CN112593003A

CN112593003A - InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof

Info

Publication number: CN112593003A
Application number: CN202011567295.2A
Authority: CN
Inventors: 张美彦; 章炉军; 于海龙; 尚晓冬; 谭琦; 宋春艳
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2021-04-02
Anticipated expiration: 2040-12-25
Also published as: CN112593003B

Abstract

The invention relates to an InDel mark fingerprint of mushroom Shenxiang No. 16 strain and a construction method thereof, wherein the fingerprint consists of 7 InDel marks developed after sequencing based on a mushroom whole genome. The InDel marked fingerprint of the mushroom 16 strain can be used for the specificity identification of the mushroom 16 strain, has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the mushroom 16 strain in the collected 44 mushroom strains.

Description

InDel marker fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof

Technical Field

The invention belongs to the field of detection of mushroom strains, and particularly relates to an InDel marked fingerprint map of mushroom Shenxiang No. 16 strain and a construction method thereof.

Background

Lentinus edodes (Lentinula edodes (Berk.) Pegler) is popular among consumers because of its high nutritive and medicinal value. China is the earliest country for artificially cultivating the mushrooms in the world, the cultivation history has been over 800 years, and the mushrooms are the most widely cultivated and highest-yield mushroom seeds in China at present. According to statistics of the edible fungus society of China, the total yield of the edible fungi of China in 2018 is 3842.04 ten thousand tons, wherein the total yield of the mushrooms is 1043.12 ten thousand tons, accounts for 27.15 percent of the total yield of the edible fungi in China and accounts for more than 90 percent of the total yield of the mushrooms in the world. The cultivation scale of the mushrooms in China is further enlarged, but with the rapid development of the mushroom industry in China, the problem that the mushrooms are produced in the same species and different names and different species and same names is increasingly prominent, so that not only is the intellectual property of mushroom breeders damaged, but also great risks are caused for producers, and hidden dangers are caused for the further development of the mushroom industry. In order to guarantee the rights and interests of breeders, reduce the risks of producers and promote the healthy, stable and sustainable development of the shiitake mushroom industry in China, a simple, convenient, rapid and reliable shiitake mushroom strain specificity identification technology is urgently established.

With the rapid development of bioinformatics and the continuous maturation of DNA sequencing technology, the sequencing throughput is increasing and the cost is decreasing. The DNA molecular marker technology can detect the genetic specificity of the mushroom strains from the gene level, and the completion of the sequencing of the whole genome of the mushroom provides convenience for the development of InDel markers. The InDel molecular marker is an application based on a high-throughput sequencing technology, reduces the cost of InDel marker development, and is suitable for the development of lentinus edodes whole genome sequencing molecular markers. And the InDel marker has the advantages of abundant quantity, high accuracy, good stability, rapidness, convenience and the like, and can be used for molecular marker assisted breeding and mushroom strain identification.

Disclosure of Invention

The invention aims to solve the technical problem of providing an InDel marked fingerprint of mushroom Shenxiang No. 16 strain and a construction method and application thereof.

The fingerprint of the InDel marker of mushroom Shenxiang No. 16 strain consists of 7 pairs of InDel markers, is an InDel marker primer developed based on an insertion/deletion fragment of a mushroom genome, has good amplification band type and high repeatability, and the detailed information of the markers is shown in Table 1.

TABLE 1 InDel tagged primer information List

The invention also provides an application of the InDel marked fingerprint of the shiitake mushroom Shenxiang No. 16 strain, which is characterized in that 7 pairs of InDel marked primers developed by the insertion/deletion fragment of the shiitake mushroom genome are utilized to carry out InDel marked amplification on the shiitake mushroom strain, the obtained banding pattern is compared with the banding pattern of the Shenxiang No. 16 strain, and the banding pattern is consistent with the banding pattern and is the shiitake mushroom Shenxiang No. 16 strain;

the band type number combination of shiitake mushroom Shenxiang No. 16 strain is as follows: 20121(1+2)2.

Through the banding amplification of the collected InDel marked primers of 44 mushroom varieties, the invention determines the number and the serial number of the allelic fragments of 7 pairs of InDel marked primers amplified in 44 mushroom varieties (table 2), and the species of Shenxiang No. 16 can be effectively identified through the serial number combination of different InDel allelic sites (figures 2-8). The relative molecular weight of the allelic locus amplified by each InDel marker primer can be determined by DNA molecular weight control D2000bp DNA ladder, and the strain with the specific InDel allelic fragment combination of the Shenxiang No. 16 strain exists, namely the shiitake mushroom Shenxiang No. 16 strain, wherein the numbering combination of the strain is as follows: 20121(1+2)2.

TABLE 2 summary of allelic fragment information for InDel primer amplification

The invention also provides a construction method of the InDel marked fingerprint of the mushroom Shenxiang No. 16 strain, which comprises the following steps:

(1) hypha culture: transferring the mushroom mycelia into a potato glucose culture medium PDA, culturing at 23-22 ℃ in a dark place, and collecting the mycelia after 10 days;

(2) extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry method, and adjusting the concentration of the sample DNA to be 20-30 ng/uL;

the CTAB method for extracting genome DNA of hyphae comprises the following steps:

putting the freeze-dried mushroom mycelia into a 2mL centrifuge tube, and putting 2-3 steel balls;

secondly, putting the centrifuge tube into a multi-sample tissue grinder, setting the frequency to be 60Hz, and grinding for 30s until the powder is uniform;

③ adding 2 xCTAB extract preheated for 1h at 62 ℃, preserving the temperature for 60min at 62 ℃, and shaking gently and mixing uniformly once at intervals of 20 min;

fourthly, centrifuging at 12000rpm and 4 ℃ for 20min, subpackaging the supernatant and two tubes of 800uL each;

adding the supernatant into a mixture with a volume ratio of 22: 24: 1, gently mixing the mixture of phenol, chloroform and isoamylol uniformly for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and taking supernatant and transferring into a new centrifugal tube;

sixthly, adding the mixture into the centrifugal tube according to the volume ratio of 24: 1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging the mixture for 10min at 12000rpm and 4 ℃, and transferring supernatant (recording volume) into another centrifugal tube;

seventhly, adding pre-cooled isopropanol at 20 ℃ below zero into the centrifugal tube, wherein the volume of the pre-cooled isopropanol is equal to that of 2/3 volume of the supernatant obtained in the step sixteenth, uniformly mixing, standing and precipitating for 1h at 20 ℃ below zero, centrifuging for 10min at 8000rpm and 4 ℃, and removing the supernatant;

adding 1mL of 70% ethanol into the obtained precipitate, washing for 1 time at 8000rpm, and centrifuging at room temperature for 2 min;

ninthly, removing the ethanol, and drying in an ultra-clean workbench; adding 100. mu.L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1. mu.L of 10mg/mL RNaseA in water bath at 37 ℃ for 1h, and removing RNA;

storing the obtained DNA extract in refrigerator at-20 deg.C for use;

detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA; the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq^TM(1.22U/22 uL Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer)10uL InDel labeled forward primer and reverse primer each 1 uL, 2 uL ddH of template DNA extracted at the concentration of 20-30 ng/uL₂O 6μL；

And (3) PCR reaction conditions: 94 ℃ for 2 min; 42second at 94 ℃, 42second at 22-60 ℃, 30second at 72 ℃ and 32 cycles; 7min at 72 ℃; storing at 10 deg.C;

and (3) electrophoresis detection: spotting 7 microlitres of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.2 percent, the electrophoresis buffer solution is 1 XTAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is carried out for 2h, and the result is photographed and analyzed;

performing PCR amplification on the mushroom strain by adopting 7 pairs of InDel labeled primers, determining the number and relative molecular weight of allelic fragments amplified by each InDel labeled primer by using a DNA molecular weight control D2000bp DNA ladder, and finding a combination meeting the number: 20121(1+2)2, namely determining the strain to be a shiitake mushroom 16 # strain.

The invention has the advantages of

The InDel marked fingerprint of the shiitake mushroom Shenxiang No. 16 strain can be used for identifying the Shenxiang No. 16 strain, and has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test. The detection time only needs 3-4 days, while the conventional antagonism test needs at least two weeks, and the fruiting test needs at least 3 months; the method has specificity of Shenxiang No. 16 strain in the collected 44 Lentinus Edodes strains in China, and has good application prospect.

Drawings

FIG. 1 is an InDel labeled fingerprint of Xianggu mushroom 16 strain, where M is D2000bp DNA ladder, numerals 1-7 represent 7 pairs of InDel labeled primers, and the arrow indicates the specific InDel allelic segment combination of Xianggu mushroom 16 strain;

FIG. 2 is an amplification map of a primer Lefp _ id001 in 44 selected mushroom materials;

FIG. 3 is an amplification map of primer Lefp _ id002 in 44 selected shiitake mushroom materials;

FIG. 4 is an amplification map of primer Lefp _ id003 in 44 selected mushroom materials;

FIG. 5 is an amplification map of primer Lefp _ id004 in selected 44 shiitake mushroom materials;

FIG. 6 shows the amplification pattern of primer Lefp _ id002 in 44 selected shiitake mushroom materials;

FIG. 7 shows the amplification pattern of primer Lefp _ id006 in 44 selected mushroom materials;

FIG. 8 shows the amplification pattern of the primer Lefp _ id007 in the selected 44 shiitake mushroom materials.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined by the appended claims.

Marker、Premix Taq^TMAll purchased from Takala Bio physician technology Co., Ltd

The rest materials and reagents are all common commercial products.

44 strains were derived:

1. CV108 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 2. xiangjiu strain, available from institute of microorganisms of Guangdong province; 3. the L7402 strain is originated from edible and medicinal fungi research institute in Songyang county; 4. 8404 strain, from edible fungus of Yichangsen origin, Hubei province; 2. huaxiang No. 2 strain, sourced from university of agriculture in Huazhong; 6. CV442 strain, available from institute of domestic fungus, academy of agricultural sciences, Shanghai city; 7. guangxi incense strain, sourced from Guangdong institute for microbiology; 8. l132 strain, available from Sanming fungus institute of Fujian province; 9. the L9319 strain is from the research and development company Limited of the large mountain mushroom industry of Lishui city, Zhejiang province; 10. minfeng No. 1 strain, san Ming fungus institute of Fujian province; 11. senyuan No. 1 strain, available from edible fungus of Yichangsen source, Limited liability company, Hubei province; 12. shenxiang No. 18 strain, sourced from edible fungus institute of agricultural science institute of Shanghai city; 13. incense such as strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 14. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 12. CV102 strain, sourced from edible fungus institute of agricultural science institute of Shanghai city; 16. the L241 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 17. 26 fragrant impurities, sourced from Guangdong institute for microorganisms; 18. l9608 strain, research center of edible fungi of Xixia county, Henan; 19. the Z3244 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 20. shenxiang No. 16 strain, sourced from edible fungus institute of academy of agricultural sciences in Shanghai city; 21. huaxiang No. 8 strain, sourced from university of agriculture in Huazhong; 22. the N7 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 23. RBL1 strain, sourced from institute of edible fungi of academy of agricultural sciences of Shanghai city; 24. the Z3210 strain originated from edible fungus institute of academy of agricultural sciences of Shanghai city; 22. shanghai Xiang F2 strain, sourced from edible fungus institute of agricultural academy of sciences of Shanghai city; 26. the L241-4 strain is sourced from scientific and technical research center of edible fungi in Qingyuan county, Zhejiang province; 27. the L26 strain, available from Sanming fungus institute of Fujian province; 28. the Junxing No. 8 strain is sourced from research and development centers of edible fungi in Lishui city, Zhejiang province; 29. CV201 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 30. the source of the suxiang strain is edible fungus institute of academy of agricultural sciences of Shanghai city; 31. l922 strain, sourced from university of agriculture in china; 32. the Z3239 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 33. the Z3243 strain is from edible fungus institute of academy of agricultural sciences of Shanghai city; 34. HK3161 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 32. l212 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 36. l868 strain, sourced from edible fungus institute of academy of agricultural sciences, Shanghai city; 37. the TW1121 strain was derived from edible fungus institute 38, L9102 strain of agricultural academy of sciences of Shanghai city, and was derived from technical research center of edible fungus science of Qingyuan county, Zhejiang province; 39. shenxiang No. 12 strain, originated from edible fungus institute of academy of agricultural sciences in Shanghai city; 40. j868 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city; 41. senyuan No. 10 strain, available from edible fungus of Yichangsen source, Limited liability company, Hubei province; 42. WD4204 strain, available from institute of edible fungi, academy of agricultural sciences, Shanghai city; 43. WD2140 strain from edible fungus institute of Shanghai institute of agricultural science; 44. 931 strain, sourced from edible fungus institute of academy of agricultural sciences of Shanghai city.

Wherein 7 pairs of InDel labeled primer sequences (2 '-3') are as follows:

lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA

Reverse primer: TGCCCCACTTACTCTCAACC

Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG

Reverse primer: GGGAGTGGGTTGTTTGGATA

Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG

Reverse primer: CGTACGGTTGGACATTTGAA

Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG

Reverse primer: GTCAACGGAGGGAAACAGAG

Lefp _ id002 forward primer: GTAGCACTCCTCATACAACC

Reverse primer: ACCAAATGTCACAGCACAGG

Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG

Reverse primer: CCCTTTTGCCCTATAAGGCG

Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC

Reverse primer: CATGATCAGATCACACAGCG are provided.

The primers were synthesized by Shanghai Bioengineering Co., Ltd.

Example 1

seventhly, adding pre-cooled isopropanol at 20 ℃ below zero relative to the volume of 2/3 parts of the supernatant in the step sixty into the centrifugal tube, uniformly mixing, standing and precipitating for 1h at 20 ℃ below zero, centrifuging for 10min at 8000rpm and 4 ℃, and removing the supernatant;

ninthly, abandoning the ethanol and drying in the ultra-clean workbench. Adding 100 μ L of 10 XTE buffer solution, gently tapping to dissolve the precipitate, adding 1 μ L of 10mg/mL RNaseA in water bath at 37 deg.C for 1h, and removing RNA;

storing the obtained DNA extract in refrigerator at-20 deg.C for use;

(3) detection of InDel molecular marker: carrying out PCR amplification of a whole genome InDel marker on the extracted DNA;

the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq^TM(1.22U/22 uL Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer)10uL InDel labeled forward primer and reverse primer each 1 uL, 2 uL ddH of template DNA extracted at the concentration of 20-30 ng/uL₂O 6μL；

(4) and (3) electrophoresis detection: spotting 7 microlitres of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.2 percent, the electrophoresis buffer solution is 1 xTAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is carried out for 2 hours, and the result is photographed and analyzed;

the mushroom strains are respectively subjected to PCR amplification by adopting 7 pairs of InDel labeled primers, the number and the relative molecular weight of the allelic fragments amplified by each InDel labeled primer can be determined by DNA molecular weight control D2000bp DNA ladder, and as shown in figure 1, the combination of the matched numbers is found as follows: 20121(1+2)2, namely the strain is the mushroom 16, the number 20 in the figures 2-8 is the mushroom 16, and the strip is consistent with that in the figure 1.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> InDel mark fingerprint spectrum of shiitake mushroom Shenxiang No. 16 strain and construction method thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acggatggag agacacagga 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgccccactt actctcaacc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cctttctcaa aagcggactg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gggagtgggt tgtttggata 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cggatgttat gcactggaag 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgtacggttg gacatttgaa 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcctttcac agtcagctcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtcaacggag ggaaacagag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtagcactcc tcatacaacc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

accaaatgtc acagcacagg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acattggcga aggctgtacg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cccttttgcc ctataaggcg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aacagtaacc tgtgcactgc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

catgatcaga tcacacagcg 20

Claims

1. A method for constructing an InDel marked fingerprint of mushroom Shenxiang No. 16 strain comprises the following steps:

(1) hypha culture: transferring the mycelium of Lentinus Edodes onto PDA plate, culturing at 22 deg.C in dark, and collecting mycelium after 10 days;

(2) extraction of genomic DNA: extracting genome DNA of the hyphae by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be 20-30 ng/uL; the CTAB method for extracting genome DNA of hyphae comprises the following steps:

fourthly, centrifuging at 12000rpm and 4 ℃ for 20min, and subpackaging the supernatant into two tubes of 800 mu L each;

sixthly, adding the mixture into the centrifugal tube according to the volume ratio of 24: 1, gently mixing the chloroform and isoamylol mixture for 10min, centrifuging at 12000rpm and 4 ℃ for 10min, and transferring the supernatant into another centrifuge tube;

storing the obtained DNA extract in refrigerator at-20 deg.C for use;

(3) detection of InDel molecular marker: performing PCR amplification of the InDel marker for developing the extracted DNA;

the PCR amplification system is as follows: total volume 20 μ L, including: premix Taq^TM(1.22U/22 uL Taq DNase, 0.4mM/L dNTP, 0.3mM/L PCR buffer)10uL of template DNA 2U L, ddH extracted at a concentration of 20-30 ng/uL, wherein the total volume of the forward primer and the reverse primer is 1 uL respectively through 10 umol/L InDel labeling₂O 6μL；

(4) and (3) electrophoresis detection: spotting 7 mu L of the product obtained by the PCR amplification on agarose gel added with nucleic acid dye for electrophoresis, wherein the volume percentage concentration of the agarose gel is 2.2 percent, the electrophoresis buffer solution is 1 × TAE, the voltage is 90v, the current is 300mA, the power is 100W, the electrophoresis is carried out for 2h, and the result is photographed and analyzed;

selecting 7 pairs of InDel marker primers to carry out PCR amplification on the mushroom strains, determining the number and relative molecular weight of allelic fragments amplified by each InDel marker primer by contrasting DNA molecular weight with D2000bp DNA ladder, and finding out a combination meeting the number: 20121(1+2)2, namely determining the strain as shiitake mushroom No. 16 strain;

wherein 7 pairs of InDel labeled primer sequences (2 '-3') are as follows:

lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA

Reverse primer: TGCCCCACTTACTCTCAACC

Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG

Reverse primer: GGGAGTGGGTTGTTTGGATA

Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG

Reverse primer: CGTACGGTTGGACATTTGAA

Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG

Reverse primer: GTCAACGGAGGGAAACAGAG

Lefp _ id002 forward primer: GTAGCACTCCTCATACAACC

Reverse primer: ACCAAATGTCACAGCACAGG

Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG

Reverse primer: CCCTTTTGCCCTATAAGGCG

Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC

Reverse primer: CATGATCAGATCACACAGCG are provided.

2. An InDel marker fingerprint of mushroom 16 bacterial is characterized in that the fingerprint consists of 7 pairs of InDel markers, and is an InDel marker primer developed based on an insertion/deletion fragment of a mushroom genome, and the 7 pairs of InDel marker primer sequences (2 '-3') are as follows:

lefp _ id001 forward primer: ACGGATGGAGAGACACAGGA

Reverse primer: TGCCCCACTTACTCTCAACC

Lefp _ id002 forward primer: CCTTTCTCAAAAGCGGACTG

Reverse primer: GGGAGTGGGTTGTTTGGATA

Lefp _ id003 forward primer: CGGATGTTATGCACTGGAAG

Reverse primer: CGTACGGTTGGACATTTGAA

Lefp _ id004 forward primer: AGCCTTTCACAGTCAGCTCG

Reverse primer: GTCAACGGAGGGAAACAGAG

Lefp _ id002 forward primer: GTAGCACTCCTCATACAACC

Reverse primer: ACCAAATGTCACAGCACAGG

Lefp _ id006 forward primer: ACATTGGCGAAGGCTGTACG

Reverse primer: CCCTTTTGCCCTATAAGGCG

Lefp _ id007 forward primer: AACAGTAACCTGTGCACTGC

Reverse primer: CATGATCAGATCACACAGCG are provided.

3. The application of the InDel marked fingerprint of mushroom Shenxiang No. 16 strain as claimed in claim 2, which is to utilize 7 pairs of InDel marked primers developed by insertion/deletion fragments of mushroom genome to perform InDel marked amplification on mushroom strain, and compare the obtained banding pattern with that of Shenxiang No. 16 strain, and if the banding pattern is consistent with that, the obtained banding pattern is mushroom Shenxiang No. 16 strain; the band type number combination of shiitake mushroom Shenxiang No. 16 strain is as follows: 20121(1+2)2.