGGAGGGAAACAGAG
Lefp _ id005 forward primer: GTAGCACTCCTCATACAACC
Reverse primer: ACCAAATGTCACAGCACAGG
Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG
Reverse primer: CCCTTTTGCCCTATAAGGCG
Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC
Reverse primer: CATGATCAGATCACACAGCG.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011567295.2A CN112593003B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011567295.2A CN112593003B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112593003A CN112593003A (en) | 2021-04-02 |
CN112593003B true CN112593003B (en) | 2023-02-03 |
Family
ID=75202282
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011567295.2A Active CN112593003B (en) | 2020-12-25 | 2020-12-25 | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112593003B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114410480B (en) * | 2021-12-27 | 2023-11-03 | 山东七河生物科技股份有限公司 | Non-spore mushroom strain QH340 and Indel marker fingerprint identification method thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106755510B (en) * | 2017-02-07 | 2020-07-07 | 上海市农业科学院 | SSR marker fingerprint spectrum of shiitake mushroom Shenxiang No. 15 strain and construction method and application thereof |
-
2020
- 2020-12-25 CN CN202011567295.2A patent/CN112593003B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN112593003A (en) | 2021-04-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112593003B (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof | |
CN112575110B (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 8 strain and construction method thereof | |
CN112626253B (en) | InDel marked fingerprint spectrum of champignon Guangxi strain and construction method thereof | |
CN112593002B (en) | InDel marker fingerprint spectrum of mushroom L135 strain and construction method thereof | |
CN112695118A (en) | InDel marked fingerprint spectrum of shiitake mushroom Shenxiang No. 18 strain and construction method thereof | |
CN112522435A (en) | InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 15 strain and construction method thereof | |
CN112725492A (en) | InDel marker fingerprint spectrum of mushroom CV501 strain and construction method thereof | |
CN112646916A (en) | InDel marked fingerprint spectrum of shiitake mushroom Huaxiang No. 5 strain and construction method thereof | |
CN112646915A (en) | InDel marker fingerprint spectrum of shiitake fungus WD4204 strain and construction method thereof | |
CN112538546A (en) | InDel marker fingerprint spectrum of mushroom L952 strain and construction method thereof | |
CN112725491B (en) | InDel marker fingerprint spectrum of shiitake mushroom Z3239 strain and construction method thereof | |
CN112593004B (en) | InDel marker fingerprint spectrum of mushroom fragrant hybrid 26 strain and construction method thereof | |
CN113215294B (en) | InDel marker fingerprint spectrum of shiitake mushroom L868 strain and construction method thereof | |
CN112575111B (en) | InDel marker fingerprint spectrum of mushroom L26 strain and construction method thereof | |
CN112626254B (en) | InDel marker fingerprint spectrum of shiitake mushroom L9319 strain and construction method thereof | |
CN112626255B (en) | InDel marker fingerprint spectrum of mushroom CV108 strain and construction method thereof | |
CN112553366B (en) | InDel marked fingerprint spectrum of Senyuan No. 1 strain of lentinus edodes and construction method thereof | |
CN112626252B (en) | InDel marker fingerprint spectrum of mushroom CV105 strain and construction method thereof | |
CN112899388B (en) | InDel marked fingerprint of shiitake mushroom like strain and construction method thereof | |
CN112708689B (en) | InDel marker fingerprint spectrum of lentinus edodes TW1151 strain and construction method thereof | |
CN112899387A (en) | InDel marked fingerprint of shiitake Shanghai fragrant F2 strain and construction method thereof | |
CN112795679A (en) | InDel marker fingerprint spectrum of mushroom N7 strain and construction method thereof | |
CN112695116A (en) | InDel marker fingerprint spectrum of mushroom Minfeng No. 1 strain and construction method thereof | |
CN112593001A (en) | InDel marked fingerprint spectrum of shiitake 931 strain and construction method thereof | |
CN112695117A (en) | InDel marker fingerprint spectrum of mushroom Xiangjiu strain and construction method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |