CN101792817B - Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit - Google Patents
Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit Download PDFInfo
- Publication number
- CN101792817B CN101792817B CN2009101543112A CN200910154311A CN101792817B CN 101792817 B CN101792817 B CN 101792817B CN 2009101543112 A CN2009101543112 A CN 2009101543112A CN 200910154311 A CN200910154311 A CN 200910154311A CN 101792817 B CN101792817 B CN 101792817B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- ihhnv
- pipe
- prawn
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) nucleic acid isothermal amplification detection kit which comprises a grinding fluid tube containing a grinding fluid, a nucleic acid extracting solution tube A containing a sodium acetate solution, a nucleic acid extracting solution tube B containing absolute ethyl alcohol, a nucleic acid extracting solution tube C containing an alcohol solution with a mass concentration of 70 percent, a TE (tellurium) buffer solution tube containing a TE buffer solution, a UNG (uracil-DNA glycosidase) enzyme tube containing uracil DNA (deoxyribonucleic acid) glycosylase, an LAMP (Loop-mediated isothermal amplification) reaction liquid tube containing an LAMP reaction liquid, a Bst DNA polymerase tube containing Bst DNA polymerase, a color-developing agent tube containing nucleic acid dye SYBR Green I, a positive control nucleic acid tube containing prawn IHHNV positive DNA and a negative control tube containing sterilizing double distilled water. The invention also provides a method for detecting the prawn IHHNV by utilizing the detection kit. The method has the characteristics of low cost, high detection sensitivity and easy site operation.
Description
Technical field
The present invention relates to aquatic animal cause of disease detection technique, specifically relate to the prawn infectivity is subcutaneous and hematopoietic tissue necrosis is viral nucleic acid isothermal amplification detection kit and detection method.
Background technology
Infectivity is subcutaneous and hematopoietic tissue necrosis is viral (IHHNV) comes to light in shore, the thin angle prawn (Litopenaeus stylirostris) that culture in the area, Hawaii at first; It is wide to distribute; Harm is serious, causes mortality ratio up to more than 90%, and can infect cultured prawn all over the world; Be one of other important diseases of crustaceans of International Office of Epizootics (OIE) delimitation, great to world's prawn culturing career development influence.In the multiple virus that can infect Penaeus vannamei (Penaeus vannamei); IHHNV can cause chronic short and small incomplete syndromes (Runt-deformity syndrome; Be called for short RDS), though can not cause the prawn mass mortality, in fact virus infection can cause heavy losses economically.Infect the Penaeus vannamei of IHHNV, abnormal rate is high, and individual growth otherness is big, and bait efficient is poor, and commodity value is low, and output is on the low side, and whole culturing economic loss maybe be up to 50%.Discover that infecting the Penaeus vannamei that infectivity is subcutaneous and hematopoietic tissue necrosis is viral or survive in ill back can be with poison throughout one's life, and can pass to of future generation and other populations to virus through vertical and horizontal transmission mode.
At present, the detection method of relevant IHHNV mainly contains five kinds, the-kind be the electron microscopic observation method, second kind is the HE staining, and the third is an antibody testing method, and the 4th kind is the nucleic acid probe hybridization method, and the 5th kind is the PCR detection method.Though Electron Microscopy can directly be observed the existence of virus particle, complicated operation, expend time in long, cost is high.The HE staining can not directly be checked virus based on pathological technique, can only utilize the histopathology sign of morbidity to detect.Antibody testing method and nucleic acid probe hybridization method are that protein or nucleic acid component of virus itself detected, and its detection sensitivity is lower, and is consuming time longer, and the prawn that can only be used to fall ill prawn or be about to morbidity detects; IHHNV causes infection as yet or is difficult to detect with above method at the extremely early stage of infection.The PCR detection method of IHHNV; Though overcome the shortcoming of preceding four kinds of methods; Under laboratory condition, can realize quick relatively, accurately detection to IHHNV; But because conventional PCR detections needs PCR appearance, gel electrophoresis and the imaging system of costliness, and detection time is long slightly, also big limitations PCR detection method applying in production reality.
The ring mediated isothermal amplification method (LAMP) that development in recent years is got up; Can be the with sensitivity efficient very selectively amplified target sequence of this method; Final LAMP product is the loop-stem structure and the dna fragmentation mixtures that encircle the Cauliflower spline structures that a series of reverse multiple target sequences constitute more, on gel, manifests the staged collection of illustrative plates that different big sub-districts band is formed behind the electrophoresis.LAMP is a kind of novel constant temperature nucleic acid amplification method, compares with other nucleic acid amplification technologies, and its reaction principle, design of primers are complicated more, but it has isothermal duplication: only need a thermostat just passable; Efficient and sensible: template only needs 10 copies or still less; Specific amplification is strong: use four primers that comprised six sections and increase in proper order by strictness; Detection time is short: amplification can be accomplished in 60min, will save time than common PCR reaction; Product can be through directly adding fluorescent dye or with advantages such as agarose gel electrophoresis detections in reaction tubes.Therefore LAMP has obtained increasingly extensive application in fields such as the sex identification of the diagnosis of the scientific research of nucleic acid, disease and prevention, animal embryo and genetically modified foodGMF detections.
Summary of the invention
The technical problem that the present invention will solve provides that a kind of cost is low, detection sensitivity is high and the prawn IHHNV detection method of easy execute-in-place and used nucleic acid isothermal amplification detection kit.
In order to solve the problems of the technologies described above, the present invention provides a kind of prawn IHHNV nucleic acid isothermal amplification detection kit, and this test kit comprises:
(1), the lapping liquid pipe: interior dress lapping liquid,
(2), nucleic acid extraction liquid A pipe: interior dress sodium acetate solution,
(3), nucleic acid extraction liquid B pipe: interior dress absolute ethyl alcohol,
(4), nucleic acid extraction liquid C pipe: the ethanolic soln of interior packing quality concentration 70%,
(5), TE damping fluid pipe: interior dress TE damping fluid;
(6), UNG enzyme pipe: interior dress uracil dna glycosylase;
(7), LAMP reaction solution pipe: interior dress LAMP reaction solution;
(8), Bst archaeal dna polymerase pipe: interior dress Bst archaeal dna polymerase;
(9), developer pipe: interior dress nucleic acid dye SYBR Green I;
(10), positive control nucleic acid pipe: the positive DNA of interior dress prawn IHHNV;
(11), negative control pipe: the distilled water of interior dress sterilization.
Improvement as prawn IHHNV nucleic acid isothermal amplification detection kit of the present invention: lapping liquid is made up of the component of following parts by volume: 5～10 parts of the tris solutions of 1～2M; 0.25 0.5～2.0 part of the disodium ethylene diamine tetra-acetic acid solution of～1.0M; 5～10 parts of the sodium dodecyl sulfate solutions of mass concentration 5～10%, 0.01～1.0 part of mercaptoethanol, 0.01～0.02 part of oxine; 5～10 parts of balance phenols and 5～10 parts of chloroforms are with distilled water constant volume to 100 part.
Further improvement as prawn IHHNV nucleic acid isothermal amplification detection kit of the present invention: the LAMP reaction solution is made up of following component: each 1～4 μ M of LAMP primer I HHNV-FIP and IHHNV-BIP; Each 0.1～0.5 μ M of LAMP primer I HHNV-F3 and IHHNV-B3; Each 0.5～2mM of dATP, dGTP and dCTP, dTTP, each 0.25～1mM of dUTP, Tris-HCl 10～40mM; KCl 10～20mM, (NH
4)
2SO
45～15mM, MgSO
41～4mM, TritonX-1000.05%～1.0%, Betaine 0.8～1.2M; All the other are distilled water.
Further improvement as prawn IHHNV nucleic acid isothermal amplification detection kit of the present invention: the nucleotide sequence of LAMP primer is following:
IHHNV-FIP(SEQ?ID?NO.1)：
5′-GTCCTTGGAGTACAAGAGTGTTTATTTTTAATCTTAGCTTGGATAATCATCGT；
IHHNV-BIP(SEQ?ID?NO.2)：
5′-GAAAATCTCTTACCATCGGTGCATTTTGAAGGTGTTTGAGTCTCCT；
IHHNV-F3(SEQ?ID?NO.3)：
5′-CGACATCCGTGTACCAGA；
IHHNV-B3(SEQ?ID?NO.4)：
5′-AGAGCGTAGGACTTTCCG。
The present invention also provides the subcutaneous and hematopoietic necrosis virus's of the detection prawn infectivity of utilizing detection kit to carry out method, comprises the following steps:
(1), the cephalothorax of getting the product to be tested prawn organizes 0.2g to place centrifuge tube I, adds the 0.5ml lapping liquid, fully is milled to pulpous state with grinding rod;
(2), the pulpous state sample with above-mentioned grinding gained boils (100 ℃ 10min) afterwards with the centrifugal 5min of 10000r/min, are got supernatant and place centrifuge tube II;
(3), in centrifuge tube II, add the sodium acetate solution mixing in the nucleic acid extraction liquid A pipe, the volume ratio of said sodium acetate solution and supernatant is 1/10; The interior absolute ethyl alcohol of nucleic acid extraction liquid B pipe that adds-20 ℃ of precoolings again mixes, and leaves standstill 10min, with the centrifugal 5min of 12000r/min, abandons supernatant, keeps throw out, and the volume ratio of said absolute ethyl alcohol and supernatant is 2: 1;
(4), with the throw out of the washing of the ethanolic soln in nucleic acid extraction liquid C pipe above-mentioned steps (3) gained, then with the centrifugal 5min of 12000r/min, abandoning supernatant, and keep throw out;
(5), with the throw out of the washing of the ethanolic soln in nucleic acid extraction liquid C pipe above-mentioned steps (4) gained, then with the centrifugal 5min of 12000r/min, abandoning supernatant, and keep throw out;
(6), the throw out of above-mentioned steps (5) gained is dried in room temperature, add 20 μ l TE damping fluid dissolution precipitation things, obtain sample nucleic acid;
(7), respectively with the positive control nucleic acid 2 μ l in the distilled water in above-mentioned sample nucleic acid, the negative control pipe, the positive control nucleic acid pipe, add 21 μ l LAMP reaction solutions, add 1 μ l UNG enzyme again, respectively detector tube, negative control pipe and positive control pipe; Above-mentioned detector tube, negative control pipe and positive control Guan Jun are carried out enzymolysis in 37 ℃ of insulation 10min;
(8), the reaction system behind above-mentioned detector tube, negative control pipe and the positive control pipe enzymolysis is operated respectively as follows:, and then place rubble ice 5min rapidly prior to 95 ℃ of insulation 5min;
(9), in the reaction system of detector tube, negative control pipe and the positive control pipe of step (8) gained, add 1 μ lBst archaeal dna polymerase and 1 μ l nucleic acid dye SYBR Green I more respectively;
(10), the detector tube with above-mentioned steps (9) gained, negative control pipe and positive control pipe are operated respectively as follows: prior to 64 ℃ of insulation 45min, accomplish the LAMP reaction in 90 ℃ of insulation 2min then;
(11), after LAMP reaction finishes, if the color of LAMP reaction product is with the color of LAMP reaction product in the negative control pipe in the detector tube, then product to be tested IHHNV detected result is negative; If the color of LAMP reaction product is with the color of LAMP reaction product in the positive control pipe in the detector tube, then product to be tested IHHNV detected result is positive.
In test kit of the present invention, raw material can obtain with commercial mode, for example EDTA Disodium, Tutofusin tris, sodium lauryl sulphate, sodium-acetate, chloroform, balance phenol, mercaptoethanol, oxine, MgCl
2, dATP, dGTP, dCTP, dTTP be available from Shanghai biotechnology Ltd; DUTP dodges brilliant molecular biosciences Science and Technology Ltd. available from Shanghai; Uracil dna glycosylase (UNG enzyme), Bst DNA polymerization are dark etc. available from U.S. NEB company; Nucleic acid dye SYBR Green I is available from Beijing ancient cooking vessel state bio tech ltd, and Betaine, Triton X-100 are available from Sigma company.LAMP primer I HHNV-FIP, IHHNV-BIP, IHHNV-F3 and IHHNV-B3 and PCR primer I HHNV-Pf, IHHNV-Pr can entrust U.S. invitrogen (Shanghai) Ying Jun Bioisystech Co., Ltd synthetic.
The acquisition mode of the positive DNA of prawn IHHNV is: susceptible prawn sample picks up from Xiaoshan, Zhejiang prawn culturing field; Extract template DNA according to step 1) of the present invention～step 6); With PCR primer I HHNV-Pf and IHHNV-Pr it is expanded; Reaction system is: 25 μ l systems comprise 2.5 μ l, 10 * PCR reaction buffer, 1.0 μ l dNTPs (10mM), 1.0 μ lIHHNV-Pf and IHHNV-Pr (20 μ M), 0.5 μ l Taq archaeal dna polymerase (5U/ μ l; Beijing ancient cooking vessel state bio tech ltd), all the other are distilled water.Extender is: 94 ℃ of preparatory sex change 5min, get into amplification cycles afterwards, and 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 60s and accomplish an amplification cycles, recirculation 30 times, last 72 ℃ of 10min, 4 ℃ of preservations.Increase the band of 523bp; After reclaiming this fragment; Be connected on the T carrier (pMD-18T-Vector is available from the precious biotech firm in Dalian) by the requirement of T carrier specification sheets, and press the competent cell operational requirement with recombinant plasmid transformed to competent cell JM109 (available from Dalian treasured biotech firm); With blue hickie method screening positive bacteria, and carry out PCR with primer I HHNV-Pf and IHHNV-Pr and verify (program is the same).Extract the plasmid of positive bacteria at last with alkaline process, as the positive DNA of IHHNV.
IHHNV is by Lightner D V for virus, Redman R M, and people such as Bell T A find report first in nineteen eighty-three in the U.S. thin angle shore prawn and Penaeus vannamei.The GenBank sequence number of IHHNV DNA is: EF633688, the target sequence position is: 2195-2410.
In the step of detection method of the present invention (7), eliminate template through the UNG enzyme that in the prawn sample nucleic acid that extracts, adds 1 unit and pollute interference detected result.In step (9), add nucleic acid dye in advance, can avoid the detection reaction result that uncaps, greatly reduce the generation possibility that template is polluted, further reduced false-positive generation.
With the LAMP compared with techniques of other reports, one of core of the present invention is to the IHHNV genome, and preferred goal gene section designs the LAMP Auele Specific Primer, make this primer can effectively detect institute's toxic strain of IHHNV, and detection specificity is good; Two of core is to carry out the processing of sample with custom-designed lapping liquid, makes that the treating processes of sample is extremely simple; Three of core is to adopt the uridylic glycosylase to eliminate the pollution of LAMP amplified production, has avoided very easily making test sample pollute the false positive results that causes because LAMP detection method product amplification amount is very big; Four of core is to use the not nucleic acid dye of inhibited reaction, has realized covered detection, has avoided the generation of polluting from the source, has further reduced the appearance of false positive results; Five of core is technical parameters of having optimized the entire operation process, and with its stdn, supportingization, forms detection kit, so that rig-site utilization.
Therefore; Positively effect of the present invention is: in test kit, compile IHHNV and detect ten kinds of reagent and three kinds of equipment such as required lapping liquid, nucleic acid extraction liquid; Make the detection of IHHNV to carry out in an orderly manner; Realized that testing process is on-the-spot, sequencing and stdn, make working specification, be difficult for makeing mistakes; Kit test method of the present invention is to be that main body designs with the cover LAMP primer according to IHHNV gene conserved regions sequences Design, thus IHHNV is detected had fully the LAMP technology sensitive, quick, safe and easy, detect characteristics more accurately; Adopt covered detection in test kit of the present invention and the detection method simultaneously; Pollute the possibility that produces thereby reduced; The UNG enzyme can thoroughly be eliminated the false positive that the pollution of repeated detection process amplifying nucleic acid causes in addition, has solved easy the to be contaminated interferential problem of restriction LAMP technology widespread use.Use test kit of the present invention and detection method in 2 hours, just can accomplish the detection of prawn IHHNV, testing process need not expensive plant and instrument such as PCR appearance and gel imaging system, only need have water-bath or metal bath and whizzer to get final product; And detected result is very easy to differentiate; Compare with the existing detection technique of prawn IHHNV, test kit of the present invention and corresponding method of detection cost are low, can realize that cultivation site detects, and detection sensitivity are high, and the copy that detects virus can be low to moderate 100.In a word; Method of the present invention has the specificity higher than regular-PCR detection method, susceptibility and convenience, can substitute subcutaneous and hematopoietic necrosis virus's related detecting method such as electron microscopic observation method, HE staining, antibody testing method, nucleic acid probe hybridization and the PCR detection method before of prawn infectivity.
Embodiment
Below through embodiment the present invention is described further (in the solution be solvent with the distilled water).
Embodiment 1, a kind of prawn IHHNV nucleic acid isothermal amplification detection kit (5 kinds of parts promptly can be used for 5 kinds times detection), it is made up of following content:
(1) lapping liquid pipe, 1 pipe, 3ml.
Lapping liquid preparation: the tris solution of 1M (Tris-HCl, pH8.0) 10 parts, the disodium ethylene diamine tetra-acetic acid solution (EDTANa of 0.25M
2) 2 parts, 10 parts of the sodium dodecyl sulfate solutions of massfraction 5% (SDS), 0.5 part of mercaptoethanol, 0.01 part of oxine, 7 parts of balance phenols, 8 parts of chloroforms part form with distilled water constant volume to 100.Above umber is parts by volume.
(2) nucleic acid extraction liquid A pipe, 1 pipe, in adorn 400 μ l 3M sodium acetate solutions (NaAc, pH5.2).
(3) nucleic acid extraction liquid B pipe, 1 pipe, interior dress 10ml absolute ethyl alcohol.
(4) nucleic acid extraction liquid C pipe, 1 pipe, the ethanolic soln of interior dress 10ml mass concentration 70%.
(5) TE damping fluid pipe, 1 pipe, in adorn 400 μ l TE damping fluids (contain 10mM Tris-HCl and 1mM EDTA, pH8.0, all the other are distilled water).
(6) UNG enzyme pipe, 1 pipe, in adorn the uracil dna glycosylase (UNG enzyme) of 6 units (U),
(7) LAMP reaction solution pipe, 1 the pipe, in adorn 150 μ l LAMP reaction solutions,
The moity of LAMP reaction solution is following: each 2 μ M of LAMP primer I HHNV-FIP and IHHNV-BIP, each 0.3 μ M of LAMP primer I HHNV-F3 and IHHNV-B3, each 1mM of dATP, dGTP and dCTP; DTTP, each 0.5mM of dUTP; Tris-HCl 20mM, KCl 15mM, (NH
4)
2SO
410mM, MgSO
42mM, Triton X-100 0.5% (mass concentration), Betaine 1M; All the other are distilled water.
LAMP primer described in the above-mentioned IHHNV gene detecting kit is according to IHHNV gene conserved regions sequences Design; The first-selected software of LAMP design of primers is PrimerExplore 4.0 (http://primerexplorer.jp/elamp4.0.0/index.html), also can use primer-design software commonly used (like PrimerPrimier 5.0 or Omiga 2.0) to require to carry out design of primers according to the LAMP primer design.Utilize among the present invention software PrimerExplore 4.0 online designs-dna sequence dna of cover LAMP primer is following:
IHHNV-FIP：
5′-GTCCTTGGAGTACAAGAGTGTTTATTTTTAATCTTAGCTTGGATAATCATCGT；
IHHNV-BIP：
5′-GAAAATCTCTTACCATCGGTGCATTTTGAAGGTGTTTGAGTCTCCT；
IHHNV-F3：
5′-CGACATCCGTGTACCAGA；
IHHNV-B3：
5′-AGAGCGTAGGACTTTCCG。
(8) BstDNA polysaccharase pipe, 1 the pipe, in adorn 5 μ l BstDNA polysaccharases.
(9) developer pipe, 1 pipe, in adorn the liquid dye of 5 μ l, these liquid dye by nucleic acid dye SYBR Green I and distilled water according to 1: 100 volume ratio mixing and get.
(10) positive control nucleic acid pipe, 1 pipe, in adorn the positive DNA of 10 μ l prawn IHHNV.
The preparation method is following: be positioned at LAMP target fragment upstream and downstream the PCR primer (IHHNV-Pf [SEQ IDNO.5]: 5 '-GAAAACCAGACTACGACAAT; IHHNV-Pr [SEQ ID NO.6]: 5 '-TCGTACTGGCTGTTCATC), IHHNV being increased, amplification condition is: 94 ℃ of preparatory sex change 5min get into amplification cycles afterwards; 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 60s and accomplish an amplification cycles, recirculation 30 times; Last 72 ℃ of 10min, 4 ℃ of preservations obtain the band of 523bp; After reclaiming this fragment, be connected to carrier pMD-18T-Vector, and transformed into escherichia coli competent cell JM109; After the PCR checking, extract plasmid, be diluted to 100copies/ μ l as the IHHNV positive control.
The source of this IHHNV is: susceptible prawn sample picks up from Xiaoshan, Zhejiang prawn culturing field, extracts template DNA, with PCR primer I HHNV-Pf and IHHNV-Pr it is expanded, and reclaims the 523bp band of amplification, through the order-checking comparison, confirms as the dna sequence dna of IHHNV.
(11) negative control pipe, 1 pipe, in adorn 10 μ l sterilization distilled water.
(12) grinding rod, 5.
(13) packing box (78 * 78 * 50mm).
(14) cystoses, foam plate hight 22mm has three row holes, four holes of Di-Lie, aperture 5.5mm, three skies of secondary series, aperture 10mm, three skies of the 3rd row, aperture 15.5mm.Each tubule of above-mentioned 1～11 is positioned in these apertures, and this cystose is identical with the bottom surface size of above-mentioned packing box, is loaded in the packing box.
(15) test kit working instructions-part.
Embodiment 2, a kind of prawn IHHNV nucleic acid isothermal amplification detection kit (5 kinds of parts), its only following content is different from embodiment 1, and all the other are all with embodiment 1.
Lapping liquid preparation: the tris solution of 2M (Tris-HCl, pH8.0) 5 parts, the disodium ethylene diamine tetra-acetic acid solution (EDTANa of 0.5M
2) 1 part, 7 parts of the sodium dodecyl sulfate solutions of massfraction 7% (SDS), 0.01 part of mercaptoethanol, 0.02 part of oxine, 5 parts of balance phenols, 10 parts of chloroforms part form with distilled water constant volume to 100.Above umber is parts by volume.
The moity of LAMP reaction solution is following: each 4 μ M of LAMP primer I HHNV-FIP and IHHNV-BIP, each 0.5 μ M of LAMP primer I HHNV-F3 and IHHNV-B3, each 2mM of dATP, dGTP and dCTP; DTTP, each 1.0mM of dUTP; Tris-HCl 40mM, KCl 20mM, (NH
4)
2SO
415mM, MgSO
44mM, Triton X-1001.0%, Betaine 0.8M; All the other are distilled water.
Embodiment 3, a kind of prawn IHHNV nucleic acid isothermal amplification detection kit (5 kinds of parts), its only following content is different from embodiment 1, and all the other are all with embodiment 1.
Lapping liquid preparation: the tris solution of 1.5M (Tris-HCl, pH8.0) 7 parts, the disodium ethylene diamine tetra-acetic acid solution (EDTANa of 1.0M
2) 0.5 part, 5 parts of the sodium dodecyl sulfate solutions of massfraction 10% (SDS), 0.01 part of mercaptoethanol, 0.015 part of oxine, 10 parts of balance phenols, 10 parts of chloroforms part form with distilled water constant volume to 100.Above umber is parts by volume.
The moity of LAMP reaction solution is following: each 1 μ M of LAMP primer I HHNV-FIP and IHHNV-BIP, each 0.25 μ M of LAMP primer I HHNV-F3 and IHHNV-B3, each 0.5mM of dATP, dGTP and dCTP; DTTP, each 0.5mM of dUTP; Tris-HCl 40mM, KCl 10mM, (NH
4)
2SO
45mM, MgSO
41mM, Triton X-1000.05%, Betaine 0.8M; All the other are distilled water.
Embodiment 4, a kind of method that detects the subcutaneous and hematopoietic necrosis virus of prawn infectivity are utilized any one detection kit of embodiment 1～embodiment 3, carry out following steps successively:
(1), the cephalothorax of getting the product to be tested prawn organizes 0.2g to place centrifuge tube I, adds the 0.5ml lapping liquid in the lapping liquid pipe, fully is milled to pulpous state with grinding rod;
(2), the pulpous state sample with above-mentioned grinding gained boils (100 ℃ 10min) afterwards with the centrifugal 5min of 10000r/min, are got supernatant and place centrifuge tube II;
(3), in centrifuge tube II, add the sodium acetate solution mixing in the nucleic acid extraction liquid A pipe, the volume ratio of sodium acetate solution and step (2) gained supernatant is 1/10; The interior absolute ethyl alcohol of nucleic acid extraction liquid B pipe that adds-20 ℃ of precoolings again mixes, and leaves standstill 10min, with the centrifugal 5min of 12000r/min, abandons supernatant, keeps throw out, and the volume ratio of absolute ethyl alcohol and step (2) gained supernatant is 2: 1;
(4), with the throw out of the washing of the 1ml ethanolic soln in nucleic acid extraction liquid C pipe above-mentioned steps (3) gained, then with the centrifugal 5min of 12000r/min, abandoning supernatant, and keep throw out;
(5), with the throw out of the washing of the 1ml ethanolic soln in nucleic acid extraction liquid C pipe above-mentioned steps (4) gained, then with the centrifugal 5min of 12000r/min, abandoning supernatant, and keep throw out;
(6), with above-mentioned steps 5) throw out (being positioned at the bottom of centrifuge tube II) of gained dries in room temperature, adds 20 μ l TE damping fluid dissolution precipitation things in the TE damping fluid pipe, obtains sample nucleic acid;
(7), respectively among the positive control nucleic acid 2 μ l in the distilled water in above-mentioned sample nucleic acid, negative control pipe, the positive control nucleic acid pipe; Add 21 μ l LAMP reaction solutions; Add 1 μ l UNG enzyme again, thereby get detector tube, negative control pipe and positive control pipe respectively; Above-mentioned detector tube, negative control pipe and positive control Guan Jun are carried out enzymolysis in 37 ℃ of insulation 10min; Purpose is the pollution template that wherein possibly exist with the enzymolysis removing method;
(8), the reaction system behind above-mentioned detector tube, negative control pipe and the positive control pipe enzymolysis is operated respectively as follows:, and then place rubble ice 5min rapidly prior to 95 ℃ of insulation 5min;
(9), in the reaction system of detector tube, negative control pipe and the positive control pipe of step (8) gained, add 1 μ l Bst archaeal dna polymerase and 1 μ l nucleic acid dye SYBR Green I more respectively;
(10), the detector tube with above-mentioned steps (9) gained, negative control pipe and positive control pipe are not operated as follows: prior to 64 ℃ of insulation 45min, accomplish the LAMP reaction in 90 ℃ of insulation 2mi then;
(11), after LAMP reaction finishes, with the LAMP reaction product that eyes are observed sample, the positive control pipe shows blue-greenish colour, the negative control pipe shows purple.If detector tube shows blue-greenish colour then representes that the IHHNV detected result of this sample is positive,, detector tube representes that then the IHHNV detected result of this sample is negative if showing purple.
The contrast experiment 1: (confirmed to infect IHHNV with same Penaeus vannamei; Pick up from Xiaoshan, Zhejiang prawn culturing field shrimp appearance) as testing sample; Utilize the test kit among the embodiment 1, prepare the detection template (being sample nucleic acid) of natural infection IHHNV prawn by step (1) among the embodiment 4～method of step (6).Above-mentioned template (the infection IHHNV prawn dna profiling that promptly extracts) is carried out 10 with the TE damping fluid
1, 10
2, 10
3, 10
4, 10
5, 10
6, 10
7Times serial dilution detects template as LAMP and PCR respectively.
1), according to step (7) among the embodiment 4～said method of step (11), respectively to 10
1-10
7Template is checked.
2), carrying out PCR with same template detects use primer I HHNV-Pf and IHHNV-Pr.
The result shows that LAMP reaction of the present invention can detect 10
6The template of doubly diluting, and PCR can only detect to 10
3The template of doubly diluting, the remolding sensitivity PCR that LAMP detects is high 1000 times, and the time spent is still less, and equipment is simpler.
The contrast experiment 2: as testing sample, utilize the test kit among the embodiment 2 with same Penaeus vannamei, experiment method is with contrast experiment 1.
The result shows: LAMP reaction of the present invention can detect 10
6The template of doubly diluting, and PCR can only detect to 10
3The template of doubly diluting.
The contrast experiment 3: as testing sample, utilize the test kit among the embodiment 3 with same Penaeus vannamei, experiment method is with contrast experiment 1.
The result shows: LAMP reaction of the present invention can detect 10
6The template of doubly diluting, and PCR can only detect to 10
3The template of doubly diluting.
At last, it is also to be noted that what more than enumerate only is several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.
Sequence table
SEQ?ID?NO.1
gtccttggag?tacaagagtg?tttattttta?atcttagctt?ggataatca?tcgt 53
SEQ?ID?NO.2
gaaaatctct?taccatcggt?gcattttgaa?ggtgtttgag?tctcct 46
SEQ?ID?NO.3
cgacatccgt?gtaccaga 18
SEQ?ID?NO.4
agagcgtagg?actttccg 18
SEQ?ID?NO.5
gaaaaccaga?ctacgacaat 20
SEQ?ID?NO.6
tcgtactggc?tgttcatc 18
Claims (3)
1. prawn IHHNV nucleic acid isothermal amplification detection kit is characterized in that this test kit comprises:
(1), the lapping liquid pipe: interior dress lapping liquid,
(2), nucleic acid extraction liquid A pipe: interior dress sodium acetate solution,
(3), nucleic acid extraction liquid B pipe: interior dress absolute ethyl alcohol,
(4), nucleic acid extraction liquid C pipe: the ethanolic soln of interior packing quality concentration 70%,
(5), TE damping fluid pipe: interior dress TE damping fluid;
(6), UNG enzyme pipe: interior dress uracil dna glycosylase;
(7), LAMP reaction solution pipe: interior dress LAMP reaction solution;
The nucleotide sequence of the LAMP primer in the LAMP reaction solution is following:
IHHNV-FIP：
5′-GTCCTTGGAGTACAAGAGTGTTTATTTTTAATCTTAGCTTGGATAATCATCGT；
IHHNV-BIP：
5′-GAAAATCTCTTACCATCGGTGCATTTTGAAGGTGTTTGAGTCTCCT；
IHHNV-F3：
5′-CGACATCCGTGTACCAGA；
And IHHNV-B3:
5′-AGAGCGTAGGACTTTCCG；
(8), Bst archaeal dna polymerase pipe: interior dress Bst archaeal dna polymerase;
(9), developer pipe: interior dress nucleic acid dye SYBR Green I;
(10), positive control nucleic acid pipe: the positive DNA of interior dress prawn IHHNV;
(11), negative control pipe: the distilled water of interior dress sterilization.
2. according to claims 1 described prawn IHHNV nucleic acid isothermal amplification detection kit, it is characterized in that said lapping liquid is made up of the component of following parts by volume:
5～10 parts of the tris solutions of 1～2M; 0.25 0.5～2.0 part of the disodium ethylene diamine tetra-acetic acid solution of～1.0M; 5～10 parts of the sodium dodecyl sulfate solutions of mass concentration 5%～10%, 0.01～1.0 part of mercaptoethanol, 0.01～0.02 part of oxine; 5～10 parts of balance phenols and 5～10 parts of chloroforms are with distilled water constant volume to 100 part.
3. according to claims 2 described prawn IHHNV nucleic acid isothermal amplification detection kits; It is characterized in that said LAMP reaction solution is made up of following component: each 1～4 μ M of LAMP primer I HHNV-FIP and IHHNV-BIP, each 0.1～0.5 μ M of LAMP primer I HHNV-F3 and IHHNV-B3, dATP, dGTP and dCTP be 0.5～2mM respectively; DTTP, each 0.25～1mM of dUTP; Tris-HCl 10～40mM, KCl 10～20mM, (NH
4)
2SO
45～15mM, MgSO
41～4mM, Triton X-100 0.05%～1.0%, Betaine 0.8～1.2M; All the other are distilled water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101543112A CN101792817B (en) | 2009-11-30 | 2009-11-30 | Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101543112A CN101792817B (en) | 2009-11-30 | 2009-11-30 | Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101792817A CN101792817A (en) | 2010-08-04 |
| CN101792817B true CN101792817B (en) | 2012-07-25 |
Family
ID=42585731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009101543112A Expired - Fee Related CN101792817B (en) | 2009-11-30 | 2009-11-30 | Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101792817B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154469A (en) * | 2011-01-14 | 2011-08-17 | 浙江大学 | General detection method for pathogenic vibrios and nucleic acid isothermal amplification detection kit used in same |
| MY184600A (en) * | 2012-02-27 | 2021-04-07 | Univ Malaya | Real-time viral detection method and kit for infectious hypodermal and haematopoietic necrosis virus |
| CN107828914B (en) * | 2017-11-10 | 2021-05-14 | 杭州众测生物科技有限公司 | RAA constant temperature fluorescence detection method and reagent for Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) |
| CN112941155B (en) * | 2018-05-14 | 2023-07-14 | 北京艾克伦医疗科技有限公司 | DNA primer pair with stem-loop structure and application thereof |
| CN114415756B (en) * | 2022-01-17 | 2023-09-05 | 厦门宇电自动化科技有限公司 | Method and system for controlling temperature of nucleic acid detection reagent raw material based on deep reinforcement learning |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285103A (en) * | 2007-04-10 | 2008-10-15 | 国家海洋局第三海洋研究所 | Synchronization detection process for multi-viruses of prawn |
| CN101643793A (en) * | 2009-08-27 | 2010-02-10 | 中国科学院南海海洋研究所 | Reagent kit for testing infectious hypodermic and hematopoietic necrosis viruses of prawns, and testing method thereof |
-
2009
- 2009-11-30 CN CN2009101543112A patent/CN101792817B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285103A (en) * | 2007-04-10 | 2008-10-15 | 国家海洋局第三海洋研究所 | Synchronization detection process for multi-viruses of prawn |
| CN101643793A (en) * | 2009-08-27 | 2010-02-10 | 中国科学院南海海洋研究所 | Reagent kit for testing infectious hypodermic and hematopoietic necrosis viruses of prawns, and testing method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101792817A (en) | 2010-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101691614B (en) | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus | |
| CN101792817B (en) | Detection method of prawn IHHNV (infectious hypodermal and hematopoietic necrosis virus) and used nucleic acid isothermal amplification detection kit | |
| CN103642936A (en) | Primer probe composition and kit for specific detection of 55 type adenovirus nucleic acid | |
| CN103074334B (en) | Method for detecting CHO cell DNA | |
| CN101372714B (en) | Prawn white spot syndrome virus nucleic acid isothermal amplification detection reagent kit and detecting method | |
| CN106701984A (en) | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal | |
| RU2270254C2 (en) | Identification of transgenic dna sequences in plant material and products made of the same, oligonucleotide kit and bioarray therefor | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| CN103866048B (en) | The HRM discrimination method of Muscovy duck parvovirus and goose parvovirus, test kit and primer sets | |
| CN104195269B (en) | A kind of method detecting tomato spotted wilf virus | |
| Li et al. | Morphology and molecular identification of the Eimeria spp. in domestic rabbits | |
| CN106350581A (en) | Method for detecting bacterial vaginosis by using detection kit | |
| CN101792818B (en) | Method for detecting WSSV and IHHNV of prawn simultaneously and detection kit used by same | |
| CN104946760A (en) | Method for detecting pythium inflatum and dedicated kit | |
| CN102154469A (en) | General detection method for pathogenic vibrios and nucleic acid isothermal amplification detection kit used in same | |
| CN101768633B (en) | Composition for detecting O139 group vibrio cholerae, kit and detection method for food | |
| CN105624286A (en) | Legionella pneumophila fluorescence PCR detection kit | |
| CN105624285A (en) | Mycoplasma pneumoniae fluorescent PCR detection reagent kit | |
| CN101451164A (en) | Method for detecting chrysanthemum chlorotic mottle virus | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| Zhang et al. | Rapid detection of cactus virus X in pitaya by efficient reverse transcription loop-mediated isothermal amplification | |
| CN107586889A (en) | Dove New-type adenovirus EvaGreen real-time fluorescence quantitative PCR detection primers | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| CN106636394A (en) | Isothermal amplication detection kit for nucleic acid of aeromonas and detection method of isothermal amplication detection kit | |
| CN103060440B (en) | Universal PCR (Polymerase Chain Reaction) detection method for bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20141130 |
|
| EXPY | Termination of patent right or utility model |