CN112941155B

CN112941155B - DNA primer pair with stem-loop structure and application thereof

Info

Publication number: CN112941155B
Application number: CN202110282713.1A
Authority: CN
Inventors: 梁振伟; 杜晋鲁; 王一凡; 蒲珏
Original assignee: Beijing Exellon Medical Technology Co ltd
Current assignee: Beijing Exellon Medical Technology Co ltd
Priority date: 2018-05-14
Filing date: 2018-05-14
Publication date: 2023-07-14
Anticipated expiration: 2038-05-14
Also published as: CN112941155A; CN112899350B; CN112899350A; CN108588050A; CN108588050B

Abstract

The invention provides a DNA primer pair with a stem-loop structure for isothermal nucleic acid amplification. The method can be used for detecting target nucleic acid in a sample under the condition of constant temperature, has the advantages of low cost, short detection time, simple and convenient operation, high specificity, high sensitivity and the like, and is particularly suitable for POCT application.

Description

DNA primer pair with stem-loop structure and application thereof

The present application is a divisional application of chinese patent application entitled "DNA polymerase, nucleic acid detection method and kit", filed 5/14/2018, which is incorporated herein by reference.

Technical Field

The present invention relates to a nucleic acid detection technique using a isothermal nucleic acid detection technique using a DNA primer pair having a stem-loop structure.

Background

Nucleic acid detection techniques have great value in molecular diagnostics, biochemical analysis, disease diagnosis applications, e.g., for detection of viral, bacterial, pathogen nucleic acids, and detection of nucleic acid disease markers, and the like. PCR (polymerase chain reaction ) technology is the most widely used nucleic acid detection technology at present. The technology was invented by dr. Mullis in 1983, which is mainly divided into three basic steps, namely: denaturation, annealing and extension. The PCR technology needs to implement nucleic acid amplification by repeatedly increasing and decreasing temperatures, has high requirements on instruments and operation environments, is precise and complex in instruments, is expensive, and is complex to operate, and needs professional technicians and laboratories, so that the application range of the PCR technology has a large limitation, for example, the application of the PCR technology in the fields of Point-of-care testing (POCT) and the like is limited. Thus, isothermal amplification techniques of nucleic acids represented by RPA (recombinase polymerase amplification), RAA (recombiase-aidamplication), LAMP (loop-mediated isothermal amplification) and the like are attracting attention, however, the specificity of these techniques is not particularly high, nonspecific amplification is easy to occur in the practical process, and interpretation of results is disturbed.

In addition, detection of RNA has long relied on reverse transcriptase, which is required to first reverse transcribe RNA to cDNA and then amplify the DNA sequence (e.g., PCR, etc.). Gulati et al found that DNA polymerase I was able to reverse transcribe viral RNA depending on the oligonucleotide oligo-dT. However, this reverse transcription system is specific to DNA polymerase: the ratio of RNA template is required to be high, and the reverse transcription amplification efficiency is not ideal (Proc.Nat. Acad. Sci USA Vol.71, no.4, pp.1035-1039,1974).

Disclosure of Invention

In order to overcome the above problems, in one aspect, the present invention provides a DNA polymerase using DNA or RNA as a template, which is obtained by subjecting a large Klenow fragment of escherichia coli polymerase I to the following amino acid substitutions: G198W, V I, E306K, Q354E, A381E, and E582K.

In some embodiments, the DNA polymerase has the sequence set forth in SEQ ID NO:18, and a polypeptide having the amino acid sequence shown in seq id no.

Correspondingly, the invention also provides a polynucleotide sequence encoding the DNA polymerase or a complementary sequence thereof.

In another aspect, the present invention provides a DNA primer pair for isothermal amplification of nucleic acids, wherein either or both of the DNA primer pair has a stem-loop structure.

In some embodiments, the stem-loop structure is formed by adding 2 to 15 bases to the 5' end of a linear DNA primer complementary to a template sequence, the 2 to 15 bases being complementary to the 3' end sequence of the linear DNA primer or to a sequence 1 to 10 bases from the 3' end of the linear DNA primer.

In some embodiments, either or both of the DNA primer pairs are 33 to 45 bases in length; or a T7 promoter sequence is also added to the 5' end of the linear primer, the length of either or both of the DNA primer pair is 51 to 63 bases.

In another aspect, the invention provides a method of determining the level of a target nucleic acid in a sample comprising:

1) Isolating the target nucleic acid from the sample;

2) Amplifying the separated target nucleic acid serving as a template by adopting a isothermal nucleic acid amplification technology to obtain a DNA amplification product; and

3) Detecting the amount of the DNA amplification product with a Cas detection composition and correlating the amount of the DNA amplification product to the level of the target nucleic acid in the sample.

In some embodiments, the target nucleic acid is DNA or RNA.

In some embodiments, the isothermal nucleic acid amplification techniques include the use of a DNA primer pair having a stem-loop structure.

In some embodiments, the isothermal nucleic acid amplification techniques include the use of amplification reaction systems containing helicase, recombinase, and DNA polymerase.

In some embodiments, the helicase is selected from the group consisting of RecQ helicase, uvrD helicase, dnaB helicase, and CMC helicase; the recombinase is selected from a UvsX system of phage, a eukaryotic Rad system, a yeast or an E.coli recA system; the DNA polymerase is selected from Deep VentRTM DNA polymerase, deep VentRTM (exo-) DNA polymerase, klenow fragment (3 '-5' exo-), DNA polymerase I, klenow large fragment, phi29 DNA polymeraseSynthase enzyme,

DNA polymerase, ventR (exo-) DNA polymerase.

In a preferred embodiment, the DNA polymerase is obtained by amino acid substitution of the Klenow large fragment of E.coli polymerase I as follows: G198W, V I, E306K, Q354E, A381E, and E582K.

In a preferred embodiment, the DNA polymerase has the sequence as set forth in SEQ ID NO:18, and a polypeptide having the amino acid sequence shown in seq id no.

In some embodiments, the Cas detection composition comprises a Cas12a or Cas13a protein.

In other embodiments, the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

In some embodiments, the target nucleic acid is derived from a virus or a bacterium.

In some embodiments, the virus or bacterium is selected from the group consisting of inf.a, inf.b, inf.c, HPV, strep.a, RSV, PTB, MP, CP, adV, EV, boV, and HRV.

In another aspect, the invention provides a kit for detecting a target nucleic acid in a sample, comprising a helicase, a recombinase and a DNA polymerase for performing isothermal nucleic acid amplification, and a Cas detection composition for detecting a DNA amplification product.

In some embodiments, the helicase is selected from the group consisting of RecQ helicase, uvrD helicase, dnaB helicase, and CMC helicase; the recombinase is selected from phage UvsX system, eukaryotic Rad system, and yeast or escherichia coli recA system; the DNA polymerase is selected from Deep VentRTM DNA polymerase, deep VentRTM (exo-) DNA polymerase, klenow fragment (3 '-5' exo-), DNA polymerase I, klenow large fragment, phi29 DNA polymerase,

DNA polymerase, and VentR (exo-) DNA polymerase.

In some embodiments, the Cas detection composition comprises a Cas13a protein and a Csm6 protein.

In some embodiments, the kit further comprises a DNA primer pair for isothermal nucleic acid amplification, either or both of the DNA primer pair having a stem-loop structure.

In some embodiments, the stem-loop structure is formed by adding 2 to 15 bases to the 5' end of a linear DNA primer complementary to the target nucleic acid, the 2 to 15 bases being complementary to the 3' end sequence of the linear DNA primer or to a sequence 1 to 10 bases from the 3' end of the linear DNA primer.

In some embodiments, the kit is for detection of influenza b virus, the DNA primers have the nucleotide sequence of SEQ ID NO:6 and 7 or SEQ ID NO:9 and 10; or the kit is used for detecting HPV viruses, and the DNA primers respectively have SEQ ID NO:14 and 15.

In some embodiments, the kit is for detection of influenza b virus, further comprising a nucleic acid sequence having SEQ ID NO:8 or 11, and a crRNA of the nucleotide sequence shown in seq id no; or the kit is used for detecting HPV virus and further comprises a nucleotide sequence with SEQ ID NO:16, and a crRNA of the nucleotide sequence shown in seq id no.

The DNA polymerase, the stem-loop structure primer, the method for detecting the nucleic acid and the kit provided by the invention can be used for detecting the target nucleic acid in a sample under the condition of constant temperature, and have the advantages of low cost, short detection time, simplicity and convenience in operation, high specificity, high sensitivity and the like, and are especially suitable for POCT application.

Drawings

FIG. 1 is a schematic diagram of the RINA-CAS technique of the present invention

FIG. 2 is a graph showing the results of isothermal nucleic acid amplification of the engineered Klenow large fragment (MT-Klenow) and wild-type Klenow large fragment (WT-Klenow) of the present invention. Wherein,,

fluorescence curve representing amplification using MT-Klenow, < >>

A fluorescence curve using WT-Klenow amplification is shown.

FIG. 3 is a graph showing the result of comparing a conventional linear primer with the stem-loop structure primer of the present invention for isothermal nucleic acid amplification. Wherein the method comprises the steps of

Three sets of parallel fluorescence curves representing primers of stem-loop structure,/->

Respectively correspond to->

Is a negative control of->

Three sets of parallel fluorescence curves representing common linear primers, < ->

Respectively correspond to->

Is a negative control of (2).

FIG. 4 is a graph showing the results of detection of Influenza B samples with LwCas13a as the detection protein. Wherein the method comprises the steps of

Three sets of parallel fluorescence curves representing detection of Influenza B samples, < >>

Corresponding +.>

Is a negative control of (2).

FIG. 5 is a graph showing the results of detection of Influenza B samples with a detection composition using LbCAs12a as the detection protein. Wherein the method comprises the steps of

Corresponding +.>

Is a negative control of (2).

FIG. 6 is a graph showing the results of detection of Influenza B samples by fluorescent quantitative PCR. Wherein the method comprises the steps of

Corresponding +.>

Is a negative control of (2).

FIG. 7 is a graph showing the detection results of HPV samples using LwCas13a as the detection protein. Wherein the method comprises the steps of

Three sets of parallel fluorescence curves representing detection of HPV samples, < >>

Corresponding +.>

Is a negative control of (2).

Detailed Description

Unless otherwise defined, technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art. Unless otherwise indicated, the basic procedures of molecular biology, genetic engineering, and the like, employed herein are conventional biological techniques well known to those skilled in the art. Unless otherwise indicated, the test materials used in the present invention are commercially available from general Biochemical agents.

As used herein, the term "large Klenow fragment" refers to a fragment of E.coli DNA polymerase I produced by partial hydrolysis of trypsin or subtilisin by the C-terminal 605 amino acid residues. This fragment retains the 5'-3' polymerase activity and 3'-5' exonuclease activity of DNA polymerase I, but lacks the 5'-3' exonuclease activity of the intact enzyme. In addition, as described above, the Klenow large fragment also has a weak RNA-dependent DNA polymerase activity.

As used herein, the terms "isothermal nucleic acid amplification" or "isothermal nucleic acid amplification techniques" are used interchangeably to refer to nucleic acid amplification processes that are performed under isothermal conditions. That is, repeated thermal denaturation is not required during the amplification process, unlike conventional PCR techniques. Isothermal nucleic acid amplification techniques have evolved over the last 20 years in the process of continuing to develop, and sub-division techniques employing different amplification principles have emerged, such as loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP), strand-displacement amplification (strand displacement amplification, SDA), rolling-change amplification (rolling circle amplification, RCA), helicase-dependent isothermal DNA amplification (helicase-dependent isothermal DNA amplification, HDA), recombinase polymerase amplification (recombinase polymerase amplification, RPA), recombinase-mediated amplification (RAA), and the like. Since these isothermal amplification methods do not require repeated thermal denaturation, the amplification rate is much faster than that of PCR amplification reactions, usually completed within 30 minutes, even within 15 minutes, they are also referred to herein as rapid isothermal nucleic acid amplification (rapid isothermal nucleic-acid amplification, RINA).

As used herein, the term "stem-loop structure" or "hairpin structure" when used in reference to a DNA primer is used interchangeably to refer to the DNA primer itself forming a secondary mechanism by base pairing at the 5 'end with the 3' end. The double-stranded portion formed by base pairing is the "stem" and the sequence between the paired bases forms the "loop". In some cases, the stem may not be blunt ended, e.g., have a3 'protruding end or a 5' protruding end, and may be referred to as a footed stem-loop structure. The number of bases paired within the stem-loop structure is typically 2 to 15 bases, e.g., 5, 6, 7, 8, 10, 12 bases, etc. The "loop" is usually formed of tens to tens of bases.

As used herein, the term "Cas detection system" or "Cas detection composition" refers to a system that utilizes bacterial CRISPR (regularly spaced clustered short palindromic repeats, clustered regularly interspaced short palindromic repeats) related proteins (CRISPR associated proteins, cas) for nucleic acid detection. The CRISPR system is a bacterial immune system that has now been found to be present in most bacteria and is used to identify and destroy phage and other pathogen invasion. CRISPR is a unique DNA region in the bacterial genome that stores viral DNA fragments, allowing a bacterial cell to recognize viruses that attempt to re-infect it. Short RNA sequences (referred to as crrnas) produced after transcription of CRISPR region sequences, upon recognition and binding to viral nucleic acids, result in cleavage of viral nucleic acids by Cas proteins (or Cas enzymes) bound to crrnas. Various CRISPR/Cas systems have been discovered so far, such as CRISPR/Cas9, CRISPR/Cas13a, CRISPR/Cas12a, and the like. Unlike Cas9, cas13a and Cas12a have corresponding nuclease activity upon activation, in addition to being able to cleave the target nucleic acid, have additional cleavage (collateral cleavage) activity, being able to continue to cleave other non-target single-stranded DNA (Cas 12 a) or RNA (Cas 13 a) nearby. These features can be used for detection of target nucleic acids in a sample. For example, to detect target nucleic acid levels in a sample, crrnas that specifically bind to the target nucleic acid sequence, as well as short RNA or DNA reporter molecules with fluorescent groups and quenching groups, can be designed to use this collateral cleavage activity of Cas13a or Cas12a to effect cleavage of the reporter nucleic acid sequence, producing a fluorescent signal. Finally, the level of the target nucleic acid in the sample is reflected by detecting the intensity or time-dependent change of the fluorescent signal. Such a system is referred to herein as a "Cas detection system". Of course, cas detection systems are not limited to Cas13a or Cas12a, but other proteins having enzymatic activity similar to Cas13a or Cas12a may be employed to effect such detection.

As used herein, the term "reporter" refers to a short single-stranded DNA or single-stranded RNA molecule, e.g., 6 to 20 bases long, that has a fluorescent group attached to its 5 'end (e.g., FAM, HEX, cy3, JOE or ROX) and a quenching group attached to its 3' end (e.g., BHQ2, BHQ3, etc.). In the complete reporter molecule, the fluorescent group is spatially close to the quenching group, and the quenching group inhibits fluorescent signal generation caused by excitation light irradiation; whereas in the case of cleavage of single-stranded DNA or single-stranded RNA in a reporter molecule, such as Cas13a or Cas12a, the fluorescent group is separated from the quenching group, the generation of a fluorescent signal can be detected under excitation light irradiation.

Engineering of Klenow Large fragments

The Klenow large fragment is the remainder of the 5'-3' exonuclease domain deleted by DNA polymerase I, comprising 605 amino acid residues, amino acid sequence: VISYDNYVTILDEETLKAWIAKLEKAPVFAFDTETDSLDNISANLVGLSFAIEPGVAAYIPVAHDYLDAPDQISRERALELLKPLLEDEKALKVGQNLKYDRGILANYGIELRGIAFDTMLESYILNSVAGRHDMDSLAERWLKHKTITFEEIAGKGKNQLTFNQIALEEAGRYAAEDADVTLQLHLKMWPDLQKHKGPLNVFENIEMPLVPVLSRIERNGVKIDPKVLHNHSEELTLRLAELEKKAHEIAGEEFNLSSTKQLQTILFEKQGIKPLKKTPGGAPSTSEEVLEELALDYPLPKVILEYRGLAKLKSTYTDKLPLMINPKTGRVHTSYHQAVTATGRLSSTDPNLQNIPVRNEEGRRIRQAFIAPEDYVIVSADYSQIELRIMAHLSRDKGLLTAFAEGKDIHRATAAEVFGLPLETVTSEQRRSAKAINFGLIYGMSAFGLARQLNIPRKEAQKYMDLYFERYPGVLEYMERTRAQAKEQGYVETLDGRRLYLPDIKSSNGARRAAAERAAINAPMQGTAADIIKRAMIAVDAWLQAEQPRVRMIMQVHDELVFEVHKDDVDAVAKQIHQLMENCTRLDVPLLVEVGSGENWDQAH (SEQ ID NO: 17). Structurally, the P61-Q194 domain of the Klenow large fragment has 3'-5' exonuclease proofreading activity, and the L422-D570 domain is a polymerase domain. It has a DNA-dependent DNA polymerase activity and a weak RNA-dependent DNA polymerase activity (i.e., reverse transcription activity).

To improve the activity, especially the reverse transcription activity, we engineered the Klenow large fragment with site-directed mutagenesis (site-directed mutagenesis) to replace part of its amino acids. Based on structural biological data (PDB: 1KFD_A) and through multiple experiments, we designed and introduced the following six amino acid residue substitutions: g198W, V222I, E306K, Q354E, a381E and E582K. The sequence of the engineered Klenow large fragment is: VISYDNYVTILDEETLKAWIAKLEKAPVFAFDTETDSLDNISANLVGLSFAIEPGVAAYIPVAHDYLDAPDQISRERALELLKPLLEDEKALKVGQNLKYDRGILANYGIELRGIAFDTMLESYILNSVAGRHDMDSLAERWLKHKTITFEEIAGKGKNQLTFNQIALEEAGRYAAEDADVTLQLHLKMWPDLQKHKWPLNVFENIEMPLVPVLSRIERNGIKIDPKVLHNHSEELTLRLAELEKKAHEIAGEEFNLSSTKQLQTILFEKQGIKPLKKTPGGAPSTSEEVLEELALDYPLPKVILKYRGLAKLKSTYTDKLPLMINPKTGRVHTSYHQAVTATGRLSSTDPNLENIPVRNEEGRRIRQAFIAPEDYVIVSEDYSQIELRIMAHLSRDKGLLTAFAEGKDIHRATAAEVFGLPLETVTSEQRRSAKAINFGLIYGMSAFGLARQLNIPRKEAQKYMDLYFERYPGVLEYMERTRAQAKEQGYVETLDGRRLYLPDIKSSNGARRAAAERAAINAPMQGTAADIIKRAMIAVDAWLQAEQPRVRMIMQVHDELVFEVHKDDVDAVAKQIHQLMKNCTRLDVPLLVEVGSGENWDQAH (SEQ ID NO: 18). The single letter symbols recommended by the IUPAC-IUB biochemical nomenclature committee are used herein to designate the individual amino acids, for example, wherein G represents glycine, W represents tryptophan, V represents valine, I represents isoleucine, E represents glutamic acid, K represents lysine, Q represents glutamine, a represents alanine. G198W represents the substitution of glycine 198 in the Klenow large fragment with tryptophan, and so on. Amino acids used for substitution in the above sequences are shown in underlined bold. These 6 amino acid residue changes increase the activity of the Klenow large fragment in reverse transcription and subsequent isothermal amplification reactions (see example 1 below). It is contemplated that one skilled in the art can also make substitutions of other amino acids based on such engineered Klenow large fragments provided by the present invention (referred to as DNA polymerases of the present invention) that do not result in loss of their DNA polymer activity (including reverse transcription activity), e.g., silent substitutions, which are also included within the scope of the polymerases of the present invention.

Accordingly, the present invention also provides polynucleotide sequences encoding the DNA polymerases of the present invention. The polynucleotide sequence can be obtained, for example, by isolating a nucleotide sequence encoding a large Klenow fragment from the genome of E.coli, amplifying it, and introducing a nucleotide substitution mutation at a specific site at the time of amplification. Alternatively, the coding nucleotide sequence may be designed based on the correspondence between amino acids and trinucleotide codons according to the amino acid sequence (SEQ ID NO: 18) of the polymerase of the present invention provided herein, followed by obtaining by chemical synthesis or the like. These operations are conventional in the art and are well known to those skilled in the art. It is noted that, based on the degeneracy of the codons, there may be a plurality of polynucleotide sequences encoding a DNA polymerase of the invention, all of which are intended to be included within the scope of the invention.

Primers for isothermal amplification of nucleic acids

In order to improve the specificity of the isothermal amplification technique of nucleic acids, the present invention provides an amplification primer having a hairpin structure (or stem-loop structure). These hairpin structures will open only when the amplification primer binds truly and effectively to the target sequence of interest; meanwhile, the hairpin structure in the amplified primer molecules effectively avoids the occurrence of mismatch between the amplified primers and prevents the generation of false positive results, thereby effectively solving the problem of poor specificity in the isothermal amplification technology. This is in contrast to commonly used PCR primers, which generally require that the primer itself cannot have a complementary sequence of more than 4 bases in succession in PCR primer design.

The 3' end of the stem-loop structural primer is completely identical or completely complementary with the nucleic acid target sequence; 2-15nt of base is additionally added at the 5 'end of the primer, and the base is complementary with the 3' end of the primer to form a stem-loop structure; or adding 2-15nt base outside the 5 'end, and forming stem-loop structure with foothold by complementation with 1-10nt base from the 3' end.

For example, a pair of conventional linear primers (i.e., that are fully complementary or identical to a portion of the contiguous sequence of the target nucleic acid) can be designed based on the target nucleic acid sequence, preferably 30-35nt in length, 40% -60% GC content, and no or only a simple secondary structure within or between the primers to avoid the 3' end of the primer being complementary to itself or another primer. Then, 2-15nt bases, preferably 6-8nt bases, are added to the 5' end of the designed linear primer, the added bases are complementary to the bases at the 3' end of the primer or complementary to several bases 1-10nt bases from the 3' end of the primer, and the structure thereof and the Tm value of the primer with the stem-loop structure are determined by software simulation. Secondary structure simulation assays can be performed using NUPACK (http:// www.nupack.org/part/new) and stem-loop structure primer Tm value assays can be performed using quekfold (http:// unafild. Rna. Albany. Edu/= DINAMelt/Quickfold). The optimal state of the stem-loop structure primer is a single stable state, and the optimal value of the Tm of the stem-loop structure primer is higher than the reaction temperature (the reaction temperature is less than or equal to 65 ℃, for example, 25 ℃). When the optimal Tm value of the stem-loop structure primer cannot be compatible with the optimal state, comprehensive consideration should be taken into consideration, for example, when the Tm value of the designed stem-loop structure primer is optimal, the Tm value can be selected to be optimal when the stem-loop structure primer is single but the loop part has a simple secondary structure; when the Tm value of the designed stem-loop structure primer is optimal, the stem-loop structure primer is not single or/and the loop part has a complex secondary structure, the stem-loop structure primer state should be mainly considered, and the single property and stability of the stem-loop structure primer are ensured.

Rapid isothermal nucleic acid amplification and Cas detection system binding for nucleic acid detection

As described above, cas detection systems can be used to detect a target nucleic acid sequence in a sample. However, its sensitivity is often difficult to meet detection requirements. For example, in the case of a target nucleic acid sequence at a low level, e.g., several to several hundred copies, an effective fluorescent signal cannot be generated. In addition, although the level of target nucleic acid in a sample can be reflected by using DNA binding dyes such as EvaGreen, sybrGreen or PNA Opener, DNA Beacon, PNA Beacon, monitoring the amplification products in a isothermal amplification process in real time, the specificity aspect is often not satisfactory. The invention provides a nucleic acid detection technology (hereinafter also referred to as RINA-CAS technology) which combines rapid isothermal nucleic acid amplification with a Cas detection system, on the one hand, can improve sensitivity, for example, can detect target nucleic acid molecules with as low as several copies, even 1 copy, and on the other hand, can improve detection specificity by primer matching in isothermal amplification and crRNA matching in detection.

FIG. 1 shows a schematic representation of the RINA-CAS technique of the present invention. Amplification product DNA was obtained by isothermal nucleic acid amplification for approximately 15 minutes in the presence of forward and reverse primers of the stem-loop structure. For detection systems employing Cas13a, the amplification product DNA is first transcribed into single stranded RNA (ssRNA). The crRNA that binds to Cas13a activates the collateral cleavage activity (single-stranded RNA nuclease activity) of Cas13a by recognizing and binding to the complementary sequence on the single-stranded RNA, resulting in cleavage of the RNA fluorescent reporter, releasing a fluorescent signal. For detection systems employing Cas12a, the collateral cleavage activity (single-stranded DNA nuclease activity) of Cas12a is activated by the crRNA that binds to Cas12a recognizing and binding to the complementary sequence on the amplified product DNA, resulting in cleavage of the DNA single-stranded fluorescent reporter, releasing a fluorescent signal. The fluorescent signal may be detected by a fluorescent detector.

The invention improves the existing rapid isothermal nucleic acid amplification technologyThe simultaneous use of helicase, recombinase, and DNA polymerase in isothermal amplification can increase the amplification efficiency and specificity, and the amplification process is usually completed within 3 to 20 minutes at 25-45 ℃ (e.g., 37 ℃). The helicase used may be selected, for example, from RecQ helicase, uvrD helicase, dnaB helicase, CMC helicase or other similar helicases; the recombinase may for example be a recombinase selected from among the UvsX system of phages, the Rad system of eukaryotes, the recA system of yeasts or of escherichia coli or other prokaryotic systems; the DNA polymerase may be selected, for example, from the group consisting of Deep VentRTM DNA polymerase, deep VentRTM (exo-) DNA polymerase, klenow fragment (3 '-5' exo-), DNA polymerase I, klenow large fragment, phi29 DNA polymerase,

DNA polymerase, ventR (exo-) DNA polymerase or other similar polymerase.

In the presence of the amplification primer, the protein-DNA complex formed by the combination of the recombinase and the amplification primer can search for a homologous sequence on the target nucleic acid; the helicase assists in unwinding the DNA duplex to form a stable D-ring structure; while the DNA single strand binding protein (SBB) stabilizes the untwisted DNA single strand. The amplification primer is combined with the target nucleic acid complementary sequence by the combined action of the recombinase and the helicase, and is polymerized and extended under the action of the DNA polymerase, and the reactions are repeated continuously under the isothermal condition of 25-45 ℃, for example, in 3-20 minutes, so as to complete the exponential amplification of the nucleic acid.

In some embodiments, the components of the amplification system employed in the rapid isothermal nucleic acid amplification of the present invention can be found in table 1 below.

TABLE 1 Components of a Rapid isothermal nucleic acid amplification System

The pH of the Tris-HCl buffer solution is 7.0-8.5, preferably 7.4. The molecular weight of polyethylene glycol is in the range of 1000-50000, preferably 20000. Dithiothreitol is used to maintain the reducibility of the individual protein components.

In some embodiments, the recombinase may employ a combination of the UvsX enzyme and a helper protein UvsY, which are proteins from either T4 or T6 phage that are capable of mediating strand displacement between the template strand and the primer strand upon melting and initiation of the reaction. This process requires ATP to provide energy. After melting and strand displacement, a single-stranded binding protein (e.g., gp 32) is able to bind to the single strand therein, preventing double strand formation.

ATP can be regenerated by creatine phosphate, and creatine kinase can realize regeneration and cyclic utilization of creatine phosphate.

In a preferred embodiment, the DNA polymerase used is a Klenow large fragment having strand displacement activity capable of specific extension following strand displacement of the amplification primer with the template strand, thereby effecting amplification of the target fragment. In a more preferred embodiment, the DNA polymerase used is a DNA polymerase of the invention, i.e. the engineered Klenow large fragment described above. The DNA polymerase of the present invention can amplify not only single-stranded or double-stranded DNA molecules as templates, but also RNA molecules as templates. In the case of amplification using an RNA molecule as a template, a cDNA molecule which can be used as a template is first synthesized using the reverse transcription activity of the DNA of the present invention, and then a subsequent amplification reaction is performed using the cDNA molecule as a template. When the DNA polymerase provided by the invention is used for amplifying target RNA, additional reverse transcriptase is not needed for reverse transcription operation, so that the amplification process is greatly simplified.

In a preferred embodiment, the upstream and downstream primers used are primers provided by the present invention having a stem-loop structure. The length of the primer is generally 33nt-45nt so as to ensure the sequence recognition specificity in the process of carrying out chain replacement by the recombinase, and the number of the adopted primers can be increased along with the increase of the number of target nucleic acid sequences to be detected. In addition, when using a Cas13a detection system, a T7 promoter sequence TAATACGACTCACTATAG (SEQ ID NO: 22) can be introduced at the 5' end of the forward amplification primer for subsequent DNA amplification product transcription and Cas13a protease cleavage detection. Thus, the primer comprises, in order from the 5 'end to the 3' end, a sequence paired with the template, a T7 promoter sequence, and a 5 'end sequence for forming a stem-loop structure with the 3' end, and the total length is approximately 51-63nt.

dNTPs used include: dATP, dTTP, dCTP, dGTP, dUTP, where dTTP may or may not be present, and the use of dUTP is advantageous for eliminating or greatly eliminating contamination problems by the UNG enzyme.

In addition, the amplification system can be further optimized by using DMSO, PEG, DTT, betaine, proline, formamide, BSA and other additives.

The DNA amplification product produced by the rapid isothermal nucleic acid amplification step can be detected by a detection system comprising Cas12a or a detection system comprising Cas13a.

The crRNA employed in these detection systems comprises a two-part structural sequence: sequences that bind to CRISPR-Cas12a/Cas13a proteins and sequences that are complementarily paired to a target nucleic acid. Wherein the sequence complementary to the target nucleic acid is 24nt-30nt in length, which may further increase the specificity and sensitivity of the detection.

In Cas12a detection systems, cas12a-RNP complexes formed by crRNA and Cas12a protein specifically recognize and cleave target DNA fragments (e.g., DNA amplification products), while activating the ssDNase activity of Cas12a protein, allowing the DNA reporter (reporter) to be degraded. The DNA reporter is an oligonucleotide ssDNA fragment with a fluorescent group at the 5 'end and a quenching group at the 3' end. Finally, the fluorescent group is separated from the quenching group, and under excitation light irradiation, a fluorescent signal is generated and read by the instrument.

In some embodiments, cas12a detection systems used in the present invention include components as shown in table 2.

TABLE 2 Cas12a detection System Components

In the Cas13a detection system, firstly, amplified product DNA containing a T7 promoter sequence is transcribed into RNA through T7 RNA polymerase, then, specific recognition and cleavage are carried out on the transcribed RNA through a Cas13a-RNP complex formed by crRNA and Cas13a protein, and then, the RNA nuclease activity of the Cas13a protein is activated, so that an RNA reporter molecule is degraded, and a fluorescent signal is emitted. The RNA reporter is an oligonucleotide RNA chain with a fluorescent group at the 5 'end and a quenching group at the 3' end.

Specifically, the detection may include, for example, the following process: (1) Transcribing the DNA amplification product carrying the T7 promoter sequence into a target RNA strand by a T7 RNA polymerase; (2) Allowing the Cas13a protein to bind to the crRNA to form a Cas13a-RNP complex, and specifically targeting the transcribed target RNA under the guidance of the crRNA; (3) Forming a target RNA-Cas13a-crRNA complex, thereby changing the conformation of Cas13a protein and activating the nonspecific RNA nuclease activity of the Cas13a protein; (4) The nonspecific RNA nuclease activity of the Cas13a protein can cleave the fluorogenic substrate RNA reporter molecule, separate the fluorescent group from the quenching group, generate a fluorescent signal under the irradiation of excitation light, and be detected and analyzed by an instrument. Although the detection process is described herein in a stepwise manner, they may be performed in the same reaction system in actual operation.

In some embodiments, cas13a detection systems used in the present invention include components as shown in table 3 below.

TABLE 3 Cas13a detection System Components

The pH value of Tris buffer in the detection system is preferably 7.4.

In some embodiments, another CRISPR-Cas protein Csm6 and its activator precursor (rurmurururwrarwrarwra- (2, 3-cyclophosphates)) can be added to the system, and after Cas13a is activated, the precursor can be cleaved to generate Csm6 activator, and the RNase activity of Csm6 is activated, so that the RNA reporter molecule can be hydrolyzed, thereby effectively improving the sensitivity of the CRISPR-Cas13a detection system. Thus, in some embodiments, the CRISPR-Cas13a detection system can be modified to supplement Csm6 protein and 500nM Csm6 activator precursor at a final concentration of 10 nM.

The RINA-CAS technique of the present invention allows amplification and detection of target nucleic acids in one reaction system, and allows qualitative and quantitative analysis of amplicons (i.e., DNA amplification products).

Detection kit

The detection kit provided by the invention can be used in the RINA-CAS technology of the invention described above. The kit may include the primary reagents for the technology, such as enzymes for performing isothermal nucleic acid amplification reactions and enzymes for detecting amplified products. Enzymes used to carry out isothermal nucleic acid amplification reactions mainly include helicases, recombinases, and DNA polymerases. In a preferred embodiment, the polymerase is a DNA polymerase provided herein. Enzymes that detect amplification products include, for example, cas12a and/or Cas13a. For specific bacterial or viral detection, the kits of the invention can further include primers for performing isothermal nucleic acid amplification reactions and crrnas for use with Cas12a and/or Cas13a. In addition, the components for performing the isothermal nucleic acid amplification reaction and the components for detecting the amplification products are listed herein in tabular form, all or part of which may be included in the detection kit of the present invention.

The RINA-CAS technology provided by the invention can complete the reaction at 37 ℃ even at room temperature, only a small constant temperature and fluorescent signal detection device is needed, a precise and expensive PCR thermal cycler is not needed, and the technology is very suitable for point-of-care testing (POCT) application.

The present invention will be explained in more detail with reference to specific examples, so that the objects, technical solutions and effects of the present invention will be more clearly understood. The following examples are given by way of illustration only and are not intended to limit the scope of the invention in any way.

EXAMPLE 1 Activity of the DNA polymerase and the Large fragment of ProKlenow of the present invention

This example compares the activity of the large Klenow fragment (MT-Klenow) after modification (i.e., introduction of the amino acid substitutions described herein) with that of the wild-type Klenow fragment (WT-Klenow). Isothermal nucleic acid amplification was performed using MT-Klenow and WT-Klenow under identical conditions using identical RNA templates and primers. The sequence of the adopted RNA template is as follows:

CAGGGAGGUGCCUUGAUGACAUAGAAGAAGAACCAGAUGAUGUUGAUGGCCCAACUGAAAUAGUAUUAAGGGACAUGAACAACAAAGAUGCAAGGCAAAAGAUAAAGGAGGAAGUAAACACUCAGAAAGAAGGGAAGUUCCGUUUGACAAUAAAAAGGGAUAUGCGUAAUGUAUUGUCCCUGAGAGUGUUAGUAAACGGAACAUUCCUCAAACACCCCAAUGGAUACAAGUCCUUAUCAACUCUGCAUAGAUUGAAUGCAUAUGACCAGAGUGGAAGGCUUGUUGCUAAACUUGUUGCUACUGAUGAGCUUACAGUGGAGGAUGAAGAAGAUGGCCAUCGGAUCCUCAAUUCACUCUUCGAGCGUCUUA(SEQ ID NO：19)；

the forward primer sequence is CAGGGAGGTGCCTTGATGACATAGAAGAAGAACCA (SEQ ID NO: 20);

the reverse primer sequence was TAAGACGCTCGAAGAGTGAATTGAGGATCCGATG (SEQ ID NO: 21).

The volume of the reaction system used was 50. Mu.L, and the components thereof are shown in Table 4 below.

TABLE 4 isothermal nucleic acid amplification reaction system Components for WT-Klenow and MT-Klenow Activity comparison experiments

The amplification process was monitored by the fluorochrome molecule Eva Green, the results of which are shown in FIG. 2, in which

Fluorescence curve representing amplification using MT-Klenow, < >>

A fluorescence curve using WT-Klenow amplification is shown. As can be seen from FIG. 2, the modified MT-Klenow of the present invention has better reverse transcription and amplification efficiency than WT-Klenow.

Example 2: stem-loop structure primer and linear primer comparison test

The 3' end of the stem-loop structural primer is completely identical or completely complementary with the nucleic acid target sequence; 2-15nt of base is additionally added to the 5 'end of the primer, and the base is complementary with the 3' end of the primer to form a stem-loop structure; or 2-15nt of base is added outside the 5 'end, and the base is complementary with 1-10nt of base from the 3' end to form a stem-loop structure with a foothold.

According to the design principle of the stem-loop structure primer, the invention performs experimental comparison on the isothermal amplification reaction of a pair of common linear primers and the stem-loop structure primer thereof. Wherein the DNA template sequence is: 5'-GACAGACTGCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAGACGGGA-3' (SEQ ID NO: 1), common linear primers are: BRAF-F (SEQ ID NO: 2) and BRAF-R (SEQ ID NO: 3) respectively; the stem-loop structural primer is as follows: JH-BRAF-F (5' sequence:)CTCTTGAGCGCCAAGTCAATCATCCACAGAGACCTCAAGAG-3' (SEQ ID NO: 4)), JH-BRAF-R (SEQ ID NO: 4): 5' -CCATACACCAAATGCATATACATCTGACTGAAAGCTGTATGG-3' (SEQ ID NO: 5)). Here and below the base for pairing that is additionally added at the 5' end of the stem-loop structural primer is underlined in solid lines. The volume of the amplification reaction system was 50. Mu.L, and the components used are shown in Table 5 below.

TABLE 5 isothermal nucleic acid amplification reaction system components for primer pair experiments

The whole experimental procedure was repeated three times and the amplification procedure was monitored by the fluorochrome molecule Eva Green, the experimental results are shown in fig. 3. In the figure

Representing stem-loop structureThree sets of parallel fluorescence curves for the primers,

corresponding +.>

Is used as a negative control of the (c) in the test,

Respectively correspond to->

Is a negative control of (2). From the results, it can be seen that the stem-loop structure primer of the invention can significantly reduce non-specific amplification.

Example 3 detection of Influenza B Virus (Influenza B) containing samples Using RINA-CAS (LwCas 13 a) technology

First, a nucleic acid extraction was performed on an Influenza B (subtype B Influenza virus yamagata) sample, and the nucleic acid extraction kit was Qiagen's viral RNA extraction kit (QIAamp Viral RNA Mini Kit). Samples without Influenza B were used as negative controls.

Adding 1 μl of the extracted RNA into a nucleic acid amplification reaction system, and adding 10% concentration ^-5 Two amplification primers Influenza Primer F for M (SEQ ID NO: 5'ACCAACTTAATACGACTCACTATAGGTGAAACTGCGGTGGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 6)), influenza Primer R (sequence: 5' -TGGTTGTCACAAGCACTGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 7)) were incubated at 37℃for 15min at 2.4. Mu.L each. The designed primer is a conserved gene Influenza B NS1 aiming at the yamagata subtype of the Influenza B virus. The volume of the amplification reaction system was 50. Mu.L, and the components are shown in Table 6 below.

TABLE 6 isothermal amplification system composition for Influenza B sample amplification

Subsequently, 4 μl of the amplified product was removed and 20 μl of the detection solution containing LwCas13a (the LwCas13a-crRNA sequence contained therein was:

the wavy underlined sequence was used to bind to LwCas13a, the dashed underlined sequence was used to bind to the amplified product) and 1. Mu.L of RNA reporter (FAM-5 '-UUUU-3' -TAMAR) were mixed and incubated at 37℃for 30min. The total volume of the assay system was 25. Mu.L and the components are shown in Table 7 below.

TABLE 7 detection System composition for detection of amplified products Using LwCas13a

The whole experiment was repeated three times and the results are shown in fig. 4. In the figure

Three sets of parallel fluorescence curves representing detection of Influenza B actual samples are shown, < >>

Respectively correspond to

Is a negative control of (2). As can be seen from FIG. 4, the RINA-CAS technique of the present invention can successfully detect Influenza B samples by first performing isothermal amplification of the samples, followed by detection using a LwCas13 a-containing detection system.

Example 4: detection of Influenza B Virus (Influenza B) containing samples Using RINA-CAS (LbCAs 12 a) technology

First, a nucleic acid extraction was performed on an Influenza B (subtype B Influenza virus yamagata) sample, and the nucleic acid extraction kit was Qiagen's viral RNA extraction kit (QIAamp Viral RNA Mini Kit). Samples without Influenza B were also used as negative controls.

Adding 1 μl of extracted Influenza B RNA into a isothermal amplification reaction system, and adding 10% concentration ^-5 Two amplification primers Influenza Primer F for M (SEQ ID NO: 5'ACCAACTGAAACTGCGGTGGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 9)), influenza Primer R (sequence: 5' -TGGTTGTCACAAGCACTGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 10)) were incubated at 37℃for 15min at 2.4. Mu.L each. The volume of the amplification reaction system was 50. Mu.L, and the respective reaction components are shown in Table 8 below.

TABLE 8 isothermal amplification system composition for Influenza B sample amplification

Subsequently, 4. Mu.L of the amplified product was removed, and 20. Mu.L of the detection solution containing LbCAs12a (LbCAs 12acrRNA sequence contained therein was:

the sequence underlined with waves for binding to LbCAs12a, the sequence underlined with dotted lines for binding to the amplified product) and a DNA reporter (FAM-5' -T)TTTT-3' -TAMAR) 1. Mu.L, incubated at 37℃for 15min. The total volume of the assay system was 25. Mu.L and the components are shown in Table 9 below. />

TABLE 9 composition of detection System for detecting amplified products Using LbCAs12a

The whole experiment was repeated three times and the results are shown in fig. 5. In the figure

Respectively correspond to

Is a negative control of (2).

As can be seen from FIG. 5, the RINA-CAS technique of the present invention can successfully detect Influenza B samples by first performing isothermal amplification of the samples, followed by detection using a LwCas13 a-containing detection system.

Example 5: detection of identical Influenza B samples by fluorescent quantitative PCR

PCR amplification was performed on RNA extracted by the RNA extraction kit (QIAamp Viral RNA Mini Kit) in example 3 as a template to verify the presence of influenza B virus therein. The two PCR amplification primers are respectively as follows: PCR-F (SEQ ID NO: 12) and PCR-R (SEQ ID NO: 13) of sequence 5'-GGGAGTCTTATCCCAAGTTGGT-3'. The PCR reaction system and the procedure were as follows:

reverse transcription reaction system

PCR reaction system

PCR reaction procedure

Fluorescence signals were collected at the end of each cycle. The test was repeated three times using the sample without Influenza B as negative control. The reaction results are shown in FIG. 6. Wherein the method comprises the steps of

Corresponding +.>

Is a negative control of (2). As can be seen from the figure, the presence of influenza B virus in the samples used is consistent with the results obtained using the RINA-CAS technique used in example 3.

Example 6: detection of HPV samples using RINA-CAS (LwCas 13 a) technology

First, nucleic acid extraction was performed on HPV samples, and the nucleic acid extraction kit was a radix et rhizoma zingiberis rapid DNA extraction detection kit (purchased from radix et rhizoma zingiberis biochemical technologies (beijing) limited). Meanwhile, samples without HPV are used as negative control.

Adding 1 μl of extracted HPV DNA into the reaction system, and adding 10% concentration ^-5 M two amplification primers HPV Primer F (sequence: 5'ACAGTAATACGACTCACTATAGGTTTGTTGGGGTAACCAACTATTTGTTACTGT-3' (SEQ ID NO: 14)), HPV Primer R (SEQ ID NO: 5' -ACTGTGACGTCTGCAGTTAAGGTTATTTTGCACAGT-3’(SEQ ID NO:15 2.4. Mu.L each, incubated at 37℃for 15min. The isothermal amplification system was 50. Mu.L in volume, and the components are shown in Table 10 below.

TABLE 10 isothermal amplification system composition for HPV sample amplification

Subsequently, 4 μl of the amplified product was removed and incubated with 20 μl of detection solution containing LwCas13a (the LwCas13a-crRNA sequence contained therein is:

the wavy underlined sequence was used to bind to LwCas13a, the dashed underlined sequence was used to bind to the amplified product) and 1. Mu.L of RNA reporter (FAM-5 '-UUUU-3' -TAMAR) were mixed and incubated at 37℃for 30min. The total volume of the assay system was 25. Mu.L and the components are shown in Table 11 below.

TABLE 11 composition of detection System for detecting amplified products Using LbCAs13a

The whole experiment was repeated three times and the results are shown in fig. 7. In the figure

Corresponding +.>

Is a negative control of (2).

As can be seen from FIG. 7, the RINA-CAS technique of the present invention can successfully detect HPV samples by first performing isothermal amplification of the samples, followed by detection using a LwCas13 a-containing detection system.

Example 7: sensitivity of the RINA-CAS technique of the present invention to a variety of virus/bacteria samples

Plasmid/genome standards for multiple viral/bacterial detection targets were diluted to about 10 in gradient ⁵ Copy/. Mu.L, 10 ⁴ Copy/. Mu.L, 10 ³ Copy/. Mu.L, 10 ² Copy/. Mu.L, 10 ¹ Copy/. Mu.L, 10 ⁰ Copy/. Mu.L.

The diluted templates were subjected to isothermal nucleic acid amplification at 37℃for 15min, and then the results were compared with negative controls, and were judged as judgment standards, and the detection sensitivity results were shown in Table 11.

TABLE 11 results of sensitivity detection of different virus/bacteria by RINA-CAS technique of the invention

In the table "+" indicates a positive result and "-" indicates a negative result.

Related abbreviations: inf.a, influenza a; inf.B, influenza B; inf.C, influenza C; HPV, human papilloma virus; strep. A, streptococcus; RSV, respiratory syncytial virus; PTB, pulmonary tuberculosis, tuberculosis; MP, mycoplasma pneumoniae; CP, chlamydia pneumoniae; adV, adenovirus; EV, epstein-Barr virus Baer virus; boV, bocavirus; HRV, human rhinovirus.

The RINA-CAS technique of the invention has extremely high detection sensitivity, for example, the detection limit of Inf.A and the like is 5 copies, and the detection limit of HPV and the like is even as low as1 copy.

SEQUENCE LISTING

<110> Beijing Ai Kelun medical science and technology Co., ltd

<120> DNA primer pair having stem-loop structure and use thereof

<130> 18188CI-1F

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 313

<212> DNA

<213> artificial sequence

<400> 1

gacagactgc acagggcatg gattacttac acgccaagtc aatcatccac agagacctca 60

agagtaataa tatatttctt catgaagacc tcacagtaaa aataggtgat tttggtctag 120

ctacagagaa atctcgatgg agtgggtccc atcagtttga acagttgtct ggatccattt 180

tgtggatggc accagaagtc atcagaatgc aagataaaaa tccatacagc tttcagtcag 240

atgtatatgc atttggaatt gttctgtatg aattgatgac tggacagtta ccttattcaa 300

acatcagacg gga 313

<210> 2

<211> 33

<212> DNA

<213> artificial sequence

<400> 2

cgccaagtca atcatccaca gagacctcaa gag 33

<210> 3

<211> 35

<212> DNA

<213> artificial sequence

<400> 3

ccaaatgcat atacatctga ctgaaagctg tatgg 35

<210> 4

<211> 41

<212> DNA

<213> artificial sequence

<400> 4

ctcttgagcg ccaagtcaat catccacaga gacctcaaga g 41

<210> 5

<211> 42

<212> DNA

<213> artificial sequence

<400> 5

ccatacacca aatgcatata catctgactg aaagctgtat gg 42

<210> 6

<211> 60

<212> DNA

<213> artificial sequence

<400> 6

accaacttaa tacgactcac tataggtgaa actgcggtgg gagtcttatc ccaagttggt 60

<210> 7

<211> 38

<212> DNA

<213> artificial sequence

<400> 7

tggttgtcac aagcactgcc tgctgtacac ttcaacca 38

<210> 8

<211> 63

<212> RNA

<213> artificial sequence

<400> 8

ggggauuuag acuaccccaa aaacgaaggg gacuaaaaca aguaaaagaa uugaugauaa 60

cau 63

<210> 9

<211> 40

<212> DNA

<213> artificial sequence

<400> 9

accaactgaa actgcggtgg gagtcttatc ccaagttggt 40

<210> 10

<211> 38

<212> DNA

<213> artificial sequence

<400> 10

tggttgtcac aagcactgcc tgctgtacac ttcaacca 38

<210> 11

<211> 60

<212> RNA

<213> artificial sequence

<400> 11

guuucaaaga uuaaauaauu ucuacuaagu guagauaagu aaaagaauug augauaacau 60

<210> 12

<211> 22

<212> DNA

<213> artificial sequence

<400> 12

gggagtctta tcccaagttg gt 22

<210> 13

<211> 22

<212> DNA

<213> artificial sequence

<400> 13

tgcctgctgt acacttcaac ca 22

<210> 14

<211> 54

<212> DNA

<213> artificial sequence

<400> 14

acagtaatac gactcactat aggtttgttg gggtaaccaa ctatttgtta ctgt 54

<210> 15

<211> 36

<212> DNA

<213> artificial sequence

<400> 15

actgtgacgt ctgcagttaa ggttattttg cacagt 36

<210> 16

<211> 61

<212> RNA

<213> artificial sequence

<400> 16

ggggauuuag acuaccccaa aaacgaaggg gacuaaaacu cugaaguaga uauggcagca 60

c 61

<210> 17

<211> 605

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 17

Val Ile Ser Tyr Asp Asn Tyr Val Thr Ile Leu Asp Glu Glu Thr Leu

1 5 10 15

Lys Ala Trp Ile Ala Lys Leu Glu Lys Ala Pro Val Phe Ala Phe Asp

20 25 30

Thr Glu Thr Asp Ser Leu Asp Asn Ile Ser Ala Asn Leu Val Gly Leu

35 40 45

Ser Phe Ala Ile Glu Pro Gly Val Ala Ala Tyr Ile Pro Val Ala His

50 55 60

Asp Tyr Leu Asp Ala Pro Asp Gln Ile Ser Arg Glu Arg Ala Leu Glu

65 70 75 80

Leu Leu Lys Pro Leu Leu Glu Asp Glu Lys Ala Leu Lys Val Gly Gln

85 90 95

Asn Leu Lys Tyr Asp Arg Gly Ile Leu Ala Asn Tyr Gly Ile Glu Leu

100 105 110

Arg Gly Ile Ala Phe Asp Thr Met Leu Glu Ser Tyr Ile Leu Asn Ser

115 120 125

Val Ala Gly Arg His Asp Met Asp Ser Leu Ala Glu Arg Trp Leu Lys

130 135 140

His Lys Thr Ile Thr Phe Glu Glu Ile Ala Gly Lys Gly Lys Asn Gln

145 150 155 160

Leu Thr Phe Asn Gln Ile Ala Leu Glu Glu Ala Gly Arg Tyr Ala Ala

165 170 175

Glu Asp Ala Asp Val Thr Leu Gln Leu His Leu Lys Met Trp Pro Asp

180 185 190

Leu Gln Lys His Lys Gly Pro Leu Asn Val Phe Glu Asn Ile Glu Met

195 200 205

Pro Leu Val Pro Val Leu Ser Arg Ile Glu Arg Asn Gly Val Lys Ile

210 215 220

Asp Pro Lys Val Leu His Asn His Ser Glu Glu Leu Thr Leu Arg Leu

225 230 235 240

Ala Glu Leu Glu Lys Lys Ala His Glu Ile Ala Gly Glu Glu Phe Asn

245 250 255

Leu Ser Ser Thr Lys Gln Leu Gln Thr Ile Leu Phe Glu Lys Gln Gly

260 265 270

Ile Lys Pro Leu Lys Lys Thr Pro Gly Gly Ala Pro Ser Thr Ser Glu

275 280 285

Glu Val Leu Glu Glu Leu Ala Leu Asp Tyr Pro Leu Pro Lys Val Ile

290 295 300

Leu Glu Tyr Arg Gly Leu Ala Lys Leu Lys Ser Thr Tyr Thr Asp Lys

305 310 315 320

Leu Pro Leu Met Ile Asn Pro Lys Thr Gly Arg Val His Thr Ser Tyr

325 330 335

His Gln Ala Val Thr Ala Thr Gly Arg Leu Ser Ser Thr Asp Pro Asn

340 345 350

Leu Gln Asn Ile Pro Val Arg Asn Glu Glu Gly Arg Arg Ile Arg Gln

355 360 365

Ala Phe Ile Ala Pro Glu Asp Tyr Val Ile Val Ser Ala Asp Tyr Ser

370 375 380

Gln Ile Glu Leu Arg Ile Met Ala His Leu Ser Arg Asp Lys Gly Leu

385 390 395 400

Leu Thr Ala Phe Ala Glu Gly Lys Asp Ile His Arg Ala Thr Ala Ala

405 410 415

Glu Val Phe Gly Leu Pro Leu Glu Thr Val Thr Ser Glu Gln Arg Arg

420 425 430

Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly Met Ser Ala Phe

435 440 445

Gly Leu Ala Arg Gln Leu Asn Ile Pro Arg Lys Glu Ala Gln Lys Tyr

450 455 460

Met Asp Leu Tyr Phe Glu Arg Tyr Pro Gly Val Leu Glu Tyr Met Glu

465 470 475 480

Arg Thr Arg Ala Gln Ala Lys Glu Gln Gly Tyr Val Glu Thr Leu Asp

485 490 495

Gly Arg Arg Leu Tyr Leu Pro Asp Ile Lys Ser Ser Asn Gly Ala Arg

500 505 510

Arg Ala Ala Ala Glu Arg Ala Ala Ile Asn Ala Pro Met Gln Gly Thr

515 520 525

Ala Ala Asp Ile Ile Lys Arg Ala Met Ile Ala Val Asp Ala Trp Leu

530 535 540

Gln Ala Glu Gln Pro Arg Val Arg Met Ile Met Gln Val His Asp Glu

545 550 555 560

Leu Val Phe Glu Val His Lys Asp Asp Val Asp Ala Val Ala Lys Gln

565 570 575

Ile His Gln Leu Met Glu Asn Cys Thr Arg Leu Asp Val Pro Leu Leu

580 585 590

Val Glu Val Gly Ser Gly Glu Asn Trp Asp Gln Ala His

595 600 605

<210> 18

<211> 605

<212> PRT

<213> artificial sequence

<400> 18

Val Ile Ser Tyr Asp Asn Tyr Val Thr Ile Leu Asp Glu Glu Thr Leu

1 5 10 15

Lys Ala Trp Ile Ala Lys Leu Glu Lys Ala Pro Val Phe Ala Phe Asp

20 25 30

Thr Glu Thr Asp Ser Leu Asp Asn Ile Ser Ala Asn Leu Val Gly Leu

35 40 45

Ser Phe Ala Ile Glu Pro Gly Val Ala Ala Tyr Ile Pro Val Ala His

50 55 60

Asp Tyr Leu Asp Ala Pro Asp Gln Ile Ser Arg Glu Arg Ala Leu Glu

65 70 75 80

Leu Leu Lys Pro Leu Leu Glu Asp Glu Lys Ala Leu Lys Val Gly Gln

85 90 95

Asn Leu Lys Tyr Asp Arg Gly Ile Leu Ala Asn Tyr Gly Ile Glu Leu

100 105 110

Arg Gly Ile Ala Phe Asp Thr Met Leu Glu Ser Tyr Ile Leu Asn Ser

115 120 125

Val Ala Gly Arg His Asp Met Asp Ser Leu Ala Glu Arg Trp Leu Lys

130 135 140

His Lys Thr Ile Thr Phe Glu Glu Ile Ala Gly Lys Gly Lys Asn Gln

145 150 155 160

Leu Thr Phe Asn Gln Ile Ala Leu Glu Glu Ala Gly Arg Tyr Ala Ala

165 170 175

Glu Asp Ala Asp Val Thr Leu Gln Leu His Leu Lys Met Trp Pro Asp

180 185 190

Leu Gln Lys His Lys Trp Pro Leu Asn Val Phe Glu Asn Ile Glu Met

195 200 205

Pro Leu Val Pro Val Leu Ser Arg Ile Glu Arg Asn Gly Ile Lys Ile

210 215 220

Asp Pro Lys Val Leu His Asn His Ser Glu Glu Leu Thr Leu Arg Leu

225 230 235 240

Ala Glu Leu Glu Lys Lys Ala His Glu Ile Ala Gly Glu Glu Phe Asn

245 250 255

Leu Ser Ser Thr Lys Gln Leu Gln Thr Ile Leu Phe Glu Lys Gln Gly

260 265 270

Ile Lys Pro Leu Lys Lys Thr Pro Gly Gly Ala Pro Ser Thr Ser Glu

275 280 285

Glu Val Leu Glu Glu Leu Ala Leu Asp Tyr Pro Leu Pro Lys Val Ile

290 295 300

Leu Lys Tyr Arg Gly Leu Ala Lys Leu Lys Ser Thr Tyr Thr Asp Lys

305 310 315 320

Leu Pro Leu Met Ile Asn Pro Lys Thr Gly Arg Val His Thr Ser Tyr

325 330 335

His Gln Ala Val Thr Ala Thr Gly Arg Leu Ser Ser Thr Asp Pro Asn

340 345 350

Leu Glu Asn Ile Pro Val Arg Asn Glu Glu Gly Arg Arg Ile Arg Gln

355 360 365

Ala Phe Ile Ala Pro Glu Asp Tyr Val Ile Val Ser Glu Asp Tyr Ser

370 375 380

Gln Ile Glu Leu Arg Ile Met Ala His Leu Ser Arg Asp Lys Gly Leu

385 390 395 400

Leu Thr Ala Phe Ala Glu Gly Lys Asp Ile His Arg Ala Thr Ala Ala

405 410 415

Glu Val Phe Gly Leu Pro Leu Glu Thr Val Thr Ser Glu Gln Arg Arg

420 425 430

Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly Met Ser Ala Phe

435 440 445

Gly Leu Ala Arg Gln Leu Asn Ile Pro Arg Lys Glu Ala Gln Lys Tyr

450 455 460

Met Asp Leu Tyr Phe Glu Arg Tyr Pro Gly Val Leu Glu Tyr Met Glu

465 470 475 480

Arg Thr Arg Ala Gln Ala Lys Glu Gln Gly Tyr Val Glu Thr Leu Asp

485 490 495

Gly Arg Arg Leu Tyr Leu Pro Asp Ile Lys Ser Ser Asn Gly Ala Arg

500 505 510

Arg Ala Ala Ala Glu Arg Ala Ala Ile Asn Ala Pro Met Gln Gly Thr

515 520 525

Ala Ala Asp Ile Ile Lys Arg Ala Met Ile Ala Val Asp Ala Trp Leu

530 535 540

Gln Ala Glu Gln Pro Arg Val Arg Met Ile Met Gln Val His Asp Glu

545 550 555 560

Leu Val Phe Glu Val His Lys Asp Asp Val Asp Ala Val Ala Lys Gln

565 570 575

Ile His Gln Leu Met Lys Asn Cys Thr Arg Leu Asp Val Pro Leu Leu

580 585 590

Val Glu Val Gly Ser Gly Glu Asn Trp Asp Gln Ala His

595 600 605

<210> 19

<211> 369

<212> RNA

<213> artificial sequence

<400> 19

cagggaggug ccuugaugac auagaagaag aaccagauga uguugauggc ccaacugaaa 60

uaguauuaag ggacaugaac aacaaagaug caaggcaaaa gauaaaggag gaaguaaaca 120

cucagaaaga agggaaguuc cguuugacaa uaaaaaggga uaugcguaau guauuguccc 180

ugagaguguu aguaaacgga acauuccuca aacaccccaa uggauacaag uccuuaucaa 240

cucugcauag auugaaugca uaugaccaga guggaaggcu uguugcuaaa cuuguugcua 300

cugaugagcu uacaguggag gaugaagaag auggccaucg gauccucaau ucacucuucg 360

agcgucuua 369

<210> 20

<211> 35

<212> DNA

<213> artificial sequence

<400> 20

cagggaggtg ccttgatgac atagaagaag aacca 35

<210> 21

<211> 34

<212> DNA

<213> artificial sequence

<400> 21

taagacgctc gaagagtgaa ttgaggatcc gatg 34

<210> 22

<211> 18

<212> DNA

<213> artificial sequence

<400> 22

taatacgact cactatag 18

Claims

DNA primer pair when using a DNA primer set having the amino acid sequence shown in SEQ ID NO:18, wherein:

either or both of the pair of DNA primers has a stem-loop structure; wherein the stem-loop structure is formed by adding 2 to 15 bases to the 5 '-end of a linear DNA primer complementary to a template sequence, the 2 to 15 bases being complementary to the 3' -end sequence of the linear DNA primer;

the DNA polymerase is obtained by carrying out the following amino acid substitutions on Klenow large fragment of the escherichia coli polymerase I: G198W, V222I, E306K, Q E, A381E and E582K.
2. The use of claim 1, wherein either or both of the DNA primer pairs are 33 to 45 bases in length; or a T7 promoter sequence is also added to the 5' end of the linear primer, the length of either or both of the DNA primer pair is 51 to 63 bases.