CN112899350A

CN112899350A - Nucleic acid detection method and kit

Info

Publication number: CN112899350A
Application number: CN202110280770.6A
Authority: CN
Inventors: 梁振伟; 杜晋鲁; 王一凡; 蒲珏
Original assignee: Beijing Aikelun Medical Technology Co ltd
Current assignee: Beijing Aikelun Medical Technology Co ltd
Priority date: 2018-05-14
Filing date: 2018-05-14
Publication date: 2021-06-04
Anticipated expiration: 2038-05-14
Also published as: CN112941155A; CN112941155B; CN108588050B; CN108588050A; CN112899350B

Abstract

The invention provides a nucleic acid detection technology and a detection kit which combine rapid isothermal nucleic acid amplification with a Cas detection system. They can be used for detecting target nucleic acid in a sample under the condition of constant temperature, have the advantages of low cost, short detection time, simple and convenient operation, high specificity, high sensitivity and the like, and are particularly suitable for POCT application.

Description

Nucleic acid detection method and kit

The divisional application of the chinese patent application entitled "DNA polymerase and nucleic acid detection method and kit" filed on 5/14/2018, the text of which is incorporated herein by reference.

Technical Field

The invention relates to a nucleic acid detection technology, in particular to a nucleic acid detection technology combining isothermal nucleic acid amplification and Cas detection.

Background

The nucleic acid detection technology has great application value in molecular diagnosis, biochemical analysis and disease diagnosis, such as detection of nucleic acid of virus, bacteria and pathogen, detection of nucleic acid disease marker, etc. The PCR (polymerase chain reaction) technology is the most widely used nucleic acid detection technology at present. This technology was invented by dr, mullis in 1983 and is mainly divided into three basic steps, namely: denaturation, annealing and extension. The PCR technology needs to realize nucleic acid amplification by repeatedly increasing and decreasing temperature, has high requirements on instruments and operating environments, is precise and complex in instruments, is expensive, is complicated to operate, and needs professional technicians and laboratories, so the application range of the PCR technology has great limitations, for example, the application of the PCR technology in the fields of Point-of-care testing (POCT) and the like is limited. Therefore, isothermal nucleic acid amplification technologies represented by rpa (recombinant polymerase amplification), RAA (recombinant-aid amplification), LAMP (loop-mediated isothermal amplification) and the like are gaining more and more attention, but these technologies are not particularly high in specificity, are prone to non-specific amplification in the practical process, and interfere with the interpretation of results.

In addition, detection of RNA has long been dependent on reverse transcriptase, which requires that RNA be reverse transcribed to cDNA by reverse transcriptase followed by amplification of the DNA sequence (e.g., PCR, etc.). Gulati et al found that DNA polymerase I was able to reverse transcribe viral RNA on oligonucleotide oligo-dT. However, this reverse transcription system is sensitive to DNA polymerases: the RNA template ratio is high, and the reverse transcription amplification efficiency is not ideal (Proc. nat. Acad. Sci USA Vol.71, No.4, pp.1035-1039,1974).

Disclosure of Invention

In order to overcome the above problems, in one aspect, the present invention provides a DNA polymerase using DNA or RNA as a template, which is obtained by performing the following amino acid substitutions on Klenow large fragment of escherichia coli polymerase I: G198W, V222I, E306K, Q354E, a381E, and E582K.

In some embodiments, the DNA polymerase has the sequence as set forth in SEQ ID NO: 18, or a pharmaceutically acceptable salt thereof.

Accordingly, the present invention also provides a polynucleotide sequence encoding the DNA polymerase or a complementary sequence thereof.

In another aspect, the present invention provides a pair of DNA primers for isothermal amplification of nucleic acids, wherein either one or both primers of the pair of DNA primers has a stem-loop structure.

In some embodiments, the stem-loop structure is formed by adding 2 to 15 bases at the 5 ' end of a linear DNA primer complementary to a template sequence, the 2 to 15 bases being complementary to the 3 ' end sequence of the linear DNA primer or to a sequence 1 to 10 bases from the 3 ' end of the linear DNA primer.

In some embodiments, either or both of the DNA primer pairs are 33 to 45 bases in length; or a T7 promoter sequence is added to the 5' end of the linear primer, so that the length of either one or both of the DNA primer pair is 51-63 bases.

In another aspect, the invention provides a method of determining the level of a target nucleic acid in a sample, comprising:

1) isolating the target nucleic acid from the sample;

2) amplifying by using the separated target nucleic acid as a template and adopting a constant-temperature nucleic acid amplification technology to obtain a DNA amplification product; and

3) detecting the amount of the DNA amplification product with a Cas detection composition and correlating the amount of the DNA amplification product with the level of the target nucleic acid in the sample.

In some embodiments, the target nucleic acid is DNA or RNA.

In some embodiments, the isothermal nucleic acid amplification technique comprises the use of a DNA primer pair having a stem-loop structure.

In some embodiments, the isothermal nucleic acid amplification technique comprises using an amplification reaction system comprising a helicase, a recombinase, and a DNA polymerase.

In some embodiments, the helicase is selected from the group consisting of RecQ helicase, UvrD helicase, DnaB helicase, and CMC helicase; the recombinase is selected from a UvsX system of bacteriophage, a Rad system of eukaryote, a yeast or an Escherichia coli recA system; the DNA polymerase is selected from Deep VentRTM DNA polymerase, Deep VentRTM (exo-) DNA polymerase, Klenow fragment (3 '-5' exo-), DNA polymerase I, Klenow large fragment, phi29 DNA polymerase, DNA polymerase I, DNA,

DNA polymerase, VentR (exo-) DNA polymerase.

In a preferred embodiment, the DNA polymerase is obtained by performing the following amino acid substitutions on the Klenow large fragment of e.coli polymerase I: G198W, V222I, E306K, Q354E, a381E, and E582K.

In a preferred embodiment, the DNA polymerase has the sequence as set forth in SEQ ID NO: 18, or a pharmaceutically acceptable salt thereof.

In some embodiments, the Cas detection composition comprises a Cas12a or Cas13a protein.

In other embodiments, the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

In some embodiments, the target nucleic acid is derived from a virus or a bacterium.

In some embodiments, the virus or bacterium is selected from inf.a, inf.b, inf.c, HPV, strep.a, RSV, PTB, MP, CP, AdV, EV, BoV, and HRV.

In another aspect, the invention provides a kit for detecting a target nucleic acid in a sample, comprising a helicase, a recombinase and a DNA polymerase for performing isothermal nucleic acid amplification and a Cas detection composition for detecting DNA amplification products.

In some embodiments, the helicase is selected from the group consisting of RecQ helicase, UvrD helicase, DnaB helicase, and CMC helicase; the recombinase is selected from a phage UvsX system, a eukaryote Rad system, and a yeast or Escherichia coli recA system; the DNA polymerizationThe enzyme is selected from Deep VentRTM DNA polymerase, Deep VentRTM (exo-) DNA polymerase, Klenow fragment (3 '-5' exo-), DNA polymerase I, Klenow large fragment, phi29 DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III,

DNA polymerase, and VentR (exo-) DNA polymerase.

In some embodiments, the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

In some embodiments, the kit further comprises a pair of DNA primers for isothermal nucleic acid amplification, either or both of the pair of DNA primers having a stem-loop structure.

In some embodiments, the stem-loop structure is formed by adding 2 to 15 bases at the 5 ' end of a linear DNA primer complementary to the target nucleic acid, the 2 to 15 bases being complementary to the 3 ' end sequence of the linear DNA primer or to a sequence 1 to 10 bases from the 3 ' end of the linear DNA primer.

In some embodiments, the kit is for detection of influenza b virus, the DNA primer pairs having the sequences of SEQ ID NOs: 6 and 7 or the nucleotide sequences shown in SEQ ID NO: 9 and 10; or the kit is used for detecting HPV virus, and the DNA primer pairs respectively have the nucleotide sequences shown in SEQ ID NO: 14 and 15.

In some embodiments, the kit is for an assay for detecting influenza b virus, further comprising a nucleic acid sequence having SEQ ID NO: 8 or 11, or a crRNA of the nucleotide sequence shown in seq id no; or the kit is used for detecting HPV virus, and also comprises a nucleotide sequence with SEQ ID NO: 16.

The DNA polymerase, the stem-loop structure primer, the method for detecting nucleic acid and the kit provided by the invention can be used for detecting the target nucleic acid in a sample under the constant temperature condition, have the advantages of low cost, short detection time, simple and convenient operation, high specificity, high sensitivity and the like, and are particularly suitable for POCT application.

Drawings

FIG. 1 is a schematic diagram of the RINA-CAS technology of the present invention

FIG. 2 is a graph showing comparison results of isothermal nucleic acid amplification of the engineered Klenow large fragment (MT-Klenow) and the wild-type Klenow large fragment (WT-Klenow) of the present invention. Wherein the content of the first and second substances,

shows the fluorescence curve amplified using MT-Klenow,

shows the fluorescence curve amplified by WT-Klenow.

FIG. 3 is a graph showing the results of comparison between a conventional linear primer and a stem-loop structure primer of the present invention for isothermal nucleic acid amplification. Wherein

Three groups of parallel fluorescence curves of the stem-loop structure primer are shown,

respectively correspond to

The negative control of (1) is,

three sets of parallel fluorescence curves representing common linear primers,

respectively correspond to

Negative control (3).

FIG. 4 is a graph showing the results of detection of an Influenza B sample by using a detection composition with LwCas13a as a detection protein. Wherein

Three sets of parallel fluorescence curves representing the detection of the Influenza B sample,

are respectively corresponding to

Negative control (3).

FIG. 5 is a graph showing the results of detection of an Influenza B sample by using a detection composition with LbCas12a as a detection protein. Wherein

are respectively corresponding to

Negative control (3).

FIG. 6 is a graph showing the results of detection of Influenza B samples by fluorescent quantitative PCR. Wherein

are respectively corresponding to

Negative control (3).

FIG. 7 is a diagram showing the detection result of HPV sample by using a detection composition with LwCas13a as a detection protein. Wherein

Three sets of parallel fluorescence curves representing detection of HPV samples,

are respectively corresponding to

Negative control (3).

Detailed Description

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, molecular biology, genetic engineering, and the like, as used herein, are generally conventional biological techniques well known to those skilled in the art. Unless otherwise indicated, the test materials used in the present invention are commercially available from general Biochemical Agents.

As used herein, the term "Klenow large fragment" refers to a C-terminal 605 amino acid residue fragment produced by the partial hydrolysis of E.coli DNA polymerase I by trypsin or subtilisin. This fragment retained the 5 '-3' polymerase activity and 3 '-5' exonuclease activity of DNA polymerase I, but lacked the 5 '-3' exonuclease activity of the intact enzyme. In addition, as described above, the Klenow large fragment also has a weak RNA-dependent DNA polymerase activity.

As used herein, the terms "isothermal nucleic acid amplification" or "isothermal nucleic acid amplification technique" are used interchangeably to refer to a nucleic acid amplification process that is performed under isothermal conditions. That is, there is no need to repeat thermal denaturation during amplification, unlike conventional PCR techniques. Isothermal nucleic acid amplification techniques have been under development for more than 20 years, and have emerged as a subdivision technique using different amplification principles, such as loop-mediated isothermal amplification (LAMP), Strand Displacement Amplification (SDA), Rolling Circle Amplification (RCA), helicase-dependent isothermal DNA amplification (HDA), Recombinase Polymerase Amplification (RPA), recombinase-induced amplification (RAA), and so on. Since these isothermal amplification methods do not require repeated thermal denaturation, the amplification rate is much faster than the PCR amplification reaction, usually completed within 30 minutes, even within 15 minutes, and they are also referred to herein as rapid isothermal nucleic acid amplification (RINA).

As used herein, the terms "stem-loop structure" or "hairpin structure" as used in reference to a DNA primer are used interchangeably to mean that the DNA primer itself forms a secondary mechanism by base pairing of the 5 'end base to the 3' end base. The double-stranded portion formed by base pairing is a "stem", and the sequence between the paired bases forms a "loop". In some cases, the stem may not be a flat end, e.g., having a3 'protruding end or a 5' protruding end, and may be referred to as a stem-loop structure with a foothold. The number of bases paired within the stem-loop structure is typically 2 to 15 bases, e.g., 5, 6, 7, 8, 10, 12 bases, etc. The "loop" is usually formed of tens to tens of bases.

As used herein, the term "Cas detection system" or "Cas detection composition" refers to a system for nucleic acid detection using CRISPR (clustered regularly interspaced short palindromic repeats) associated proteins (Cas) of bacteria. The CRISPR system is a bacterial immune system that has been found to be present in most bacteria and is used to recognize and destroy phage and other pathogen invasion. CRISPR is a unique DNA region in the bacterial genome that stores viral DNA fragments, allowing bacterial cells to recognize viruses that attempt to re-infect it. The short RNA sequence (referred to as crRNA) generated after transcription of the CRISPR region sequence, upon recognition and binding of the viral nucleic acid, results in cleavage of the viral nucleic acid by a Cas protein (or referred to as Cas enzyme) bound to the crRNA. Various CRISPR/Cas systems have been discovered so far, such as CRISPR/Cas9, CRISPR/Cas13a, CRISPR/Cas12a, and the like. Unlike Cas9, Cas13a and Cas12a have respective nuclease activities upon activation, in addition to being able to cleave a target nucleic acid, they also have a nicking (catalytic cleavage) activity, being able to continue to cleave nearby other non-target single-stranded DNA (Cas12a) or RNA (Cas13 a). These features can be used for the detection of target nucleic acids in a sample. For example, to detect the level of a target nucleic acid in a sample, crRNA that specifically binds to the target nucleic acid sequence, as well as short RNA or DNA reporter molecules with a fluorophore and a quencher can be designed, and this additional cleavage activity of Cas13a or Cas12a is used to effect cleavage of the reporter nucleic acid sequence, resulting in a fluorescent signal. Finally, the level of the target nucleic acid in the sample is reflected by detecting the intensity or time-dependent change of this fluorescent signal. Such a system is referred to herein as a "Cas detection system". Of course, Cas detection systems are not limited to Cas13a or Cas12a, and other proteins with enzymatic activity similar to Cas13a or Cas12a may also be employed to achieve such detection.

As used herein, the term "reporter" refers to a short single-stranded DNA or single-stranded RNA molecule, e.g., 6 to 20 bases in length, with a fluorophore (e.g., FAM, HEX, cy3, JOE, or ROX) attached to the 5 'end and a quencher (e.g., BHQ2, BHQ3, etc.) attached to the 3' end. In the complete reporter molecule, a fluorescent group is close to a quenching group in space, and the quenching group inhibits the generation of a fluorescent signal caused by the irradiation of excitation light; in the case where Cas13a or Cas12a cleaves single-stranded DNA or single-stranded RNA in a reporter molecule, the fluorescent group is separated from the quencher group, and generation of a fluorescent signal can be detected under irradiation of excitation light.

Modification of Klenow Large fragment

The Klenow large fragment is the remainder of the DNA polymerase I deletion 5 '-3' exonuclease domain, comprising 605 amino acid residues, the amino acid sequence being: VISYDNYVTILDEETLKAWIAKLEKAPVFAFDTETDSLDNISANLVGLSFAIEPGVAAYIPVAHDYLDAPDQISRERALELLKPLLEDEKALKVGQNLKYDRGILANYGIELRGIAFDTMLESYILNSVAGRHDMDSLAERWLKHKTITFEEIAGKGKNQLTFNQIALEEAGRYAAEDADVTLQLHLKMWPDLQKHKGPLNVFENIEMPLVPVLSRIERNGVKIDPKVLHNHSEELTLRLAELEKKAHEIAGEEFNLSSTKQLQTILFEKQGIKPLKKTPGGAPSTSEEVLEELALDYPLPKVILEYRGLAKLKSTYTDKLPLMINPKTGRVHTSYHQAVTATGRLSSTDPNLQNIPVRNEEGRRIRQAFIAPEDYVIVSADYSQIELRIMAHLSRDKGLLTAFAEGKDIHRATAAEVFGLPLETVTSEQRRSAKAINFGLIYGMSAFGLARQLNIPRKEAQKYMDLYFERYPGVLEYMERTRAQAKEQGYVETLDGRRLYLPDIKSSNGARRAAAERAAINAPMQGTAADIIKRAMIAVDAWLQAEQPRVRMIMQVHDELVFEVHKDDVDAVAKQIHQLMENCTRLDVPLLVEVGSGENWDQAH (SEQ ID NO: 17). Structurally, the P61-Q194 domain of Klenow large fragment has 3 '-5' exonuclease proofreading activity, and the L422-D570 domain is a polymerase domain. It has a DNA-dependent DNA polymerase activity and a weak RNA-dependent DNA polymerase activity (i.e., reverse transcription activity).

To improve the activity, especially the reverse transcription activity, the Klenow large fragment was engineered to replace a portion of the amino acids with site-directed mutagenesis (site-directed mutagenesis). Based on structural biological data (PDB:1KFD _ A), and through multiple experiments, we designed and introduced the following six amino acid residue substitutions: G198W, V222I, E306K, Q354E, a381E and E582K. The sequence of the engineered Klenow large fragment is:

the amino acids are represented here by the one-letter symbols recommended by the IUPAC-IUB Commission on Biochemical nomenclature, for example, where G represents glycine, W represents tryptophan, V represents valine, I represents isoleucine, E represents glutamic acid, K represents lysine, Q represents glutamine, and A represents alanine. G198W shows the substitution of glycine 198 to tryptophan in this Klenow large fragment, and so on. The amino acids used for substitution in the above sequences are shown in underlined bold. These 6 amino acid residue changes enhance the activity of the Klenow large fragment in reverse transcription and subsequent isothermal amplification reactions (see example 1 below). It is expected that one skilled in the art may also substitute other amino acids on the basis of the engineered Klenow large fragment provided herein (referred to as the DNA polymerase of the invention) that do not result in loss of its DNA polymer activity (including reverse transcription activity), such as silent substitutions, and such substitutions are included within the scope of the polymerase of the invention.

Accordingly, the present invention also provides a polynucleotide sequence encoding the DNA polymerase of the present invention. The polynucleotide sequence can be obtained, for example, by isolating and amplifying a nucleotide sequence encoding Klenow large fragment from E.coli genome, and introducing a nucleotide substitution mutation at a specific site upon amplification. Alternatively, the coding nucleotide sequence may be designed based on the correspondence between amino acids and trinucleotide codons based on the amino acid sequence of the polymerase of the present invention provided herein (SEQ ID NO: 18), and then obtained by chemical synthesis or the like. These procedures are conventional in the art and are well known to the skilled artisan. It is noted that, based on codon degeneracy, a plurality of polynucleotide sequences encoding the DNA polymerase of the present invention may be present, and all of them are intended to be included in the scope of the present invention.

Primer for isothermal amplification of nucleic acid

In order to improve the specificity of the nucleic acid isothermal amplification technology, the invention provides an amplification primer with a hairpin structure (or stem-loop structure). These hairpin structures will only open when the amplification primers are actually and effectively bound to the target sequence of interest; meanwhile, the hairpin structure in the amplification primer molecule also effectively avoids the occurrence of mismatching between the amplification primers and prevents the generation of false positive results, thereby effectively solving the problem of poor specificity in the constant temperature amplification technology. This is in contrast to conventional PCR primers, which generally require that the primers themselves do not have complementary sequences of more than 4 contiguous bases.

The 3' end of the stem-loop structure primer of the invention is completely identical or completely complementary to the nucleic acid target sequence; additionally adding 2-15nt of basic groups at the 5 'end of the primer, and complementing the basic groups with the 3' end of the primer to form a stem-loop structure; or adding 2-15nt of base at the 5 'end, and forming a stem-loop structure with a foothold by complementing the base 1-10nt away from the 3' end.

For example, a pair of conventional linear primers (i.e., that can be completely complementary or identical to a partially contiguous sequence of the target nucleic acid) can be designed based on the target nucleic acid sequence, with a preferred primer length of 30-35nt, a GC content of 40% -60%, and no or only simple secondary structure within or between the primers, avoiding the 3' end of the primer being complementary to itself or another primer. Subsequently, 2-15nt of bases, preferably 6-8nt, are added to the 5 ' end of the designed linear primer, the added bases are complementary to the 3 ' end of the primer or to several bases 1-10nt after the 3 ' end of the primer, and the structure thereof and the Tm value of the stem-loop structure primer are determined by software simulation. Secondary structure modeling assays can be performed using NUPACK (http:// www.nupack.org/partition/new) and stem-loop primer Tm values can be determined using Quikfold (http:// unaffold. rna. albany. edu/. The optimal state of the stem-loop structure primer is a single stable state and the optimal value of Tm of the stem-loop structure primer is higher than the reaction temperature (the reaction temperature is less than or equal to 65 ℃, for example, 25 ℃). When the optimal Tm value of the stem-loop structure primer is incompatible with the optimal state, the optimal Tm value can be comprehensively considered, for example, when the Tm value of the stem-loop structure primer is designed to be optimal, the Tm value can be selected to be optimal when the stem-loop structure primer is single but the loop part has a simple secondary structure; when the Tm value of the stem-loop structure primer is designed to be optimal, and the stem-loop structure primer is not single or/and the loop part has a complex secondary structure, the state of the stem-loop structure primer is mainly considered, and the uniqueness and the stability of the stem-loop structure primer are ensured.

Rapid isothermal nucleic acid amplification and Cas detection system combined for nucleic acid detection

As described above, Cas detection systems can be used to detect a target nucleic acid sequence in a sample. However, its sensitivity is often difficult to meet the detection requirements. For example, at low levels of target nucleic acid sequence, e.g., several to several hundred copies, an effective fluorescent signal cannot be generated. In addition, although DNA binding dyes such as EvaGreen and SybrGreen, or PNA Opener, DNA Beacon and PNA Beacon can be used for monitoring the amplification product condition in the isothermal amplification process in real time to reflect the level of the target nucleic acid in the sample, the specificity often cannot meet the requirement. The nucleic acid detection technology (also called RINA-CAS technology) which combines rapid isothermal nucleic acid amplification and a Cas detection system can improve the sensitivity, such as the detection of target nucleic acid molecules with a number of copies or even 1 copy, on one hand, and improve the specificity of detection by combining primer matching in the isothermal amplification process and crRNA matching in the detection process on the other hand.

FIG. 1 shows a schematic representation of the RINA-CAS technology of the present invention. In the presence of forward and reverse primers of the stem-loop structure, amplification product DNA was obtained by isothermal nucleic acid amplification for approximately 15 minutes. For detection systems employing Cas13a, the amplification product DNA is first transcribed into single-stranded rna (ssrna). crRNA bound to Cas13a activates the attendant cleavage activity of Cas13a (single-stranded RNA nuclease activity) by recognizing and binding to a complementary sequence on the single-stranded RNA, resulting in cleavage of the RNA fluorescent reporter, releasing a fluorescent signal. For detection systems employing Cas12a, the attendant cleavage activity of Cas12a (single-stranded DNA nuclease activity) is activated by recognition of crRNA bound to Cas12a and binding to a complementary sequence on the amplification product DNA, resulting in cleavage of the DNA single-stranded fluorescent reporter, releasing a fluorescent signal. The fluorescent signal may be detected by a fluorescence detector.

The invention improves the existing rapid isothermal nucleic acid amplification technology, adopts helicase, recombinase and DNA polymerase during isothermal amplification, can improve the amplification efficiency and specificity, and completes the amplification process within 3 to 20 minutes at 25 to 45 ℃ (such as 37 ℃). The helicase used may be selected, for example, from RecQ helicase, UvrD helicase, DnaB helicase, CMC helicase or other similar helicases; the recombinase may for example be selected from the group consisting of recombinases in the UvsX system of bacteriophages, the Rad system of eukaryotes, the recA system of yeasts or E.coli or other prokaryotic systems; the DNA polymerase may be selected from, for example, Deep VentRTM DNA polymerase, Deep VentRTM (exo-) DNA polymerase, Klenow fragment (3 '-5' exo-), DNA polymerase I, Klenow large fragment, phi29 DNA polymerase, DNA polymerase I, DNA polymerase,

DNA polymerase, VentR (exo-) DNA polymerase or other similar polymerases.

In the presence of the amplification primer, the recombinase forms a protein-DNA complex with the amplification primer, which enables finding a homologous sequence on the target nucleic acid; helicase helps to unwind the DNA double strand, forming a stable D-ring structure; and simultaneously, the DNA single-strand binding protein (SBB) stabilizes the dissociated DNA single strand. The amplification primer is combined with the complementary sequence of the target nucleic acid through the combined action of a recombinase and a helicase, and is subjected to polymerization extension under the action of DNA polymerase, and the reactions are continuously repeated under the isothermal condition of 25-45 ℃, for example, within 3-20 minutes, so that the exponential amplification of the nucleic acid is completed.

In some embodiments, the components of the amplification system used in the rapid isothermal nucleic acid amplification of the present invention can be found in table 1 below.

TABLE 1 Components of Rapid isothermal nucleic acid amplification System

The pH of the Tris-HCl buffer solution is 7.0-8.5, preferably 7.4. The molecular weight of the polyethylene glycol is in the range of 1000-50000, preferably 20000. Dithiothreitol is used to maintain the reducibility of the individual protein components.

In some embodiments, the recombinase may employ the combination of the UvsX enzyme and the helper protein UvsY, which are proteins from T4 or T6 phages that mediate template strand melting and strand displacement between the template strand and the primer strand upon initiation of the reaction. This process requires ATP to provide energy. After melting and strand displacement, a single-stranded binding protein (e.g., Gp32) can bind to a single strand therein, preventing double-strand formation.

ATP can be regenerated by phosphocreatine, and creatine kinase can realize regeneration and recycling of phosphocreatine.

In a preferred embodiment, the DNA polymerase used is Klenow large fragment, which has strand displacement activity and is capable of specific extension following strand displacement of the amplification primers with the template strand, thereby effecting amplification of the target fragment. In a more preferred embodiment, the DNA polymerase used is the DNA polymerase of the invention, i.e.the engineered Klenow large fragment described above. The DNA polymerase of the present invention can amplify not only single-stranded or double-stranded DNA molecules but also RNA molecules as a template. In amplification using an RNA molecule as a template, a cDNA molecule that can serve as a template is first synthesized using the reverse transcription activity of the DNA of the present invention, and then a subsequent amplification reaction is performed using the cDNA molecule as a template. When the DNA polymerase of the present invention is used to amplify target RNA, no additional reverse transcriptase is required for reverse transcription operation, which greatly simplifies the amplification process.

In a preferred embodiment, the upstream and downstream primers used are those provided by the present invention having a stem-loop structure. The length of the primer is generally 33nt-45nt to ensure the sequence recognition specificity in the process of recombinase strand replacement, and the number of the adopted primers can be increased along with the increase of the number of the target nucleic acid sequences to be detected. In addition, when the Cas13a detection system is used, a T7 promoter sequence TAATACGACTCACTATAG (SEQ ID NO: 22) can be introduced at the 5' end of the forward amplification primer for subsequent transcription of the DNA amplification product and protease cleavage detection of Cas13 a. Thus, the primer comprises a sequence which is matched with the template, a T7 promoter sequence and a 5 'end sequence for forming a stem-loop structure with the 3' end in sequence from the 5 'end to the 3' end, and the total length is about 51-63 nt.

The dNTPs used include: dATP, dTTP, dCTP, dGTP, dUTP, where dTTP may or may not be present, and the use of dUTP facilitates or greatly eliminates the contamination problem by the UNG enzyme.

In addition, the amplification system can be further optimized by additives such as DMSO, PEG, DTT, Betaine, Proline, Formamide, BSA and the like.

The DNA amplification product resulting from the rapid isothermal nucleic acid amplification step can be detected by a detection system comprising Cas12a or a detection system comprising Cas13 a.

The crRNA used in these detection systems comprises two structural sequences: a sequence that binds to a CRISPR-Cas12a/Cas13a protein and a sequence that complementarily pairs with a target nucleic acid. The length of the sequence complementary-paired with the target nucleic acid is 24nt-30nt, which can further increase the specificity and sensitivity of detection.

In the Cas12a assay system, the Cas12a-RNP complex formed by crRNA and Cas12a protein specifically recognizes and cleaves a target DNA fragment (e.g., DNA amplification product), and simultaneously activates ssDNase activity of Cas12a protein, so that a DNA reporter (reporter) is degraded. The DNA reporter molecule is an oligonucleotide ssDNA fragment with a fluorescent group at the 5 'end and a quenching group at the 3' end. Finally, the fluorescent group is separated from the quenching group, and under the irradiation of exciting light, a fluorescent signal is generated and read by an instrument.

In some embodiments, the Cas12a detection system used in the present invention includes components as shown in table 2.

TABLE 2 Cas12a detection System Components

In the Cas13a detection system, firstly, amplification product DNA containing a T7 promoter sequence is transcribed into RNA by T7 RNA polymerase, and then the transcribed RNA is specifically recognized and cleaved by a Cas13a-RNP complex formed by crRNA and Cas13a protein, so that the RNA nuclease activity of Cas13a protein is activated, so that the RNA reporter molecule is degraded and emits a fluorescent signal. The RNA reporter molecule is an oligonucleotide RNA chain with a fluorescent group at the 5 'end and a quenching group at the 3' end.

Specifically, the detection may include, for example, the following processes: (1) transcribing the DNA amplification product carrying the T7 promoter sequence into a target RNA strand by T7 RNA polymerase; (2) allowing the Cas13a protein to bind to the crRNA to form a Cas13a-RNP complex, and specifically targeting the transcribed target RNA under the guidance of the crRNA; (3) forming a target RNA-Cas13a-crRNA complex, thereby causing a conformational change in the Cas13a protein, activating its non-specific RNA nuclease activity; (4) the nonspecific RNA nuclease activity of the Cas13a protein can be used for enzyme digestion of a fluorogenic substrate RNA reporter molecule, so that a fluorescent group and a quenching group are separated, a fluorescent signal is generated under the irradiation of exciting light, and the fluorescent signal is detected and analyzed by an instrument. Although the detection process is described in a stepwise manner, they may be carried out in the same reaction system in practice.

In some embodiments, the Cas13a detection system used in the present invention includes the components shown in table 3 below.

TABLE 3 Cas13a detection System Components

The pH of the Tris buffer in the detection system is preferably 7.4.

In some embodiments, another CRISPR-Cas protein Csm6 and its activator precursor (ruururus ururus rarurra rarra- (2, 3-cyclic phosphate)) can be added into the system, when Cas13a is activated, the precursor can be cleaved to generate the activator of Csm6, the RNase activity of Csm6 is activated, and the RNA reporter molecule can be hydrolyzed, thereby effectively improving the sensitivity of the CRISPR-Cas13a detection system. Thus, in some embodiments, the CRISPR-Cas13a assay system can be modified by the addition of a final concentration of 10nM of the Csm6 protein and 500nM of the Csm6 activator precursor.

The RINA-CAS technology of the present invention allows amplification and detection of a target nucleic acid in a single reaction system, and allows qualitative and quantitative analysis of amplicons (i.e., DNA amplification products).

Detection kit

The detection kit provided by the present invention can be used in the RINA-CAS technology of the present invention described above. The kit may include the main reagents for this technique, such as enzymes for performing isothermal nucleic acid amplification reactions and enzymes for detecting the amplification products. Enzymes for performing isothermal nucleic acid amplification reactions mainly include helicases, recombinases, and DNA polymerases. In a preferred embodiment, the polymerase is a DNA polymerase provided by the present invention. Enzymes that detect amplification products include, for example, Cas12a and/or Cas13 a. For specific bacterial or viral detection, the kits of the invention may further comprise primers for performing an isothermal nucleic acid amplification reaction and crRNA for use in conjunction with Cas12a and/or Cas13 a. In addition, components for performing isothermal nucleic acid amplification reactions and components for detecting amplification products, all or part of which may be included in the detection kit of the present invention, are listed in tabular form at various places herein.

The RINA-CAS technology provided by the invention can complete the reaction at 37 ℃ or even room temperature, only needs a small constant temperature and fluorescence signal detection device, does not need to use a precise and expensive PCR thermal cycler, and is very suitable for instant test (POCT) application.

The present invention will be explained in more detail with reference to specific examples, so that the objects, technical solutions and effects of the present invention will be more apparent. The following examples are given by way of illustration only and are not intended to limit the scope of the invention in any way.

Example 1 Activity of DNA polymerase and ProKlenow Large fragment of the invention

This example compares the activity of the engineered (i.e., introduced amino acid substitutions described herein) Klenow large fragment (MT-Klenow) with the wild-type Klenow large fragment (WT-Klenow). Isothermal nucleic acid amplification was performed using MT-Klenow and WT-Klenow under the same conditions using the same RNA template and primers. The RNA template sequence used was:

CAGGGAGGUGCCUUGAUGACAUAGAAGAAGAACCAGAUGAUGUUGAUGGCCCAACUGAAAUAGUAUUAAGGGACAUGAACAACAAAGAUGCAAGGCAAAAGAUAAAGGAGGAAGUAAACACUCAGAAAGAAGGGAAGUUCCGUUUGACAAUAAAAAGGGAUAUGCGUAAUGUAUUGUCCCUGAGAGUGUUAGUAAACGGAACAUUCCUCAAACACCCCAAUGGAUACAAGUCCUUAUCAACUCUGCAUAGAUUGAAUGCAUAUGACCAGAGUGGAAGGCUUGUUGCUAAACUUGUUGCUACUGAUGAGCUUACAGUGGAGGAUGAAGAAGAUGGCCAUCGGAUCCUCAAUUCACUCUUCGAGCGUCUUA(SEQ ID NO：19)；

the forward primer sequence was CAGGGAGGTGCCTTGATGACATAGAAGAAGAACCA (SEQ ID NO: 20);

the reverse primer sequence was TAAGACGCTCGAAGAGTGAATTGAGGATCCGATG (SEQ ID NO: 21).

The volume of the reaction system used was 50. mu.L, and the components therein are shown in Table 4 below.

TABLE 4 isothermal nucleic acid amplification reaction System Components for comparative WT-Klenow and MT-Klenow Activity assays

The amplification process was monitored by the fluorescent dye molecule Eva Green, and the results are shown in FIG. 2, which is a graph

Shows the fluorescence curve amplified using MT-Klenow,

shows the fluorescence curve amplified by WT-Klenow. As can be seen from FIG. 2, MT-Klenow modified by the present invention has better reverse transcription and amplification efficiency than WT-Klenow.

Example 2: comparison test of stem-loop structure primer and linear primer

The 3' end of the stem-loop structure primer is completely identical or completely complementary with a nucleic acid target sequence; base groups of 2-15nt are additionally added at the 5 'end of the primer, and are complementary with the 3' end of the primer to form a stem-loop structure; or the base with 2-15nt is added specially at the 5 'end and is complementary with the base with 1-10nt away from the 3' end to form a stem-loop structure with a foothold.

According to the design principle of the stem-loop structure primers, the invention carries out experimental comparison on the isothermal amplification reaction of a pair of common linear primers and the stem-loop structure primers thereof. Wherein the DNA template sequence is: 5'-GACAGACTGCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAGACGGGA-3' (SEQ ID NO: 1), and the common linear primers are: BRAF-F (sequence: 5'-CGCCAAGTCAATCATCCACAGAGACCTCAAGAG-3' (SEQ ID NO: 2)), BRAF-R (sequence: 5'-CCAAATGCATATACATCTGACTGAAAGCTGTATGG-3' (SEQ ID NO: 3)); the stem-loop structure primer is as follows: JH-BRAF-F (sequence: 5-CTCTTGAGCGCCAAGTCAATCATCCACAGAGACCTCAAGAG-3' (SEQ ID NO: 4)), JH-BRAF-R (sequence: 5' -CCATACACCAAATGCATATACATCTGACTGAAAGCTGTATGG-3' (SEQ ID NO: 5)). Bases for pairing which are additionally added to the 5' end in the stem-loop structure primer here and below are underlined with solid lines. The volume of the amplification reaction system was 50. mu.L, and the components used were as shown in Table 5 below.

TABLE 5 isothermal nucleic acid amplification reaction System Components for primer comparison experiments

The whole experimental process was repeated three times, the amplification process was monitored by the fluorescent dye molecule, Eva Green, and the experimental results are shown in FIG. 3. In the drawings

are respectively corresponding to

The negative control of (1) is,

three sets of parallel fluorescence curves representing common linear primers,

respectively correspond to

Negative control (3). As can be seen from the results, the stem-loop structure primer of the present invention can significantly reduce non-specific amplification.

Example 3 detection of Influenza B virus (Influenza B) containing samples Using the RINA-CAS (Using LwCas13a) technique

First, a nucleic acid extraction was performed on an Influenza B (Influenza B virus yamagata subtype) sample, and the nucleic acid extraction Kit was a Qiagen virus RNA extraction Kit (QIAamp Viral RNA Mini Kit). Samples without Influenza B were used as negative controls.

Adding 1 μ L of the extracted RNA into a nucleic acid amplification reaction system, and adding the RNA to a concentration of 10^-5M two amplification primers Influenza Primer F (sequence: 5-ACCAACTTAATACGACTCACTATAGGTGAAACTGCGGTGGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 6)), Influenza Primer R (sequence: 5' -TGGTTGTCACAAGCACTGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 7)) 2.4. mu.L each, and incubated at 37 ℃ for 15 min. The designed primer is a conserved gene Influenza B NS1 aiming at the yamagata subtype of the Influenza B virus. TheThe volume of the amplification reaction system was 50. mu.L, and the components are shown in Table 6 below.

TABLE 6 isothermal amplification System composition for amplification of Influenza B samples

Subsequently, 4. mu.L of the amplification product was removed, and 20. mu.L of a detection solution containing LwCas13a (containing LwCas13a-crRNA having the sequence:

wavy underlined sequence for binding to LwCas13a, dashed underlined sequence for binding to amplification product) and RNA reporter (FAM-5 '-UUUUUUU-3' -TAMAR) 1. mu.L were mixed and incubated at 37 ℃ for 30 min. The total volume of the assay system was 25. mu.L, and the components are shown in Table 7 below.

Table 7 composition of detection system for detecting amplification product by using LwCas13a

The entire experimental procedure was performed in triplicate and the results are shown in figure 4. In the drawings

Three sets of parallel fluorescence curves representing the detection of actual samples of Influenza B,

are respectively corresponding to

Negative control (3). As can be seen from FIG. 4, the RINA-CAS technology of the present invention can successfully detect Influenza B samples by first performing isothermal amplification of the samples and then performing detection using a detection system containing LwCas13 a.

Example 4: detection of Influenza B virus (Influenza B) containing samples Using the RINA-CAS (LbCas 12a) technique

First, a nucleic acid extraction was performed on an Influenza B (Influenza B virus yamagata subtype) sample, and the nucleic acid extraction Kit was a Qiagen virus RNA extraction Kit (QIAamp Viral RNA Mini Kit). Samples without Influenza B were also used as negative controls.

Adding 1 mu L of the extracted RNA of the Influenza B into a constant-temperature amplification reaction system, and adding the RNA with the concentration of 10^-5M two amplification primers Influenza Primer F (sequence: 5-ACCAACTGAAACTGCGGTGGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 9)), Influnza Primer R (sequence: 5' -TGGTTGTCACAAGCACTGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 10)) 2.4. mu.L each, and incubated at 37 ℃ for 15 min. The volume of the amplification reaction system was 50. mu.L, and the reaction components are shown in Table 8 below.

TABLE 8 isothermal amplification System composition for amplification of Influenza B samples

Subsequently, 4. mu.L of the amplification product was removed, and 20. mu.L of a detection solution containing LbCas12a (wherein the LbCas12acrRNA sequence contained therein is:

the waved underlined sequence was used to bind to LbCas12a, with the dotted line belowUnderlined sequence for binding to the amplification product) and 1. mu.L of DNA reporter (FAM-5 '-TTTTT-3' -TAMAR) were incubated at 37 ℃ for 15 min. The total volume of the assay system was 25. mu.L, and the components are shown in Table 9 below.

TABLE 9 detection System composition for detection of amplification product by LbCas12a

The whole experimental process was performed in triplicate and the results are shown in figure 5. In the drawings

are respectively corresponding to

Negative control (3).

As can be seen from FIG. 5, the RINA-CAS technology of the present invention can successfully detect Influenza B samples by first performing isothermal amplification of the samples and then performing detection using a detection system containing LwCas13 a.

Example 5: detection of the same Influenza B sample by fluorescent quantitative PCR

The RNA extracted by the RNA extraction Kit (QIAamp Viral RNA Mini Kit) in example 3 was subjected to PCR amplification as a template to verify the presence of influenza B virus therein. The two PCR amplification primers are respectively: PCR-F (sequence: 5'-GGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 12)), and PCR-R (sequence: 5'-TGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 13)). The PCR reaction system and procedure were as follows:

reverse transcription reaction system

PCR reaction system

PCR reaction procedure

Fluorescence signals were collected at the end of each cycle. The experiment was repeated three times, using a sample without infilenza B as a negative control. The reaction results are shown in fig. 6. Wherein

are respectively corresponding to

Negative control (3). As can be seen from the figure, the samples used had influenza B virus present, consistent with the results obtained with the RINA-CAS technique used in example 3.

Example 6: detection of HPV samples Using the RINA-CAS (with LwCas13a) technique

Firstly, nucleic acid extraction is carried out on an HPV sample, and the nucleic acid extraction kit is a Tiangen rapid DNA extraction detection kit (purchased from Tiangen Biochemical technology (Beijing) Co., Ltd.). Samples without HPV were also used as negative controls.

Adding 1 μ L of extracted HPV DNA into the reaction system, and adding 10% concentration^-5Two amplification primers of M HPV Primer F (sequence: 5-ACAGTAATACGACTCACTATAGGTTTGTTGGGGTAACCAACTATTTGTTACTGT-3' (SEQ ID NO: 14)), HPV Primer R (sequence: 5'-ACTGTGACGTCTGCAGTTAAGGTTATTTTGCACAGT-3' (SEQ ID NO: 15)) 2.4. mu.L each, and incubated at 37 ℃ for 15 min. The isothermal amplification system had a volume of 50. mu.L, and the components are shown in Table 10 below.

TABLE 10 isothermal amplification System composition for amplification with HPV samples

Subsequently, 4. mu.L of the amplification product was removed and mixed with 20. mu.L of a detection solution containing LwCas13a (containing LwCas13a-crRNA having the sequence:

wavy underlined sequence for binding to LwCas13a, dashed underlined sequence for binding to amplification product) and RNA reporter (FAM-5 '-UUUUUUU-3' -TAMAR) 1. mu.L were mixed and incubated at 37 ℃ for 30 min. The total volume of the assay system was 25. mu.L, and the components are shown in Table 11 below.

TABLE 11 detection System composition for detection of amplification product by LbCas13a

The whole experimental process was performed in triplicate and the results are shown in figure 7. In the drawings

are respectively corresponding to

Negative control (3).

As can be seen from FIG. 7, the RINA-CAS technology of the present invention can successfully detect HPV samples by first performing isothermal amplification of the samples and then performing detection using a detection system containing LwCas13 a.

Example 7: sensitivity of RINA-CAS technology of the invention to various virus/bacteria samples

Plasmid/genomic standards for various viral/bacterial detection targets were diluted in a gradient of about 10⁵Copy/. mu.L, 10⁴Copy/. mu.L, 10³Copy/. mu.L, 10²Copy/. mu.L, 10¹Copy/. mu.L, 10⁰Copies/. mu.L.

The diluted templates were subjected to isothermal nucleic acid amplification at 37 ℃ for 15min, and the results were compared with negative controls and used as criteria for determination, with the results of detection sensitivity shown in Table 11.

TABLE 11 detection results of the sensitivity of the RINA-CAS technology of the present invention to different kinds of viruses/bacteria

In the table, "+" indicates a positive result and "-" indicates a negative result.

Related abbreviations: inf.a, influenza a; b, influenza b; c, influenza c; HPV, human papilloma virus; strep.a, streptococcus; RSV, respiratory syncytial virus; PTB, pulmony tuboculosis, tuberculosis; MP, mycoplasma pneumoniae; CP, chlamydia pneumoniae; AdV, adenovirus; EV, Epstein-Barr virus; BoV, bocavirus; HRV, human rhinovirus.

The RINA-CAS technology of the present invention has extremely high detection sensitivity, for example, the detection limit for inf.a etc. is 5 copies, and the detection limit for HPV etc. is even as low as1 copy.

SEQUENCE LISTING

<110> Beijing Aikelen medical science and technology Co., Ltd

<120> nucleic acid detection method and kit

<130> 20180402

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 313

<212> DNA

<213> Artificial sequence

<400> 1

gacagactgc acagggcatg gattacttac acgccaagtc aatcatccac agagacctca 60

agagtaataa tatatttctt catgaagacc tcacagtaaa aataggtgat tttggtctag 120

ctacagagaa atctcgatgg agtgggtccc atcagtttga acagttgtct ggatccattt 180

tgtggatggc accagaagtc atcagaatgc aagataaaaa tccatacagc tttcagtcag 240

atgtatatgc atttggaatt gttctgtatg aattgatgac tggacagtta ccttattcaa 300

acatcagacg gga 313

<210> 2

<211> 33

<212> DNA

<213> Artificial sequence

<400> 2

cgccaagtca atcatccaca gagacctcaa gag 33

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence

<400> 3

ccaaatgcat atacatctga ctgaaagctg tatgg 35

<210> 4

<211> 41

<212> DNA

<213> Artificial sequence

<400> 4

ctcttgagcg ccaagtcaat catccacaga gacctcaaga g 41

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence

<400> 5

ccatacacca aatgcatata catctgactg aaagctgtat gg 42

<210> 6

<211> 60

<212> DNA

<213> Artificial sequence

<400> 6

accaacttaa tacgactcac tataggtgaa actgcggtgg gagtcttatc ccaagttggt 60

<210> 7

<211> 38

<212> DNA

<213> Artificial sequence

<400> 7

tggttgtcac aagcactgcc tgctgtacac ttcaacca 38

<210> 8

<211> 63

<212> RNA

<213> Artificial sequence

<400> 8

ggggauuuag acuaccccaa aaacgaaggg gacuaaaaca aguaaaagaa uugaugauaa 60

cau 63

<210> 9

<211> 40

<212> DNA

<213> Artificial sequence

<400> 9

accaactgaa actgcggtgg gagtcttatc ccaagttggt 40

<210> 10

<211> 38

<212> DNA

<213> Artificial sequence

<400> 10

tggttgtcac aagcactgcc tgctgtacac ttcaacca 38

<210> 11

<211> 60

<212> RNA

<213> Artificial sequence

<400> 11

guuucaaaga uuaaauaauu ucuacuaagu guagauaagu aaaagaauug augauaacau 60

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence

<400> 12

gggagtctta tcccaagttg gt 22

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<400> 13

tgcctgctgt acacttcaac ca 22

<210> 14

<211> 54

<212> DNA

<213> Artificial sequence

<400> 14

acagtaatac gactcactat aggtttgttg gggtaaccaa ctatttgtta ctgt 54

<210> 15

<211> 36

<212> DNA

<213> Artificial sequence

<400> 15

actgtgacgt ctgcagttaa ggttattttg cacagt 36

<210> 16

<211> 61

<212> RNA

<213> Artificial sequence

<400> 16

ggggauuuag acuaccccaa aaacgaaggg gacuaaaacu cugaaguaga uauggcagca 60

c 61

<210> 17

<211> 605

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 17

Val Ile Ser Tyr Asp Asn Tyr Val Thr Ile Leu Asp Glu Glu Thr Leu

1 5 10 15

Lys Ala Trp Ile Ala Lys Leu Glu Lys Ala Pro Val Phe Ala Phe Asp

20 25 30

Thr Glu Thr Asp Ser Leu Asp Asn Ile Ser Ala Asn Leu Val Gly Leu

35 40 45

Ser Phe Ala Ile Glu Pro Gly Val Ala Ala Tyr Ile Pro Val Ala His

50 55 60

Asp Tyr Leu Asp Ala Pro Asp Gln Ile Ser Arg Glu Arg Ala Leu Glu

65 70 75 80

Leu Leu Lys Pro Leu Leu Glu Asp Glu Lys Ala Leu Lys Val Gly Gln

85 90 95

Asn Leu Lys Tyr Asp Arg Gly Ile Leu Ala Asn Tyr Gly Ile Glu Leu

100 105 110

Arg Gly Ile Ala Phe Asp Thr Met Leu Glu Ser Tyr Ile Leu Asn Ser

115 120 125

Val Ala Gly Arg His Asp Met Asp Ser Leu Ala Glu Arg Trp Leu Lys

130 135 140

His Lys Thr Ile Thr Phe Glu Glu Ile Ala Gly Lys Gly Lys Asn Gln

145 150 155 160

Leu Thr Phe Asn Gln Ile Ala Leu Glu Glu Ala Gly Arg Tyr Ala Ala

165 170 175

Glu Asp Ala Asp Val Thr Leu Gln Leu His Leu Lys Met Trp Pro Asp

180 185 190

Leu Gln Lys His Lys Gly Pro Leu Asn Val Phe Glu Asn Ile Glu Met

195 200 205

Pro Leu Val Pro Val Leu Ser Arg Ile Glu Arg Asn Gly Val Lys Ile

210 215 220

Asp Pro Lys Val Leu His Asn His Ser Glu Glu Leu Thr Leu Arg Leu

225 230 235 240

Ala Glu Leu Glu Lys Lys Ala His Glu Ile Ala Gly Glu Glu Phe Asn

245 250 255

Leu Ser Ser Thr Lys Gln Leu Gln Thr Ile Leu Phe Glu Lys Gln Gly

260 265 270

Ile Lys Pro Leu Lys Lys Thr Pro Gly Gly Ala Pro Ser Thr Ser Glu

275 280 285

Glu Val Leu Glu Glu Leu Ala Leu Asp Tyr Pro Leu Pro Lys Val Ile

290 295 300

Leu Glu Tyr Arg Gly Leu Ala Lys Leu Lys Ser Thr Tyr Thr Asp Lys

305 310 315 320

Leu Pro Leu Met Ile Asn Pro Lys Thr Gly Arg Val His Thr Ser Tyr

325 330 335

His Gln Ala Val Thr Ala Thr Gly Arg Leu Ser Ser Thr Asp Pro Asn

340 345 350

Leu Gln Asn Ile Pro Val Arg Asn Glu Glu Gly Arg Arg Ile Arg Gln

355 360 365

Ala Phe Ile Ala Pro Glu Asp Tyr Val Ile Val Ser Ala Asp Tyr Ser

370 375 380

Gln Ile Glu Leu Arg Ile Met Ala His Leu Ser Arg Asp Lys Gly Leu

385 390 395 400

Leu Thr Ala Phe Ala Glu Gly Lys Asp Ile His Arg Ala Thr Ala Ala

405 410 415

Glu Val Phe Gly Leu Pro Leu Glu Thr Val Thr Ser Glu Gln Arg Arg

420 425 430

Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly Met Ser Ala Phe

435 440 445

Gly Leu Ala Arg Gln Leu Asn Ile Pro Arg Lys Glu Ala Gln Lys Tyr

450 455 460

Met Asp Leu Tyr Phe Glu Arg Tyr Pro Gly Val Leu Glu Tyr Met Glu

465 470 475 480

Arg Thr Arg Ala Gln Ala Lys Glu Gln Gly Tyr Val Glu Thr Leu Asp

485 490 495

Gly Arg Arg Leu Tyr Leu Pro Asp Ile Lys Ser Ser Asn Gly Ala Arg

500 505 510

Arg Ala Ala Ala Glu Arg Ala Ala Ile Asn Ala Pro Met Gln Gly Thr

515 520 525

Ala Ala Asp Ile Ile Lys Arg Ala Met Ile Ala Val Asp Ala Trp Leu

530 535 540

Gln Ala Glu Gln Pro Arg Val Arg Met Ile Met Gln Val His Asp Glu

545 550 555 560

Leu Val Phe Glu Val His Lys Asp Asp Val Asp Ala Val Ala Lys Gln

565 570 575

Ile His Gln Leu Met Glu Asn Cys Thr Arg Leu Asp Val Pro Leu Leu

580 585 590

Val Glu Val Gly Ser Gly Glu Asn Trp Asp Gln Ala His

595 600 605

<210> 18

<211> 605

<212> PRT

<213> Artificial sequence

<400> 18

Val Ile Ser Tyr Asp Asn Tyr Val Thr Ile Leu Asp Glu Glu Thr Leu

1 5 10 15

Lys Ala Trp Ile Ala Lys Leu Glu Lys Ala Pro Val Phe Ala Phe Asp

20 25 30

Thr Glu Thr Asp Ser Leu Asp Asn Ile Ser Ala Asn Leu Val Gly Leu

35 40 45

Ser Phe Ala Ile Glu Pro Gly Val Ala Ala Tyr Ile Pro Val Ala His

50 55 60

Asp Tyr Leu Asp Ala Pro Asp Gln Ile Ser Arg Glu Arg Ala Leu Glu

65 70 75 80

Leu Leu Lys Pro Leu Leu Glu Asp Glu Lys Ala Leu Lys Val Gly Gln

85 90 95

Asn Leu Lys Tyr Asp Arg Gly Ile Leu Ala Asn Tyr Gly Ile Glu Leu

100 105 110

Arg Gly Ile Ala Phe Asp Thr Met Leu Glu Ser Tyr Ile Leu Asn Ser

115 120 125

Val Ala Gly Arg His Asp Met Asp Ser Leu Ala Glu Arg Trp Leu Lys

130 135 140

His Lys Thr Ile Thr Phe Glu Glu Ile Ala Gly Lys Gly Lys Asn Gln

145 150 155 160

Leu Thr Phe Asn Gln Ile Ala Leu Glu Glu Ala Gly Arg Tyr Ala Ala

165 170 175

Glu Asp Ala Asp Val Thr Leu Gln Leu His Leu Lys Met Trp Pro Asp

180 185 190

Leu Gln Lys His Lys Trp Pro Leu Asn Val Phe Glu Asn Ile Glu Met

195 200 205

Pro Leu Val Pro Val Leu Ser Arg Ile Glu Arg Asn Gly Ile Lys Ile

210 215 220

Asp Pro Lys Val Leu His Asn His Ser Glu Glu Leu Thr Leu Arg Leu

225 230 235 240

Ala Glu Leu Glu Lys Lys Ala His Glu Ile Ala Gly Glu Glu Phe Asn

245 250 255

Leu Ser Ser Thr Lys Gln Leu Gln Thr Ile Leu Phe Glu Lys Gln Gly

260 265 270

Ile Lys Pro Leu Lys Lys Thr Pro Gly Gly Ala Pro Ser Thr Ser Glu

275 280 285

Glu Val Leu Glu Glu Leu Ala Leu Asp Tyr Pro Leu Pro Lys Val Ile

290 295 300

Leu Lys Tyr Arg Gly Leu Ala Lys Leu Lys Ser Thr Tyr Thr Asp Lys

305 310 315 320

Leu Pro Leu Met Ile Asn Pro Lys Thr Gly Arg Val His Thr Ser Tyr

325 330 335

His Gln Ala Val Thr Ala Thr Gly Arg Leu Ser Ser Thr Asp Pro Asn

340 345 350

Leu Glu Asn Ile Pro Val Arg Asn Glu Glu Gly Arg Arg Ile Arg Gln

355 360 365

Ala Phe Ile Ala Pro Glu Asp Tyr Val Ile Val Ser Glu Asp Tyr Ser

370 375 380

Gln Ile Glu Leu Arg Ile Met Ala His Leu Ser Arg Asp Lys Gly Leu

385 390 395 400

Leu Thr Ala Phe Ala Glu Gly Lys Asp Ile His Arg Ala Thr Ala Ala

405 410 415

Glu Val Phe Gly Leu Pro Leu Glu Thr Val Thr Ser Glu Gln Arg Arg

420 425 430

Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly Met Ser Ala Phe

435 440 445

Gly Leu Ala Arg Gln Leu Asn Ile Pro Arg Lys Glu Ala Gln Lys Tyr

450 455 460

Met Asp Leu Tyr Phe Glu Arg Tyr Pro Gly Val Leu Glu Tyr Met Glu

465 470 475 480

Arg Thr Arg Ala Gln Ala Lys Glu Gln Gly Tyr Val Glu Thr Leu Asp

485 490 495

Gly Arg Arg Leu Tyr Leu Pro Asp Ile Lys Ser Ser Asn Gly Ala Arg

500 505 510

Arg Ala Ala Ala Glu Arg Ala Ala Ile Asn Ala Pro Met Gln Gly Thr

515 520 525

Ala Ala Asp Ile Ile Lys Arg Ala Met Ile Ala Val Asp Ala Trp Leu

530 535 540

Gln Ala Glu Gln Pro Arg Val Arg Met Ile Met Gln Val His Asp Glu

545 550 555 560

Leu Val Phe Glu Val His Lys Asp Asp Val Asp Ala Val Ala Lys Gln

565 570 575

Ile His Gln Leu Met Lys Asn Cys Thr Arg Leu Asp Val Pro Leu Leu

580 585 590

Val Glu Val Gly Ser Gly Glu Asn Trp Asp Gln Ala His

595 600 605

<210> 19

<211> 369

<212> RNA

<213> Artificial sequence

<400> 19

cagggaggug ccuugaugac auagaagaag aaccagauga uguugauggc ccaacugaaa 60

uaguauuaag ggacaugaac aacaaagaug caaggcaaaa gauaaaggag gaaguaaaca 120

cucagaaaga agggaaguuc cguuugacaa uaaaaaggga uaugcguaau guauuguccc 180

ugagaguguu aguaaacgga acauuccuca aacaccccaa uggauacaag uccuuaucaa 240

cucugcauag auugaaugca uaugaccaga guggaaggcu uguugcuaaa cuuguugcua 300

cugaugagcu uacaguggag gaugaagaag auggccaucg gauccucaau ucacucuucg 360

agcgucuua 369

<210> 20

<211> 35

<212> DNA

<213> Artificial sequence

<400> 20

cagggaggtg ccttgatgac atagaagaag aacca 35

<210> 21

<211> 34

<212> DNA

<213> Artificial sequence

<400> 21

taagacgctc gaagagtgaa ttgaggatcc gatg 34

<210> 22

<211> 18

<212> DNA

<213> Artificial sequence

<400> 22

taatacgact cactatag 18

Claims

1. A method of determining the level of a target nucleic acid in a sample, comprising:

1) isolating the target nucleic acid from the sample;

2. The method of claim 1, wherein the target nucleic acid is DNA or RNA.

3. The method of claim 1, wherein the isothermal nucleic acid amplification technique comprises the use of a pair of DNA primers having a stem-loop structure.

4. The method of claim 1, wherein the isothermal nucleic acid amplification technique comprises using an amplification reaction system comprising a helicase, a recombinase, and a DNA polymerase.

5. The method of claim 4, wherein the helicase is selected from the group consisting of RecQ helicase, UvrD helicase, DnaB helicase, and CMC helicase; the recombinase is selected from a UvsX system of bacteriophage, a Rad system of eukaryote, a yeast or an Escherichia coli recA system; the DNA polymerase is selected from Deep VentRTM DNA polymerase, Deep VentRTM (exo-) DNA polymerase, Klenow fragment (3 '-5' exo-), DNA polymerase I, Klenow large fragment, phi29 DNA polymerase, DNA polymerase I, DNA,

DNA polymerase, VentR (exo-) DNA polymerase.

6. The method of claim 4, wherein the DNA polymerase is obtained by performing the following amino acid substitutions on the Klenow large fragment of E.coli polymerase I: G198W, V222I, E306K, Q354E, a381E, and E582K.

7. The method of claim 4, wherein the DNA polymerase has the sequence as set forth in SEQ ID NO: 18, or a pharmaceutically acceptable salt thereof.

8. The method of claim 1, wherein the Cas detection composition comprises a Cas12a or a Cas13a protein.

9. The method of claim 1, wherein the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

10. The method of claim 1, wherein the target nucleic acid is derived from a virus or a bacterium.

11. The method of claim 10, wherein the virus or bacterium is selected from inf.A, inf.B, inf.C, HPV, strep.A, RSV, PTB, MP, CP, AdV, EV, BoV, and HRV.

12. A kit for detecting a target nucleic acid in a sample comprising a helicase, a recombinase and a DNA polymerase for performing isothermal nucleic acid amplification and a Cas detection composition for detecting DNA amplification products.

13. The kit of claim 12, wherein the helicase is selected from the group consisting of RecQ helicase, UvrD helicase, DnaB helicase, and CMC helicase; the recombinase is selected from a phage UvsX system, a eukaryote Rad system, and a yeast or Escherichia coli recA system; the DNA polymerase is selected from Deep VentRTM DNA polymerase, Deep VentRTM (exo-) DNA polymerase, Klenow fragment (3 '-5' exo-), DNA polymerase I, Klenow large fragment, phi29 DNA polymerase, DNA polymerase I, DNA,

DNA polymerase, and VentR (exo-) DNA polymerase.

14. The kit of claim 12, wherein the DNA polymerase is obtained by performing the following amino acid substitutions on the Klenow large fragment of escherichia coli polymerase I: G198W, V222I, E306K, Q354E, a381E, and E582K.

15. The kit of claim 12, wherein the DNA polymerase has the sequence as set forth in SEQ ID NO: 18, or a pharmaceutically acceptable salt thereof.

16. The kit of claim 12, wherein the Cas detection composition comprises a Cas12a or a Cas13a protein.

17. The kit of claim 12, wherein the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

18. The kit of claim 12, further comprising a pair of DNA primers for isothermal nucleic acid amplification, either or both of the pair of DNA primers having a stem-loop structure.

19. The kit of claim 18, wherein the stem-loop structure is formed by adding 2 to 15 bases at the 5 ' end of a linear DNA primer complementary to the target nucleic acid, the 2 to 15 bases being complementary to the 3 ' end sequence of the linear DNA primer or to a sequence 1 to 10 bases from the 3 ' end of the linear DNA primer.

20. The pair of DNA primers of claim 19, wherein either or both of the pair of DNA primers is 33 to 45 bases in length; or the 5' end of the linear primer is added with a T7 promoter sequence, so that the length of either primer or both primers in the DNA primer pair is 51-63 bases.

21. The kit of claim 18, wherein the kit is for detection of influenza b virus, the DNA primer pairs having the sequences of SEQ ID NOs: 6 and 7 or the nucleotide sequences shown in SEQ ID NO: 9 and 10; or the kit is used for detecting HPV virus, and the DNA primer pairs respectively have the nucleotide sequences shown in SEQ ID NO: 14 and 15.

22. The kit of claim 18, wherein the kit is for the detection of influenza b virus, further comprising a nucleic acid having the sequence of SEQ ID NO: 8 or 11, or a crRNA of the nucleotide sequence shown in seq id no; or the kit is used for detecting HPV virus, and also comprises a nucleotide sequence with SEQ ID NO: 16.