JP2005528114A - Mutant DNA polymerase I mutant and method for targeted random mutagenesis using the mutant DNA polymerase I mutant in continuous culture - Google Patents

Abstract

Variant DNA polymerase I, which has a mutation in motif A and / or motif B in the active domain that increases the error rate during replication. Expression plasmid constructs and cell lines are provided for expressing these low fidelity polymerase mutants. Also use these low fidelity DNA polymerase I mutants to produce libraries of randomly mutagenized genes (which may be prokaryotic or eukaryotic) A method is provided. Random mutagenesis involves combining mutagenesis and selection in continuous culture for convenient repeatability, thereby producing a diverse range of base pair substitutions (widely distributed along the sequence). . Some benefits include minimizing harmful damage to chromosomal DNA and adapting to strains that accept complementation, which substantially facilitates the production and identification of enzymes (with altered properties). The

Description

Cross-reference of related applications

  This application claims the priority of provisional application No. 60 / 384,944, filed May 31, 2002, currently pending.

  The present invention relates to DNA polymerase I mutants and methods for their application, in particular to DNA Pol I mutants designed to have reduced replication fidelity, and continuous culture. in random mutagenesis for modification of target sequences in culture).

Statement of government interests

  This invention was made with government support under grant number ROI CA 78885 awarded by the National Institutes of Health. The government has certain rights in the invention.

Background of the Invention

  Enzymes are routinely used in industries related to pharmacy and biotechnology and are increasingly applied as biocatalysts in chemical synthesis and bioremediation. Native enzymes rarely have the properties required for direct industrial or medical applications, because they have specific biochemical properties. Because it has evolved to run within an environment (generally different from the chemical environment for industrial and medical applications). So far, two general approaches have been used to change enzyme performance. One involves the replacement of individual amino acid residues based on detailed structural information, and the other involves the production of a large library of randomly substituted variants, or mutants. With regard to optimal conditions of catalysis and / or substrate specificity by modifying structural properties already present in the parent enzyme, and by mutagenesis followed by identification of mutants with the desired properties Fine-tuning of the enzyme performance becomes possible. This approach has great potential for improving the biosynthesis and degradation pathways of the complex and overcoming the rate-limiting step for medical and industrial applications.

  Unlike site-directed mutagenesis, random mutagenesis does not require conventional knowledge of the structure of the targeted enzyme or the mechanistic aspects of the reaction. The main limitation of random mutagenesis is that only a small fraction of sequence space can be effectively searched. This is because the possible combinations of amino acid substitutions in the average enzyme are astronomical numbers (which greatly exceeds the size of most libraries) and functionally defective mutants frequently occur, by. In addition, the diversity of the random mutant library is constrained by the error-correcting nature of the genetic code. A particular amino acid residue in a protein is replaced with one of 19 other natural amino acids, but on average due to a particular single point mutation within the codon that encodes a particular amino acid Only 6 different amino acid substitutions occur. These substitutions tend to be conservative and result in the replacement of a particular amino acid with another amino acid having similar physicochemical properties.

  A number of methods have been developed to induce random point mutations in vitro, which are PCR-mediated chemical mutagenesis [Roufa, D. et al. J. et al. , Methods Mol. Biol. 57: 357-67 (1996)] to mutagenic PCR (Cadwell, R .; C. and Joyce, G .; F. , PCR Methods Appl. 3: S136-40 (1994)], and ligation of degenerate oligonucleotides [Black, M. et al. E. and Loeb, L.M. A. , Methods Mol. Biol. 57: 335-49 (1996)]. These methods provide some control over the intensity of mutagenesis and can achieve very high mutation loads. However, even under intense mutagenesis conditions, it is minimally possible to generate specific subsequences of more than 2 or 3 amino acids within the enzyme by mutagenesis. . Moreover, a high mutation load increases the proportion of defective mutants.

  One strategy for increasing the likelihood of generating mutants with altered properties consists of limiting mutagenesis to a region of the target gene (which is directly involved in catalysis) [ Suzuki et al. , Mol. Divers. 2: 111-18 (1996)]. This strategy has been successful in some cases [Encell et al. , Cancer Res. 58: 1013-20 (1998); Glick et al. , Embo J. et al. 20: 7303-12 (2001); Patel, P .; H. and Loeb, L.M. A. , Proc. Natl. Acad. Sci. USA 97: 5095-100 (2000); Shinkai et al. , J. et al. Biol. Chem. 276: 18836-42 (2001)], which results in leaving a large portion of the protein unexplored, requiring substantial knowledge of protein structure and structure-function relationships, and the active site sequence is not close or easy If it is not identifiable, it becomes difficult.

Finding the desired variant is generally a big challenge. This can be achieved either by true selection or screening. True selection consists of conferring growth advantage on clones that exhibit the desired activity and is therefore performed in vivo. Depending on how strong the growth advantage is, selection-based techniques can be extremely effective to increase the appearance of the desired variant in the population. Selection-based techniques have additional advantages in eliminating defective and inactive mutants. There are many ways to link specific enzyme properties with growth, including genetic complementation, auxotrophy, or drug resistance. Unfortunately, selection-based techniques are not available for all enzymes and desired properties. If no selection-based technique is available, the desired variant can be identified by screening. Screening is more versatile (than selection-based techniques) because screening does not require biological activity.
However, screening is more limited in throughput.

  In vivo mutagenesis offers significant advantages over in vitro methods where selection-based techniques are available. This is because in vivo mutagenesis can be immediately associated with positive genetic selection. This promotes the accumulation of beneficial mutations (a strategy known as “directed evolution”). By step-wise selection with a positive effect on the desired phenotype of the mutation, we are able to achieve a combination of mutations that has a very low probability at the start of the experiment. This iterative process of mutagenesis and selection is greatly facilitated by performing both mutagenesis and selection simultaneously in vivo.

  The efficiency of a particular in vivo mutagenesis system depends preferentially on the type of cellular hosts or “mutator strains” used. Also, currently available mutagenic strains are inadequate for a number of reasons. For example, mutD5 is Pol III deficient in proofreading activity [Scheuermann, R., et al. H. and Echols, H.M. , Proc. Natl. Acad. Sci. USA 81: 7747-51 (1984)]. Under certain growth conditions, errors introduced by this polymerase (the main replicative polymerase in E. coli) result in mismatch repair saturation and a dramatic increase in mutagenesis [Schaaper, R .; M.M. and Radman, M.M. , Embo. J. et al. 8: 3511-16 (1989)]. Other strains include mismatch repair inactivation [Glickman, B. et al. W. and Radman, M.M. , Proc. Natl. Acad. Sci. U S A 77: 1063-67 (1980)], or multiple mutations affecting mismatch repair (mut S), oxo-dGTP repair activity (mut T), and 3′-5 ′ exo of DNA Pol III Nuclease activity (mut D) [Greener et al. , Methods Mol. Biol. 57: 375-85 (1996)]. However, inactivation of the major DNA repair pathway greatly limits the performance of these mutagenized strains [Greener et al. , Mol. Biotechnol. 7: 189-95 (1997)]. Since mutagenesis is not directed to the targeted sequence, growing these mutagenized strains in culture results in extensive mutagenesis invariably. This leads to a substantial loss of the organism's fitness, which in turn limits the number of effective iterative cycles that can be performed. [Fijalkaska, 1. J. et al. and Schaper, R.A. M.M. , Proc. Natl. Acad. Sci. USA 93: 2856-61 (1996)]. Also, non-specific mutations obscure phenotypic expression from mutations in the target gene [Long-McGie et al. , Biotechnol. Bioeng. 68: 121-25 (2000); Negri et al. , Antimicrob. Agents Chemother. 44: 2485-2491 (2000)] and long-term passages in culture reduce the efficiency of mutagenesis [Greener et al. , Mol. Biotechnol. 7: 189-95 (1997)].

  In summary, random mutagenesis limits the efficiency of this technique by the number of mutants that require analysis, where enzymatic modification is possible with minimal structural or mechanistic information about the target protein. . Although high mutation loading cannot be achieved in vivo, linking in vivo mutagenesis with positive genetic selection expands the number of mutants that can be analyzed effectively.

There are mutagenized strains whose properties have been investigated in detail, but have the following limitations with respect to enzyme modification by random mutagenesis:
(1) Dependence on DNA defects and / or DNA repair pathways on certain defects;
(2) the unhealthy state of the host cells resulting from extensive chromosomal mutagenesis and from defective DNA repair pathways;
(3) increased phenotypic noise resulting from non-specific chromosomal mutations, reducing the reliability of selection based on phenotypic characteristics; and
(4) Progressive decrease in the rate of mutagenesis that occurs in long-term culture.
There is clearly a need to improve random mutagenesis in culture. In particular, it is desirable to be independent of healthy host strains and specific genetic backgrounds.

Summary of the Invention

  One aspect of the present invention is the design of within the PolI family of mutated DNA polymerases and random mutagenesis of the exogenous target gene of interest in the frequency of chromosomal DNA in continuous culture. It relates to how to use them in performing at a frequency exceeding. Various aspects of the invention relate to the design of DNA polymerases, which are by introducing mutations into residues within their active portion, thereby increasing the error rate of the polymerase. These are collectively referred to as “error-prone Pol I mutants”. These mutations are associated with either motif A or motif B, or both motifs A and B. The compositions of the various aspects of the present invention comprise a DNA sequence encoding any part of the designed site of a PolI mutant (having low fidelity), a PolI mutant (low fidelity) And any portion of the host strain (which contains either DNA or polypeptide sequences corresponding to these mutated PolI mutants).

  Another aspect of the present invention is to allow these mutated polymerase mutants to be expressed under carefully controlled or “optimized” culture conditions to induce mutagenesis (the subject sequence). Increased frequency of preferentially targeting exogenously introduced plasmids encoding. The compositions and methods are provided for random mutagenesis. This is done in continuous culture and there is no plasmid recovery between selection steps, which greatly facilitates the accumulation of beneficial mutations. The compositions and methods can be readily applied for use in any existing strain suitable for complementation with the target gene. This is because critical reagents are encoded in a transformable vector, and mutagenesis is not dependent on any particular genetic defect in the host strain.

  Suitable strains include cells that endogenously express wild type DNA polymerase and / or wild type DNA repair function. The compositions and methods can introduce a broad spectrum mutation into any DNA target sequence (prokaryotic or eukaryotic). This achieves the identification of sequences encoding polypeptides with altered properties.

Detailed description of the invention

  Aspects of the invention are for the production of Pol I mutants, collectively referred to as “variant Pol I mutants”. This is a modification of the wild-type DNA polymerase at specific residues that form the active domain, and these PolI mutants result in increased misincorporation during catalysis. These low-fidelity Pol I mutants are potentially useful in any industry that uses enzymes that perform biochemical reactions (any improvement in the activity of such enzymes is desirable). Aspects of the invention are useful for a wide range of applications in the pharmaceutical / medical industry as well as any industry that engages in enzyme-dependent processes.

  FIG. 1A outlines a random mutagenesis approach in continuous culture mediated by a mutated PolI mutant. Prokaryotic host cells containing a first vector encoding a target gene of interest and a second vector encoding a mutated PolI mutant are presented. Suitable host cells may or may not express wild type Pol I endogenously. The iterative cycle of mutagenesis and selection using the mutagenesis system of the present invention results in directed evolution of the gene of interest.

  FIG. 1B shows how expression of a low fidelity Pol 1 mutant in a host cell shows plasmid-specific mutagenesis without substantially modifying the prokaryotic host chromosome when expressed in vivo. An example of how to promote As shown, host cells with wild type Pol III (major DNA polymerase) and temperature sensitive Pol I activity can be transformed with the two plasmids. If mutagenesis occurs at a restrictive temperature, the endogenous temperature-sensitive Pol I can be inactivated. Within the first (“target”) plasmid, the target gene of interest can be inserted downstream of the ColEl origin of replication (“ori”), which is specifically recognized by Pol1. The second plasmid (“pSC101 ori”) can express the mutant DNA polymerase. This is designed in the active site and replicates substrate DNA (eg, the first plasmid containing the target gene) erroneously. Since DNA synthesis by PolI is very restricted in the chromosome, mutagenesis is largely limited to the target plasmid during in vivo expression of mutated PolI mutants.

  The following paragraphs illustrate two general aspects of the present invention (compositions for mutagenesis systems and compositions for performing directed evolution in vivo by continuous culture). Method used).

Components of the mutagenesis system
With respect to mutagenesis systems, including compositional embodiments relating to mutated PolI mutants, the following disclosure is provided by:
(1) Development and characterization of motif A and / or B PolI mutants,
(2) a host strain that can be used to express motif A and / or B PolI mutant, and
(3) Types of target sequences that can be used by motif A and / or B PolI mutants.
Specific examples relating to these compositions are referenced and provided in the following sections.

Development and characterization of mutated PolI mutants
Type I polymerase consists of a single polypeptide with three distinct domains [Kornberg, A. et al. and Baker, T .; A. , DNA replication, second edition, Vol. 1, p. 931. New York: H. Freeman and Company (1992)]. In particular, three residues (I614, A661, and T664), critical to the fidelity of one such polymerase (Thermus aquaticus (Taq) polymerase), have been previously identified by the inventors [Suzuki et al. al. , J. et al. Biol. Chem. 272: 11228-35 (1997); Patel et al. , J. et al. Biol. Chem. 276: 5044-51 (2001)].

  Upon dNTP binding, motifs A and B have been shown to form a pocket at the catalytic site that accommodates incoming nucleotides (accommodates). Certain amino acid substitutions at specific positions in these motifs favor misincorporation. This is due to the enlargement of the active site cavity and / or the more stable “closed” conformation [Suzuki et al. , J. et al. Biol. Chem. 272: 11228-35 (1997); Patel et al. , J. et al. Biol. Chem. 276: 5044-51 (2001)].

  One aspect of the present invention relates to E. coli DNA polymerase variants (ie, mutated PolI mutants). These are engineered within the active site (especially in motif A and / or motif B) to increase the frequency of replication errors in the substrate DNA. FIG. 2 shows the positions within motifs A and B (identified and characterized by the present invention), which is critical with respect to the fidelity of E. coli polymerase. In particular, motif I position I709 and motif B positions S756 and A759 of E. coli DNA PolI are designed to increase the incorporation of mismatched residues. These mutants are further described in the following sections. A method for the construction of a mutated PolI mutant is provided in Example 1 below.

One embodiment relates to E. coli error-prone Pol I mutants. The mutant bears amino acid substitutions in both motif A and the 3 'to 5' exonuclease domain and exhibits an increased frequency of misincorporation during replication of the target DNA.

  The motif A mutant was altered by substituting wild-type aspartic acid (D) with alanine (A) at position 424, inactivating the exonuclease function essential for proofreading. FIG. 2 provides an example of a motif A mutant. The mutant lacks exonuclease activity, including D424A I709N and D424A I709F mutants in which wild type isoleucine (position 709) is replaced with asparagine (N) or phenylalanine (F). Is included). Biochemical characterization of these two mutants was performed by the inventor. Also, the following documents describing their work are incorporated herein by reference [Shinkai, A. et al. and Loeb, L.M. , J. et al. Biol. Chem. 276: 46759-64 (2001)]. These mutated PolI mutants (which retain one or more mutations in active site motif A) result in more frequent errors during both in vitro and in vivo template replication, and thus in vitro and It can be used in vivo.

  Another embodiment relates to an E. coli mutated PolI mutant that retains the mutation in both the motif B and the 3 ′ → 5 ′ exonuclease domain and the frequency of misincorporation during replication of the target DNA. Resulting in a rise. The motif B mutant was altered by replacing wild type aspartate (D) with alanine (A) at position 424, inactivating the exonuclease function essential for proofreading. FIG. 2 provides an example of a motif B mutant. The mutant lacks exonuclease activity, including D424A S756E and D424A A759R mutants, in which wild type serine (S) (at position 756) is replaced with glutamic acid (E); Wild type alanine (A) (at position 759) is replaced with arginine (R)]. These mutant PolI mutants (which retain one or more mutations in active site motif B) can be used in vitro and in vivo.

  A further aspect relates to an E. coli mutated PolI mutant, which retains amino acid substitutions in both motif A and motif B and exhibits a high increase in the frequency of misincorporation during target DNA replication. . These motif A and B mutants have their 3 ′ → 5 ′ exonuclease activity altered by replacing wild type aspartate (D) (position 424) with alanine (A), Activated. However, this modification does not appear to have a significant impact on mutagenesis of these mutants (see Table 2). FIG. 2 provides an example of a mutated PolI mutant carrying amino acid substitutions in motif A and motif B. One such mutant is “D424A I709N A759R”. In the mutant, wild type isoleucine (I) (at position 709) is replaced with asparagine (N) and wild type alanine (A) (at position 759) is replaced with arginine (R). Another mutant in both motifs is referred to as “D424A I709F A759R”. In the mutant, wild type isoleucine (I) (at position 709) is replaced with phenylalanine (F) and wild type alanine (A) (at position 759) is replaced with arginine (R). These mutated PolI mutants (retaining single or more amino acid substitutions in each motif A and motif B of the active site) can be used in vitro and in vivo.

  Additional embodiments relate to E. coli mutated PolI mutants carrying motifs A and B discussed above and combinations of motif A and motif B mutations, including other PolI family DNA polymerases. Included are homologous mutations that can be designed into members, including S. aureus, S. pneumoniae, Bacillus subtilis, or enterococci.

Unrestricted Selection in Host Strain Used for Mutagenesis Mediated by Mutant PolI Mutants (Unrestricted Selection)
Variants Motif A and / or Motif B Suitable hosts for expression of the PolI gene are not limited to strains with an inactivated DNA repair mechanism or strains with defective chromosomal PolI (chromosomal PolI). The mutagenesis system is therefore uniquely adaptable to various strains that are imaginable. Various embodiments using cells with or without endogenous wild-type PolI activity may be used to express mutators.

  Another aspect relates to strains with or without an inactivated DNA repair mechanism. Examples of host strains that can provide a suitable cellular environment that supports mutagenesis mediated by mutated PolI expression include E. coli strains (eg, JS200 and XL1-Blue). The JS200 strain is a representative of a strain having a PolI temperature-sensitive allele (polA12) in its chromosome [Monk, M. et al. and Kinross, J. et al. , J. et al. Bacteriol. 109: 971-78 (1972)]. The XL1-Blue strain is a representative of a strain that has endogenous wild-type PolI activity and is substantially proficient in DNA repair, and therefore co-expression of an exogenous mutant PolI mutant Can be supported. Another aspect relates to many existing strains, which are deficient in a particular enzyme (which can functionally complement), so that the search for the system can be made to the full extent. Become.

  When used in vivo, mutant PolI mutants encoding either motif A and / or motif B amino acid substitutions are transferred to prokaryotic hosts as part of a circular vector (eg, a plasmid) or It can be introduced in a linear form (eg in bacterial phage). In one embodiment, the vehicle encoding motif A and / or motif B PolI may remain in an unintegrated form (eg, as an exogenous plasmid). In another embodiment, a single or multiple copies of a gene (which encodes any portion of motif A and / or motif B mutagen sequence) are integrated into the chromosome of a prokaryotic host. This produces a mutagenic prokaryotic strain or a stable line of cell lines.

  An example relating to generating a stable mutagenic cell line is described below.

  A double stranded DNA fragment consisting of 3000 bp of the PolA1 locus encoding a low fidelity variant (which is flanked by about 1000 bp of natural genomic sequence on the 5 'and 3' sides) Can be subcloned into a plasmid with a sensitive origin of replication. Chloramphenicol can be used as a marker for positive selection. Sucrose can also be used for negative selection. For example, the resulting plasmid can be used to transform JS200 cells, and chloramphenicol resistance can be selected under permissive conditions at 30 ° C. The culture can be switched to 37 ° C. and plasmid replication can be blocked by the temperature sensitive PolI allele. These conditions give dramatic growth advantages to cells in which the mutated PolI mutant has integrated into its chromosome, and stable integrants that can be confirmed by PCR for most colonies growing at 37 ° C ( integrals). If this method does not produce the desired result, sucrose can be added in the selection step to select positively for the presence of the plasmid. Several other methods for generating allelic substitutions currently practiced by those skilled in the art are contemplated.

Unrestricted selection in target DNA used for mutagenesis mediated by mutated PolI mutants
The in vivo mutagenesis system contemplates a number of suitable templates (illustrated in FIG. 3). In one aspect, the targeted template may be a prokaryotic gene (FIG. 3A) encoding a full-length protein or any fragment thereof.

  In another embodiment, the targeted template may be a eukaryotic gene (FIG. 3A), which is in the form of cDNA or genomic DNA (without introns), or any fragment thereof. May be. For example, a eukaryotic gene in any of these forms may be introduced exogenously into a prokaryotic strain (endogenously temperature sensitive or expresses wild-type Pol1) and replicated unfaithfully. . Subsequently, the library of mutated eukaryotic DNA may be separated from their prokaryotic host, for example by using conventional methods for plasmid preparation or for phage recovery. Once a plasmid library has been isolated, it may be subjected to restriction enzyme digestion with one or more endonucleases (which can be used to dissociate the targeted gene of interest from the vector by molecular organisms). Which is commercially available to those skilled in the art).

  This can be easily done by using gel electrophoresis and separating the DNA fragments based on differences in morphology and size. Upon isolation and repurification, the gene library can be used for subcloning into a eukaryotic expression vector. The target gene of interest may be transformed into eukaryotic cells or conventional cell lines and screened for the desired property or function. Other procedures for manipulating DNA within the skill of the art are also contemplated. As an example, a χ2913recA strain (which is defective in thymidine synthase (ΔthyA572)) was co-expressed with a vector encoding a human TS cDNA placed downstream of ori and a vector expressing a mutant PolI mutant. It may be transformed.

  Selection may be performed in the presence of increasing concentrations of 5-fluorouracil (“5FU”), a potent inhibitor of thymidine synthase. Clones with increased resistance to 5FU can be isolated. These mutations can also be characterized by using materials and methods utilized by those skilled in the art [Landis et al. , Cancer Res. 61: 666-72 (2000)].

  Templates that are subjected to in vivo mutagenesis with PolI mutagens can be delivered in a circular form (eg, a plasmid) or in a linear form. In one embodiment, the template may be delivered by a bacteriophage capable of injecting phage genomic material into a prokaryotic host that expresses one mutated PolI mutant.

  When bacteriophage is dependent on PolI for replication (eg, bacteriophage T4 [Hobbs, LS and Nossall, NGJ Bacteriol 178: 6772-6777 (1996)] in an RNAseH deficient background) Viral replication in the host results in template expansion and mutagenesis to produce a library of mutants. In another embodiment, the targeted gene (s) can be introduced exogenously into a Pol1-dependent plasmid, including plasmids ColEl, pBR322, p15A, pMB, pNT7, pVH51, RSF1030, CloDF13, ColE2, pLMV158, pLS1, And their derivatives.

  The target plasmid is distinct from the plasmid encoding the mutated PolI mutant (Pol1 independent). In its simplest form, the system includes one plasmid (encoding a mutated PolI mutant) and another plasmid or phage (encoding the targeted gene). Other methods of gene delivery known and practiced by those skilled in the art are included in these embodiments.

  As an example of the efficacy of mutated PolI random mutagenesis with respect to enzyme modification, an isoform of the β-lactamase gene ("TEM-1") (instead of any prokaryotic or eukaryotic gene, hypothesized (Representing the gene of interest above) was inserted into a plasmid as a target for in vivo mutagenesis (described in Example 2 provided below). To determine the frequency of in vivo mutagenesis associated with mutated PolI expression, the β-lactamase reversion assay described below can be used. As illustrated in FIG. 3B, the β-lactamase gene was inserted into the template plasmid from the ori position (ie, from the origin of replication of the ColEl plasmid) at an increasing distance (“pLA230”, “pLA700”). ”,“ PLA1400 ”,“ pLA2800 ”, and“ pLA3700 ”). In all constructs, an ocher stop codon (TAA) replaces glutamic acid (GAA) 26 codons downstream from the start of translation of the TEM-1 β-lactamase gene. For example, in the reporter plasmid pLA230, the ocher stop codon is located about 230 bp downstream of ori. Most mutations within the ocher stop codon result in reversion to the codon encoding the amino acid and allow β-lactamase expression, and the mutations can be counted as carbenicillin resistant colonies. These can be confirmed by sequencing plasmids isolated from these colonies. The mutagenic effect of mutagenic PolI in the ColEl plasmid sequence was evaluated, and the frequency of ocher reversion in cells expressing mutagenic PolI and the frequency in cells expressing wild-type PolI were determined. You can compare. To confirm the frequency of mutations in the chromosomal DNA, rifampicin resistance, which arises from point mutations in the chromosome-encoded RNA Pol II gene, can be assessed [Ovchinnikov et al. , Mol. Gen. Genet. 190: 344-348 (1983)].

  The β-lactamase gene is tested for in vivo mutagenesis under conditions where increasing concentrations of aztreonam are present to select mutations that improve β-lactamase substrate recognition of aztreonam. The TEM-1 isoform of β-lactamase is the most frequently occurring β-lactamase and is found in gram-negative clinical isolates. It functions in the catalytic degradation of β-lactams by amide-bond hydrolysis [Wiedemann et al. , J. et al. Antimicrob. Chemother. 24 Suppl. B: 1-22 (1989)]. The catalytic efficacy of β-lactamase varies greatly depending on the β-lactam used as a substrate. β-Lactamase degrades penicillin with high efficiency, but the hydrolysis of cephalosporin by β-lactamase is poor and only residual activity for newer broad spectrum antibiotics have. Extended-spectrum antibiotics include aztreonam and third-generation cephalosporins (eg, cefotaxime and ceftazidime) that are specifically designed to minimize recognition by β-lactamase Holds bulky adducts. FIG. 4 illustrates the representative structure of each of these β-lactam substrates (including penicillin, cephalosporin, and aztreonam). Aztreonam was used as a selective agent in Examples 4 and 7.

  Evolution of β-lactamase, which occurs naturally under pressure in the widespread use of broad spectrum antibiotics in the clinic [Medeiros, A. , Clin. Infect. Dis. 24 Suppl. 1: commented on S19-45 (1997)] can be simulated in the laboratory [Long-McGie et al, Biotechnol. Bioeng. 68: 121-5 (2000); Zaccolo, M .; and Gherardi, E .; , J Mol. Biol. 285: 775-83 (1999); Orencia et al. , Nat. Struct. Biol. 8: 238-42 (2001)]. From clinical isolates and laboratory selections, it is known that at least two specific amino acid substitutions are required for substantial resistance to a broad spectrum β-lactam [Knox Antimicrob. Agents Chemoth. 39: 2543-2601 (1995)]. Resistant mutations have been identified in a total of 37 different positions, which can be found at http: // www. lahey. org / studios / temtable / html. These mutations fall into two broad categories: one group of mutations (including R164 S / H (arginine to serine or histidine) and G238S (glycine to serine)) are active site It occurs nearby and increases the catalytic potency of the β-lactamase enzyme.

  Mutations belonging to the second group, including E104K (glutamic acid to lysine) and M182T (methionine to threonine) are typically located away from the active site. They are most likely selected in response to mutations at the catalytic site and suppress the destabilizing effects resulting from these mutations [Petrosino J. et al. et al. , Trends Microbiol. 8: 323-327 (1998)].

  Selecting mutagenesis of the β-lactamase gene (coupled with aztreonam selection) validated the use of mutated PolI random mutagenesis for enzyme modification. The following two considerations were critical in target selection:

(1) established by clinical isolates and laboratory selection studies, ie the β-lactamase gene can be modified to recognize aztreonam as a substrate via mutation; and (2) at least two specific Amino acid substitutions are necessary to achieve substantial aztreonam resistance. This reduces the potential background contributed by spontaneous mutations. This is because they are very unlikely to generate more than one amino acid substitution (because the frequency is low (10 ^{−7 in} JS200 cells)).

Methods for in vivo mutagenesis of target DNA mediated by mutated PolI mutants (selection or in combination with screening)
In connection with the methods embodied to perform in vivo mutagenesis mediated by mutant PolI mutants, the following provides the following disclosure: (1) Mutant Pol1 mediated in continuous culture Advantages and applications of sexual mutagenesis, and (2) parameters of optimized culture conditions. Specific examples relating to these aspects are referenced and provided in the following sections.

The advantage of mutated Pol1-mediated mutagenesis in culture for enzyme modification and applied random mutagenesis methods (followed by selection or screening) allow continuous sequencing of enzyme sequence, structure, and functional space Searches are possible under conditions where there is no detailed mechanistic or structural information [Skandalis et al. Chem. Biol. 4: 889-98 (1997)]. Mutagenesis and selection / screening can be repeated in an iterative fashion. This is done so that the sequence space is directed to changes that improve performance in an approach referred to as “directed evolution”. By performing mutagenesis and selection simultaneously in continuous culture, the need to recover target DNA between selection steps is avoided.

  Due to the directed evolution, only fractions with a small sequence space are still explored. Therefore, it is unlikely to achieve optimal solutions or evolve new catalytic functions.

  Large leap in sequences can be achieved by shuffling sequences within a library of mutants prescreened for activity or within a family of enzymes [Smith, G. et al. P. , Nature. 370: 324-5 (1994); Crameri, A .; et al. , Nature. 391: 288-91 (1998)]. In one aspect, the present invention can also be used in combination with these shuffling techniques. Mutant PolI mutants can produce additional mutations during these shuffling processes in vitro and in vivo.

  The mutated DNA polymerases of the present invention have potential applications in the medical field in both drug development and gene therapy. For example, random mutagenesis is instrumental in the production of modified enzymes with respect to cancer management [Encell L. et al. P. et al. , Nat. Biotechnol. 17: 143-7 (1999)].

  These include mutants designed to reduce the side effects of cancer treatment and mutants with improved pro-drug-activating properties. Examples of the former include: thymidylate synthase resistance to 5-fluorouracil; 6-methylguanine-methyltransferase resistance to alkylating drugs and to 6-benzoguanine And dihydrofolate reductase resistance to methotrexate. Examples of the latter include thymidylate kinase with enhanced specificity for gancyclovir or acyclovir, a deoxycytidine-kinase mutant specific for Ara-C, and 5-fluoro Cytosine deaminase specific for cytosine (5-fluorocytosine) is included.

  In addition, the mutated PolI mutants of the present invention have potential application in promoting enzyme modification by random mutagenesis, a domain that is used in chemical synthesis, bioremediation, and food processing. [Chillamilla et al. , Mol. Cell Biochem. 224: 159-68 (2001); Schmidt-Danert et al. , Trends Biotechnol. 17: 135-6 (1999)]. The PolI mutants of the present invention can be used to create enzymes with altered substrate specificity, including altered esterases, lipases, cytochrome oxidases, and dioxygenases, and non-natural environments (non- Natural enzymes (eg, alkaline conditions, high temperatures, cold, and / or the presence of metal chelators) include enzymes with improved catalysis. For example, PolI mutants can be used to create enzymes with altered substrate specificity to improve the efficiency of chemical synthesis and enantiomeric purity. Enzymes that are resistant to high temperatures and to the presence of metal chelators can be obtained by mutated PolI mutagenesis to improve the rate of biocatalysis in chemical synthesis. PolI mutants can also be used to produce enzymes that provide resistance to alkaline conditions for pigment degradation in a cleaning shop or resistance to low temperature conditions in food processing applications.

  The present invention has foreseeable applications in emerging fields, including biotechnology, gene therapy, and bioremediation. Customization of substrate recognition by DNA-specific reagents such as recombinases and restriction enzymes [Buchholz et al. , Nature Biotechnol. 19: 1047-52 (2001); Santoro et al. , Proc. Natl. Acad. Sci. U S A, 99: 4185-90 (2002)], or enzyme improvements related to alkane degradation [Belhaj et al. , Res. Microbiol. 153: 339-344 (2002)] are two examples of newly emerging regions that can benefit from use of aspects of the present invention.

In vivo mutagenesis and selection / screening under optimized culture conditions
Methods are provided for generating enhanced mutagenesis that can target sequences of interest. Here, mutated PolI mutants that retain amino acid substitutions in motif A and / or B (eg, including amino acid substitutions at positions I709N / F and A759R) are carefully controlled in culture conditions in the host strain. Expressed below (described in Example 2 below). In one embodiment, the method comprises transforming a prokaryotic host strain with an expression vector (the expression vector has any number of forms encoding one or more mutated PolI mutants). And transforming a second vector (eg, a plasmid encoding one or more target genes). In another embodiment, the method comprises introducing one or more copies of a gene or fragment encoding a mutated PolI mutant into the chromosome of a cell line or host strain, and subsequently said suddenly Transforming a population of cells expressing the mutant with a vector (eg, a plasmid encoding one or more target genes). In one aspect, the controlled conditions include growing a culture of transformed cells in rich media, and a stationary growth phase of the culture ( For example, reaching and maintaining (growth stage obtained 15 hours after inoculation). In a preferred embodiment, the culture conditions under which the mutated PolI achieves optimal mutagenic performance are: (1) an exponentially increasing (eg OD 600-0.5) of transformed host strain culture Growing at a cell density index; (2) medium pre-heated at 37 ° C. to a low concentration (eg, 1:10 ⁵ ) and nutrient rich medium (eg, 2XYT) Diluting in; (3) incubating the culture for an additional time (eg, 15 minutes at 37 ° C.); and (4) placing the culture on a 37 ° C. shaker; Reaching a saturation point (eg, 15 hours).

In another embodiment, a mutated PolI mutant can be used to produce labeled plasmid DNA or a fragment thereof in vivo. For example, one or more labeled nucleotides or nucleoside analogs can be added to the culture medium to introduce target plasmid DNA into replicated copies. In a related embodiment, the mutated PolI mutant is purified as a recombinant protein from cell extracts and the target sequence for microarray analysis or other high-throughput DNA labeling procedures or for sequencing purposes Can be added to in vitro reactions containing. Modified deoxynucleoside triphosphates (“dNTPs”) or nucleotide analogs include dATPs, dGTPs, dCTPs, dTTPs, dUTPs, and dITPs. In addition, related analogs can be added to the in vitro DNA polymerization reaction in any combination [Glick et al. , Biotechniques 33 (5): 1136-42 (2002)]. These nucleotides and nucleosides are covalently attached to groups for detection by fluorescence (rhodamine green, fluorescein), chemiluminescence (biotin), or radioactivity (γ [ ³² P]). modification). The nucleoside and nucleotide analogs can be synthesized by methods known to those skilled in the art.

  Using the provided compositions and methods, a mutated PolI mutant carrying a mutation in motif A and / or motif B increases the frequency of mutagenesis, the frequency of mutagenesis being 4 and 5 It has orders of magnitude greater than the frequency of wild-type PolI and up to 400-fold in proportion to the chromosome (shown in Example 3 provided below). The compositions and methods allow for mutagenesis to target nucleotides located away from ori, including a distance of 3700 bp far beyond the 400 bp limit previously reported by researchers. . Thus, a variety of prokaryotic and eukaryotic genes can be targeted by the present invention.

  The compositions and methods of the present invention allow for the targeting of sequences of interest and produce a diverse mutation spectrum and a wide distribution of mutations (provided below) As shown in Example 4). The mutagenesis system of the present invention provides additional advantages in connection with existing mutator strains. As a result, the mutagenesis system represented by one aspect of the present invention can be easily applied to different strains (shown in Example 6 provided below). Suitable host strains include: (1) a strain that expresses an endogenous temperature sensitive DNA PolI allele, (2) a wild type DNA polymerase; and (3) a wild type DNA pol and a wild type DNA repair phenotype both. Inducible promoters can be used to adjust the optimal expression level of mutated PolI in various strains that achieve random mutagenesis. Other aspects of the in vivo mutagenesis system relate to a number of existing strains, which are strains that are defective in certain enzymes and known to accept complementation (eg, defective in thymidine synthase described above). Χ2913recA strain).

The composition and method aspects allow the accumulation of beneficial mutations in the target gene (in continuous culture). Two independent selections by increasing the concentration of aztreonam were performed under optimized mutagenic conditions to obtain 23 sequences displaying β-lactamase variants from each selection. (Shown in Examples 4 and 7 provided below). Two known amino acid substitutions were identified in these selections: E104K (glutamic acid changed to lysine at position 104) and R164H (arginine changed to histidine at position 164) in selection 1 and to S Change (arginine changed to serine at position 164) in selection 2. In addition, a new mutation, G267R (glycine changed to arginine at position 267) was identified in selection 1. The mutation can occur sequentially in this system, as exemplified by the G267R mutation (followed by the E104K and R164H mutations). This is found in a single clone encoding a silent mutation, which is also present in all other plasmids carrying sequenced E104K and R164H mutations. No other silent mutations were found. Table 4 in Example 7 shows the aztreonam phenotypes corresponding to different combinations of these amino acid substitutions after subcloning into the vector (these are not replicated by the mutated PolI mutant and other mutations are present) (Ensure that they did not). FIG. 10 shows a dose response curve of aztreonam resistance (obtained by a representative subset of these aztreonam resistant mutations). All non-synonymous mutations contributed to aztreonam resistance. The almost complete absence of irrelevant mutations is not inconsistent with the expected low mutational load and each mutation stimulates the natural evolution of resistance to β-lactamase antibiotics In the process, it is suggested to appear over time [Negri et al. , Antimicrob. Agents Chemother. 44: 2485-2491 (2000); Vuee et al. , Antimicrob. Agents Chemother. 33: 757-761 (1989)]. The relatively mild mutagenesis conditions are beyond the offset by the large size pool (approximately 10 ¹¹ plasmids) and by the discriminating power of repetitive functional selection. The discovery of the three relevant mutations in a single β- lactamase sequences ^{[10 -10} probability [Long-McGie et al. , Biotechnol. Bioeng. 68: 121-5 (2000)]] is an illustration of an efficient search of sequence space made possible by aspects of the present invention.

  The compositions and methods are used to identify the most common mutations found in clinical isolates by the selection process, with prognostic purposes predicting the evolution of new resistant mutations (eg, G267R). It can be used based on the fact that it can be identified. Aspects of the invention do not resemble many other mutagenesis approaches that produce a more biased representation compared to naturally occurring mutants [Orencia et al. , Nat. Struct. Biol. 8: 238-242 (2001)]. Mutations (positions E104 and R164) are most frequently found in naturally occurring clinical isolates (http://www.lahev.org/studios/temtable.htm). This is consistent with a diverse and well-distributed mutation spectrum (approximates to endogenously generated mutations) [Schaper R. et al. , R.A. M.M. and Dunn, R.A. L. Genetics 129, 317-326 (1991)]. A mutation has not been previously reported at position G267 and therefore G267R represents a new determinant conferring aztreonam resistance. This mutation is located in the loop connecting the B5β-sheet to the N-terminal H11 helix, which is the third most frequent mutation in clinical isolates, G238S (glycine changes to serine at position 238). Receive a shift in the presence of

To provide support for these aspects, experimental data is provided in Examples 2-7, which are described following the end of this section. While specific embodiments of the invention are described herein for purposes of illustration, it should be understood that various modifications can be made without departing from the spirit and scope of the invention. It is. Accordingly, the invention is not limited except as by the appended claims appended hereto.

  The following examples demonstrate aspects of the present invention in various contexts. In Example 1, a method is provided for constructing a low-fidelity E. coli PolI mutant that is engineered in motif A and / or B. In Example 2, optimized culture conditions are provided for increasing the frequency of plasmid-specific in vivo mutagenesis. In Example 3, a synergistic effect on the efficiency of a plasmid targeted in vivo mediated by the D424A I709N A759R PolI mutant and its sensitivity to culture conditions is provided. In Example 4, the spectrum and frequency of mutations introduced into the target sequence / β-lactamase upon expression of the D424A I709N A759R PolI variant is provided. In Example 5, the frequency of mutation in the target plasmid is provided as a function of distance from the origin of replication (ori). In Example 6, the effect of D424A I709N A759R Pol expression on the frequency of in vivo mutagenesis in the host cell (the host cell endogenously produces wild-type PolI and is proficient in DNA repair). Is provided). In Example 7, an example of directed evolution under selective pressure (eg, increasing the concentration of aztreonam) is provided.

Example 1
Construction of mutated PolI mutants

  The construction of the plasmid encoding the mutated PolI mutant of the present invention used in Examples 1 to 7 was generated by the following method. E. coli DH5αpolA was amplified by colony polymerase chain reaction using 59-ATATATAGACTTATGGTTCAGATCCCCCCAAAATCCACTTATC-39 and 59-ATATATAGGAATTCTTAGTGGCGCCTGATCCCAGTTTTCCGCACT-39 as primers. To create pECpol I, a 3 kilobase pair amplified fragment was digested with HindIII and EcoRl and then cloned into pHSG576 under the control of the lactose promoter (this is a low copy number plasmid, pol1 -Has an independent origin and chloramphenicol as a selectable marker). Site-directed mutagenesis was performed with pECpol I, introducing silent mutations C to A into position 2,067 and G to C into position 2,214 (in the polA gene), respectively, and the Accl and EagI sites, respectively. (They are flanked by the sequence encoding motif A). The resulting plasmid was named pECpol IS.

Plasmids encoding the I709N and I709F motif A mutants of DNA polymerase were isolated from the PolI library by genetic selection. A random library was constructed by annealing two single-stranded DNA oligonucleotides containing segments with random sequences: Oligo 1 is a 104-mer, sense nucleotide 2,053 Corresponded to ~ 2,156 and contained an Accl site for cloning (5'-GAAGGTCGTCGTATACGCCAGGCGTTTATTGGCGCCAGAGATTAT [GTGATGTCTCAGCGGGACTACTCGCAGATGGACTGC22]; ATTATGTCGC 2,137 and contained an EagI site (5'-AACACTTTCT CGGCCGTTGCCCGGTGGATATCTTTTCCTTCCGCGAATGCGGTCAGCAAGCCTTTGTCACGCGAAAGATGCGCCATAAT-3 '). The square bracketed nucleotides (in oligo 1) were synthesized to contain 88% wild type nucleotides and 4% of each of the other three nucleotides (at all positions). The 20 base pair complementary region of hybridization is underlined. Mix oligo 1 and oligo 2 in their non-random complementary regions, each 250 pmol in 20 μl H ₂ O and heat at 95 ° C. for 5 minutes, then cool at room temperature for 2 h Annealed. Partially duplexed oligonucleotides with 50 units of E. coli polI Klenow fragment (New England BioLabs, Beverly, Mass.) For 2 h and 0.3-ml reaction mixture at 37 ° C. (10 mM Tris-HCI, Ph7.5, 5 mM) Incubation in MgC12, 7.5 mM DTT, and 0.5 mM of all four dNTPs). The resulting DNA was digested with Accl and Eagle, purified, and inserted into pECpoldum (instead of the stuffer fragment). Plasmid (containing random library) was transformed into E. coli XLI-Blue and the number of transformed cells was aliquoted onto LB agar plates (containing 30 μg / ml chloramphenicol). Was determined by plating. The rest of the library was amplified by growing transformed E. coli XLI-Blue in 3 liters of 2XYT medium for 16 hours at 37 ° C. The random library (pECpolLib) was then purified. pECpolLib was transformed into JS200 cells (plasmids pHSG576, pECpoIIS, as pECpoldum control) and selected for overnight on a nutrient agar plate for survival. Only paired samples (including less than 1,500 colonies at 30 ° C.) were analyzed (because the dense plating of the cells induced an increase in background at 37 ° C.). Approximately 280 colonies (grown at 37 ° C.) were randomly picked and sequenced and found to contain between 1 and 2 amino acid substitutions.

A759R and S756E amino acid substitutions (in motif B) were introduced into plasmids I709N, I709F, D424A I709N and D424A I709F by site-directed mutagenesis to provide mutants I709N A759R, D424A I709F A759R, D424A DI709A24, DI709N I709F A759R was produced. For site-directed mutagenesis, Quickchange (Stratagene®, La Jolla, Calif.) Was used with the following mutagenic primers:
Pol I S756E-F5′-CCAGCGAGCAACGCCGTGAGGCGAAAGCGATCAACTTTGG-3 ′;
Pol I S756E-R5′-CCAAAGTTGATCCGCTTTCGCCTCACGGCGGTGCTCCGCTGG-3 ′;
Pol I A759R-F5′-CGCCCGTAGCGCGAAACGGATCAACTTTTGGTCTGATTTATGGC-3 ′;
Pol A759R-R5'-GCCATAAATCAGACCAAAGTTGATCCGTTTCGCGCTACGGCG-3 '.

  To deplete exonuclease function, site-directed mutagenesis was performed on pECpol I to generate an A-to-C transversion at position 1271, thus changing Asp424 to Ala, 3′-5 'Deactivated exonuclease activity [Derbyshire et al. , Science 240: 199-201 (1988)]. In the same manner, 3 'to 5' exonuclease domain-inactivating mutations were introduced into plasmids (encoding the I709N and I709F mutations) to generate D424A I709N and D424A I709F mutants, respectively.

Example 2
Optimization of culture conditions

FIG. 5A provides an example of “initial” culture conditions and a method for inducing in vivo mutagenesis by expression of mutant PolI. This represents the usual method used by those skilled in the art prior to the development of "optimal" culture conditions and embodied methods in the present invention. There are two previous reports that a 3-10 fold increase occurs in plasmid mutagenesis (compared to chromosomal mutagenesis, using culture conditions similar to initial conditions). In one case, the polymerase used was PolI containing an inactivated proofreading domain [Fabret et al. Nucleic Acids Res. 28: E95 (2000)]. Another example developed by the inventors used D424A I709F as a mutated PolI [Shinkai, A. et al. , And Loeb, L. A. J. et al. Biol. Chem. 276: 46759-64 (2001)]. Improvements in the frequency of mutagenesis and in targeting belonged to the following four variables: (1) dilution of initial inoculum (up to at least 1:10 ⁵ ), (2) Cell growth in 2XYT, (3) preheating of the cells at 37 ° C., and (4) continuous growth of the culture past the saturation point (typically 15-17 h).

result:
Example 2 shows individual culture parameters that were found to affect mutagenesis by mutated PolI expression. Ideally, a system for random in vivo mutagenesis will cause frequent mutations in the entire targeted gene (5 'to 3' end), non-target specific. Should be presented as several mutations.

  By varying the culture conditions, optimal mutagenic performance was achieved according to these criteria. It should be allowed for the culture to reach saturation. Other variables that contribute to the effectiveness of random mutagenesis include the type of culture medium, the temperature of the medium at the time of inoculation, and the initial inoculum concentration. Careful optimization of the culture conditions, achieved by trial and error, is critical to obtain mutagenesis. This gives a high target specificity and a wide distribution of mutations.

  The JS200 strain was first described as SC18-12 [Witkin, E .; M.M. and Roegner-Maniscalco, V.M. , J. et al. Bacteriol. 174: 4166-8 (1992)], having the following genotype: SC-18 recA718 polA12 uvrA155 trpE65 lon-11 sulA1. SC-18 possesses tetracycline resistance and is insensitive to lambda phage. PolA12 is a temperature sensitive allele of PolI [Monk, M. et al. and Kinross, J. et al. , J. et al. Bacteriol. 109: 971-8 (1972)]. polA12 appears to be misfolded, which occurs in a manner that disrupts the spatial arrangement of the functional sites of the polymerase and 5 ′ → 3 ′ exonuclease, and miscoordination between these two activities. ) (As seen in the nick translation assay). The elevated temperature further increases misfolding and completely disrupts the effective polymerization at the nick [Uyemura et al. , J. et al. Biol. Chem. 251: 4085-9 (1976)]. The Rec718 allele is derived from an unstable recombinant obtained in conjugation between a recA441 K12 donor and a recA + B / r-derived recipient [Witkin, E. et al. M.M. , Mol. Gen. Genet. 185: 43-50 (1982)]. It carries two base substitutions, one constitutively activates the RecA protein and one is a partial suppressor [(McCall et al., J. Bacteriol. 169: 728-34 [1987). ].

  The preparation of the reporter plasmid is described as follows. A reporter plasmid for measuring the reversion frequency of the β-lactamase gene is a modification of plasmid pGPS3 (New England Biolabs Inc., Beverly, Mass.). This plasmid contains the pUC19 (ColE1 type) origin of replication and the npt and amp genes (for kanamycin and carbenicillin selection). To measure reversion frequency, a G-to-T transversion (at position 76 of the β-lactamase gene) was introduced by site-directed mutagenesis to change the codon GAA (to Glu26) to the ocher stop codon TAA. . The reporter plasmids used to measure the β-lactamase reversion frequency were pLA230 and pLA2800 (having 230 bp and 2800 bp downstream from the pUC19 origin of replication) [Shinkai, A. et al. & Loeb, L. A. , J. et al. Biol. Chem. 276, 46759-46764 (2001)]. Plasmid pGPSori corresponds to pLA230, but has a wild-type β-lactamase gene instead of an interrupted version. It was obtained in the same manner as pLA200, but in this case pGPS3 was used as a template for primers 5'-GCACCCGACATACCATGTCCCTATTTTGTTTATT-3 'and 5'AAACTTGGTCGGTACTCTTACCAATGCTTATATC-3. The pLA2800 corresponds to pGPS3 encoding an ocher stop codon at position 76 of the β-lactamase gene (2748 bp from the origin of replication).

The preparation of competent cells is described as follows. Single colonies grown on LB plates (with appropriate antibiotic selection) were picked and incubated overnight at 30 ° C. in 50 ml LB plus antibiotics without shaking. After shaking the culture of bacteria in 1h, 30 ° C., it was transferred to a flask (containing 450 ml LB antibiotic) and left for 3-4 hours 30 ° C. shaker (0.5-1 of _{OD 600} Until). The cells were chilled on ice for 20 minutes, centrifuged in a Sorval® RC 5B Plus centrifuge and washed twice in 10% glycerin. The pellet was resuspended in ˜2 ml 10% glycerin, aliquoted in 120 μl and quick-frozen on dry ice. In order to avoid revertants and / or suppressors outgrowth, competent cells were first generated with the Poll plasmid and subsequently transformed with the reporter plasmid.

Transformation was performed using a Bio-Rad Gene Pulser ^™ instrument (set to 400Ω, 2.20V and 2.5 μFD). After electric shock, the cells were resuspended in 1 ml LB medium, shaken for 1 h at 30 ° C. and cultured on LB plates (with appropriate antibiotics for plasmid selection). Single colonies were picked into 5 ml LB (with appropriate antibiotics) and grown overnight at 30 ° C. without shaking. For XL1-Blue cells (because temperature or medium is not an issue), resuspension in 2XYT medium, shaking for 30 minutes at 37 ° C., single colony LB medium 16 h in 37 ° C. shaker More standard protocols with growth follow. Transformation (with a reporter gene) most frequently results in a temperature-sensitive phenotypic defect. Due to the replication of the reporter plasmid (which is PolI-dependent and multicopy), it appears that the limited PolI functional reserve of JS200 cells is depleted even under permissive conditions, with revertants and / or suppressors. Convenient for growth of Therefore, a plasmid carrying PolI was used for the first transformation to generate competent cells. This was subsequently used to transform with a reporter plasmid.

The β-lactamase reversion assay was performed as follows. E. coli JS200 transformant strain carrying PolI (wild type or different low fidelity mutant) in the pHSG576 plasmid (chloramphenicol resistance (cm ^r )) was transformed with the reporter plasmid (kanamycin (kan ^r )). Retransformed. Single colonies exhibiting double resistance (cm ^r , kan ^r ) were picked into 5 ml LB (plus tet, kan, cm) and grown overnight without shaking. After shaking for 1 hour at 30 ° C., the culture (OD˜0.5) was diluted 1:10 ⁵ in 5 ml of 2XYT medium (preheated at 37 ° C.). These new cultures were maintained at 37 ° C. for 15 minutes and incubated for 15 hours in a 37 ° C. shaker. β-lactamase stop codon reversion was performed by adding appropriate dilutions of saturated cultures on plates containing 50 μg / ml carbenicillin (Island Scientific, Bainbridge Island, WA) in addition to kanamycin and chloramphenicol. Detection (at least two).

  For rifampin resistance, cells were cultured in 25 μg / ml rifampin. Results are expressed as frequency compared to viable colonies (grown in kan cm alone) and represent the average of at least two clones (independently retained).

Example 3
Synergistic effect of motif A and motif B mutations in vivo and significant targeting of plasmid sequences

  Table 1 below summarizes the results of the assay characterizing the frequency and extent of mutagenesis targeting (results are shown in FIG. 6). JS200 cells were transformed with either wild-type PolI or the respective PolI mutant, and reporter plasmid pLA230. The frequency of β-lactamase reversion (normalized to wild type) is an indicator of the frequency of mutations in a particular target gene. The ratio of rifampicin resistance to carbenicillin resistance reflects the frequency of chromosomal mutagenesis.

Initial conditions presented a culture grown at 30 ° C. to OD 600-0.5, which was diluted 1:50 in nutrient broth and allowed to reach in an 37 ° C. shaker until OD = 0.7 [ Shinkai, A.I. and Loeb, L.M. A. , J. et al. Biol. Chem. 276: 46759-64 (2001)]. Optimized conditions resulted in a culture that grew to an OD 600-0.5 under permissive conditions, which was diluted 1:10 ⁵ in 2XYT (preheated at 37 ° C.) and additionally Incubated for 15 minutes at 37 ° C. and placed on a 37 ° C. shaker for 15 hours (saturated). Mutagenesis frequency was determined by β-lactamase reversion assay (target in plasmid) or by counting rifampin resistant colonies (target in chromosome). Reported values were also normalized to wild type. The relative frequency of plasmid vs. chromosomal mutagenesis for each mutant polymerase was obtained after normalizing to that observed for the wild type polymerase. This introduces variables such as assays of different nature (forward assay (Rif ^r ) vs. β-lactamase reversion assay) and differences in target numbers (single copy (Rif ^r ) vs. multiple copy β-lactamase).

result:
Example 3 investigates the characteristics of mutagenesis related to the expression of different mutated PolI mutants and their sensitivity to culture conditions (FIGS. 5A and 5B). To establish the effect of low fidelity mutations in motif A and in motif B, the following PolI mutants were tested alone and in combination: D424A I709N, A759R, D424A A759R, I709N A759R and D424A I709N A759R (its The subset is shown in FIG. Table 1 summarizes these results. The effect of D424A I709N expression (under initial conditions) is reported in published data [Shinkai, A .; , And Loeb, L. A. J. et al. Biol. Chem. 50: 46759-64 (2001)]. Expression of the D424D A759R mutation results in frequent mutagenesis (comparable to D424A I709N). Similar to the motif A mutation, elevated mutagenesis relies on simultaneous inactivation of the proofreading domain. These results confirm that position A759 (in motif B) is a critical determinant of fidelity in E. coli. Surprisingly, the expression of the I709N A759R D424A triple mutant results in frequent mutations, which exceeds the additive effect (more than additive), and each double mutation described above 6 to 26 times higher than that of the body (the same applies to I709F A759R D424A). Unlike single motif A or motif B mutants, mutagenesis with double motif A and motif B PolI mutants shows some dependence on inactivation of proofreading. This suggests that the combination of mutations (at positions I709F and A759R) results in functional inactivation of the proofreading.

  Under optimized conditions, a frequency of mutagenesis of 15,000 times higher than the wild type was achieved (in other experiments a 100,000-fold increase was observed (FIG. 8B)). This represents a substantial increase over the frequency achieved under “initial” conditions (3,600 times). Also, optimized conditions further limit mutagenesis to the target plasmid. In the case of the I709N A759R D424A triple mutant, plasmid specificity is increased 400-fold. In summary (In sum), the I709 (motif A) and A759 (motif B) mutations synergistically enhance target plasmid mutagenesis. Also, both mutation frequency and targeting are sensitive to growth conditions.

Example 4
Determination of the spectrum and frequency of mutations introduced in the target sequence (during expression of D424A I709N A759R Pol I)

  Table 2 below shows the mutation spectrum of mutations located outside the ocher stop codon in the β-lactamase gene identified in cells expressing D424A I709N A759R PolI. The number in the item indicates the position of the sequence (compared to the origin of replication). Given the nature of the assay used, where functional expression is required, frameshifts and deletions were not determined.

result:
Example 4 provides an illustration of the mutagenic spectrum resulting from mutated PolI expression. To characterize the nucleotide changes associated with I709N A759R D424A PolI expression, 158 carbenicillin resistant clones were sequenced. All 155 of these clones showed mutations in the ocher codon.

  Of these, only two are changed to different stop codons (both to opal) and exhibit an overall specificity of 96.8% for the reversion assay. The wild type sequence is present in 148 of the remaining 153 sequences, and in varying amounts (from trace to about 90%), it is encoded in a multicopy plasmid (having varying degrees of dominance). It is consistent with mutation. In order to establish a complete spectrum of base pair substitution, a good quality sequence of at least 650 bp was obtained for all of these 158 clones. A total of 46 secondary mutations were detected within this 650 bp interval. Of these, 40 were located in the open reading frame (ORF), 22 of which were silent. Only two mutations were detected more than once in this analysis. This points out that the degree of diversity is high. Table 2 shows the mutation spectrum of these 46 secondary mutations.

  Expression of D424A I709N A759R PolI resulted in diverse mutation spectra within 650 nucleotides during this analysis. However, a bias to the transition (80%) was detected, and the GC → AT mutation (56%) was predominance.

  The number of target plasmids present in cells expressing I709N A759R D424A PolI was determined to estimate the mutation burden and was found to be only 10 copies / cell (FIG. 7). This contrasts with ~ 100 copies / cell in cultures expressing wild type PolI. This effect of the PolI point mutation on the target plasmid copy number reduces the size of the mutant library by a factor of 10. However, this reduction in the number of targets per cell appears to have improved the selection efficiency. Because each new mutation is expected to account for the majority of the expressed protein and therefore has a great influence on the phenotype.

  Under optimized mutagenesis conditions, the frequency of stop codon reversion was on the order of 1 in 500 cells (FIG. 6). If 10 target plasmids / cell are expected, this is interpreted as 1 reversion at 5000 codons. This is equivalent to one mutation at 3,900 codons since two of the nine possible base pair substitutions (at the ocher codon) are not allowed. Assuming an even distribution of mutations (ie, mutations at the ocher stop codon represent those of each other codon in the protein), a putative mutation of 1 mutation at 11,500 bp (3 × 3900) It is calculated as an frequency (an estimated mutation frequency). The highest mutation frequency reported in vivo is 0.5 mutations / Kbp [Greener, A. et al. et al. , 7: 189-95 Mol. Biotechnol. (1997)], however, this mutagenesis was unstable upon continuous culture and had severely deleterious effects in the host [Greener, A. et al. et al. , 7: 189-95 Mol. Biotechnol. (1997)].

JS200 cells expressing D424A I709N A759R polymerase and carrying the reporter plasmid pLA230 were grown under conditions optimal for mutagenesis and cultured on plates (containing 50 μg / ml carbenicillin). A single carbenicillin resistant colony was grown. These plasmids were extracted and the sequence of the ocher codon was determined using the oligonucleotide Blac-5. Secondary mutations were confirmed using the following oligonucleotides:
Blac-5 5'-TTACGGTTCCTGGGCCTTTTGC-3 ';
Blac-6 5'-GGTTGAGTACTCACCAGTCAC-3 ';
Blac-7 5'-TCCGATCGGTGTCAGAAGTAA-3 '; and
Blac-8 5′-CCATTTCCACCCCCTCCCCAGTT-3 ′.
Sequences were analyzed using Sequencher software.

Example 5
In vivo mutagenesis with a mutated PolI mutant (as a function of distance from the origin of replication)

FIG. 8B shows the frequency of mutagenesis as a function of distance from the origin of replication (ori), which contains mutant PolI mutants (containing single and double mutations in the active site). In order to assess the level of mutagenic coverage. JS200 cells were transformed with either wild-type or different mutant PolI mutants and one of the following reporters with increased distance between the origin of replication and the position of the ocher stop codon: pLA230, pLA700, pLA1400, pLA2800, and pLA3700. Cultures grown to OD 600-0.5 under permissive conditions were diluted 1:10 ⁵ with 2XYT (preheated at 37 ° C.), additionally incubated at 15 ′, 37 ° C., shaken at 37 ° C. The machine was placed for 15 hours (saturated). Results show one representative experiment. Each point represents the average of two independent cultures, each cultured in duplicate.

result:
PolI has been reported to synthesize ˜400 bp in the leading strand downstream of the ColEl origin [Sakakibara, Y. et al. & Tomizawa, J. et al. , Proc. Natl. Acad. Sci USA 71: 1403-1407 (1974)], at which point both the leading and lagging strands are taken over by the PolIII replisome (taken over) [Staudenbauer, W. et al. L. , Mol. Gen. Genet. 149: 151-158 (1976)]. Thus, many Pol1-dependent mutations were expected to cluster at the 5 ′ end of the target gene. Contrary to this expectation, when mutations further downstream than 500 bp are compared to mutations in the sequence corresponding to the initiating leader, a similar frequency of hits and equivalent A spectrum (a comparable spectrum) was detected. However, when the ocher stop codon in the reporter gene is further positioned as shown in FIG. 3B from the origin of replication (also illustrated in Example 5 and FIG. 8), a reduction in mutagenesis is evident, which is long Results from the absence of synthesis of the leading strand by the mutated PolI at distance. However, the observed decrease in plasmid mutagenesis (at 700 bp points) was only moderate, and in the case of triple PolI mutant mutations the frequency remained constant (another The background for 3Kb exceeds 4 digits). Significant plasmid mutagenesis with PolI (beyond the sequence corresponding to the starting leader strand in the plasmid sequence) was not expected by one skilled in the art. Therefore, Example 5 points out the following. That is, the target sequence at a distance of at least 3700 bp from ori is amenable to mutation due to mutated PolI expression.

Preparation of pLA230 and pLA2800 is provided in Example 2. Other reporters were also derived from the plasmids pLA2800 and pGPSΔ shown below: pLA3800 synthesizes the complete npt (kan ^r ) gene from the synthetic oligonucleotides 5'-CATCGGGTACCTTACCAATTCTGATTAGAAAAAC- and -GATGGGTACCCTAGTAGTACC Containing the recognition site). An amplified fragment of 980 bp was cloned into the KpnI site of plasmid pLA2800 (one additional copy of npt was added and the stop codon moved to 3691 bp of the plasmid replication origin). pLA2200 was produced by excising the Sal1 1517 bp fragment from plasmid pLA3800 and religating the plasmid backbone.

  This moved the stop codon to 2174 bp of the plasmid replication origin. pLA1400 was produced by cloning the PCR amplified npt gene into the SacI and Aflll sites of pLA2800 (a β-lactamase ocher codon is transferred from ori to 1403 bp). Oligonucleotides containing SacI and AflIII adapters used for amplification were 5'-CATCGAGCTCTTAACCAATTCTGATTAGAAAAAC-3 'and 5'-GATGATACATTCTAGATTTAAAATGATACGGATCC-3'.

  pLA700 was generated by subcloning the PCR amplified β-lactamase reporter into the SwaI and SpeI sites of pGPSΔ. The oligonucleotides used were 5'-CATCGATATCTCACCAATGCTTAATCAGTG-3 'and 5'-GATGACTAGTCCCCTTTGTTTATTTTTTCT-3' (containing EcoRV and SpeI adapters, respectively). This places the ocher stop codon (in the β-lactamase gene) only 709 nucleotides away from the origin of replication.

Example 6
Effect of mutant PolI mutant in in vivo mutagenesis of cells expressing wild-type PolI

FIG. 9 (illustration of the data in Table 3) demonstrates the plasmid-specific mutation frequency. This plasmid-specific mutation frequency is variability in the PolI-strained strain (a Pol I proficient strain) to determine if chromosomal wild-type PolI expression interferes with mutated PolI mutagenesis. Mediated by PolI mutants. XLI-Blue cells (strain expressing wild type PolI) were transformed with PolI mutagen (D424 I709N A759R) and reporter plasmid pLA230. They were grown at 30 ° C. to OD˜0.5. The 10 ⁻⁵ dilution was then grown in 2XYT medium for 17 hours in the presence or absence of 100 μg / ml IPTG and cultured in triplicate on carbenicillin plates. The frequency of β-lactamase reversion in XL1-Blue cells and in JS200 cells was plotted for comparison in the presence or absence of the same concentration of IPTG.

result:
Critical genetic material is provided in the vector. And wild-type PolI expression and / or intact DNA repair (in the host) is not significantly interfered with by mutagenesis. Thus, random mutagenesis can be performed in strains specifically designed for complementation with the targeted gene. FIG. 9 and Table 3 (in Example 6) illustrate this point, where the mutated PolI mutant expresses wild-type PolI and is proficient in DNA repair (XL-1 Blue). ) Is demonstrated to be co-dominant. PolI overexpression of mutant PolI increases target plasmid mutagenesis in these cells (by competing with wild-type PolI for target plasmid replication). When overexpressed, it can be expected that the mutated PolI outcompetes the wild type. This is illustrated in FIG. This figure shows that D424A I709N A759R PolI (by inducing expression from the tac promoter with IPTG) in XL-1 Blue cells further increased plasmid mutagenesis to a frequency comparable to that obtained in JS200. Shows that The higher background observed (compared to JS200) will depend on the GlnV mutation (amber suppressor with some activity on ocher). Therefore, this conclusion should not be affected. Rifampicin resistance is comparable between the two strains, indicating that PolI mutagenesis is still plasmid-restricted in XL1-Blue cells.

XLI-Blue ^{cells, F ':: Tn1O proA + B} + lacIq Δ (lacZ) M15 / recA1 endA1 gyrA96 (Nalr) thi hsdRl7 - a _{^{(r k m k +) glnV44}} relA1 lac, and are commercially available ( For example, it can be purchased from Statagene®). Cells were grown under the appropriate antibiotic selection: tetracycline (Sigma®; St. Louis MO) at 12.5 μg / ml and chloramphenicol (Sigma®; St. Louis). MO) was used at a concentration of 30 μg / ml and / or kanamycin (Island Scientific, Bainbridge Island, WA) at a concentration of 50 μg / ml.

Example 7
Phenotypic analysis of aztreonam resistant mutations produced by directed evolution

Table 4 shows the TEM-1 mutation phenotype. These were identified as a result of selections performed to establish applicability to the directed evolution (enzymatic) of the system. JS200 cells (cotransformed with a plasmid encoding D424A I709N A759R PolI and a second plasmid encoding the target TEM-1 β-lactamase) were tested under selective pressure with increasing concentrations of aztreonam. did. Controls include the following transformants: (a) wild type PolI (with wild type β-lactamase); (b) D424A I709N A759R PolI (plasmid lacking β-lactamase) and (c) wild type. PolI (plasmid lacking β-lactamase). Two independent selections were performed under optimized mutagenic conditions. After one round of mutagenesis without selection, 1:10 inoculum was incubated with 0.5 μg / ml aztreonam (IC ₉₉ = 0.2 μg / ml). Viable cells were grown by growing a 1:10 dilution (a 1:10 dilution) in the presence of the same concentration of drug, after which another 1:10 dilution was selected in 32 μg / ml aztreonam. At this concentration, no control showed significant growth. Surviving cells were cultured at 64 μg / ml aztreonam. Plasmids were obtained from single colonies and TEM-1 β-lactamase was sequenced directly using specific primers.

In order to eliminate the potential effects of mutations elsewhere in the vector and to generate single, double and triple amino acid substitutions, subcloned related mutations can be transformed into wild type target plasmids. Subcloned into For phenotypic analysis, the mutants were retransformed into JS200 cells containing wild type PolI (a further mutagenesis was avoided). A dose response curve of the mutations selected for aztreonam is shown in FIG. In addition, Table 4 shows IC ₅₀ s (average of two individual transformants) for all transformants. Fold aztreonam resistance ^a (Fold ^aztreonam resistance ^a) is (normalized to wild type = 100) indicating an _{IC 50} based on the average of two experiments.

Aztreonam was purchased from Drug Services at the University of Washington and resuspended in water at a concentration of 50 mg / ml. Aztreonam dose response curves for JS200 were obtained under the conditions used for PolI mutagenesis (1:10 ⁵ seeds, preheated 2XYT, 15 h on 37 ° C. shaker). The inhibitory concentration of aztreonam (IC ₉₉ ) that killed> 99% of the cells was 0.2 μg / ml. This is true for both JS200 cells transformed with pGPS3ori and cells transformed with pGPS3Δ, confirming that wild-type β-lactamase does not confer significant aztreonam resistance.

JS200 cells were transformed with a plasmid (encoding D424A I709N A759R PolI) and pGPSori (a plasmid encoding wild type β-lactamase starting 150 bp downstream from ori). Controls include cells expressing: (a) wild-type PolI and wild-type β-lactamase; (b) D424A I709N A759R PolI and target plasmid (bearing large β-lactamase deletion) And (c) wild-type PolI and deleted β-lactamase. Two independent selections were performed under “optimized” mutagenic conditions. After one round of mutagenesis without selection, a 1:10 dilution of the culture (a 1:10 dilution) was incubated with 0.5 μg / ml aztreonam (IC ₉₉ = 0.2 μg / ml).

  Viable cells were grown by growing a 1:10 dilution (a 1:10 dilution) in the presence of the same concentration of drug, after which another 1:10 dilution was selected in 32 μg / ml aztreonam. None of the controls survived at this point. This indicates that the presence of both mutated PolI and β-lactamase was essential for resistance under these conditions. Surviving cells were cultured at 64 μg / ml aztreonam. Plasmids were obtained from single colonies and TEM-1 β-lactamase was sequenced directly using specific primers.

  Individual colonies were picked from aztreonam plates and grown under permissive conditions (30 ° C., no shaking) to avoid further mutagenesis in the presence of 10 μg / ml aztreonam. Plasmid was extracted from 3 ml of each of these clones using the Perfectprep® miniprep kit (from Eppendorf AG) and resuspended in 50 μl of water. They were sequenced using primers Blac-5, -6, -7, -8 (Example 4).

Using sites HaeIII, Scal, and FspI (unique within the target plasmid), the mutation identified in the β-lactamase ORF is subcloned by aztreonam selection into a vector encoding β-lactamase, and All possible mutant combinations were generated. These constructs were transformed into JS200 cells (carrying wild-type PolI plasmid) to maintain the same genetic background without inducing further mutagenesis. They were grown in the absence of β-lactam. Cells were diluted in 10 ⁵ cfu / ml standard inoculum and grown for 16 h in the presence of increasing concentrations of aztreonam. IC ₅₀ S was achieved by plotting OD ₆₀₀ against drug concentration and finding the concentration that reduced survival to 50%. To account for variations in expression of individual clones, two independent experiments were performed and averaged. The standard deviation between the two experiments was on the order of 30%.

FIG. 1A is a schematic diagram of a 2-plasmid mutagenesis system (utilizing co-expression of mutant PolI and exogenously introduced DNA template). FIG. 1B is a schematic diagram of a 2-plasmid mutagenesis system (utilizing co-expression of mutated PolI and exogenously introduced DNA template). FIG. 2 shows the residues in motif A and motif B in the active site of E. coli DNA polymerase. These are important with respect to replication fidelity during nucleotide incorporation. FIG. 3A shows an embodiment of template DNA (including prokaryotic and eukaryotic DNA) targeted for in vivo mutagenesis with mutated PolI. FIG. 3B shows several target plasmids. They have varying distances between the origin of replication (ori) and the ocher stop codon in the β-lactamase gene used as a reporter for mutagenesis. FIG. 4 illustrates the three classes of chemical structures of the β-lactamase substrates: penicillin, cephalosporin, and aztreonam. Aztreonam was tested as a selective agent in Example 7. FIG. 5A shows the initial conditions and methods for inducing mutagenesis by expressing mutant PolI in the presence of the target plasmid in culture (discussed in Example 2). FIG. 5B shows optimization conditions and methods for inducing mutagenesis by expressing mutant PolI in the presence of the target plasmid in culture (discussed in Example 2). FIG. 6 shows the effect of culture conditions on mutagenesis (by expression of mutated PolI mutant) (discussed in Example 3). FIG. 7 shows the copy number of the target plasmid (when D424A I709N A759R mutant PolI is expressed under optimized conditions). FIG. 8A shows the position of the mutation. These mutations were identified within the 650 bp interval starting at a distance of 100 bp from the ColEl origin of replication (ori) (discussed in Example 5). FIG. 8B shows how distance affects the frequency of mutations in the target plasmid (discussed in Example 5). FIG. 9 shows the effect of mutant Pol1 expression on the rate of plasmid mutagenesis in the host (wild type for PolI and proficient in the main pathway of DNA repair) (discussed in Example 6). ). FIG. 10 shows a dose response curve of aztreonam resistance (obtained by a representative subset of mutations identified following selection with aztreonam).

Claims (45)

  PolI comprising a mutation in the active site having a first motif A and a second motif B, identified to produce a higher proportion of nucleotide misincorporations than that of natural DNA polymerase A recombinant mutant DNA polymerase of a family of polymerases.   The mutant DNA polymerase according to claim 1, wherein the natural DNA polymerase is an Escherichia DNA polymerase.   2. The mutant DNA polymerase of claim 1, wherein the first motif A is mutated at one or more residues, but the second motif B is not mutated.   2. The mutant DNA polymerase of claim 1, wherein the second motif B is mutated at one or more residues, but the first motif A is not mutated. .   The mutant DNA polymerase according to claim 1, wherein the first motif A and the second motif B are each mutated at one or more residues.   The mutant E. coli DNA polymerase according to claim 1, wherein the mutation in the first motif A does not occur at position 709.   2. The mutant E. coli DNA polymerase according to claim 1, wherein the mutation in the first motif A comprises an amino acid residue substituted at position 709, the amino acid residue being not isoleucine. E. coli DNA polymerase.   8. The mutant DNA polymerase of claim 7, wherein the amino acid residue is phenylalanine.   8. The mutant DNA polymerase of claim 7, wherein the amino acid residue is methionine.   8. The mutant DNA polymerase of claim 7, wherein the amino acid residue is alanine.   8. The mutant DNA polymerase of claim 7, wherein the amino acid residue is asparagine.   The mutant E. coli DNA polymerase according to claim 1, wherein the mutation in the second motif B does not occur at position 756 or 759.   2. The mutant E. coli DNA polymerase according to claim 1, wherein the mutation in the second motif B comprises an amino acid residue substituted at position 756, wherein the amino acid residue is not serine. E. coli DNA polymerase.   14. A mutant DNA polymerase according to claim 13, wherein the amino acid residue is glutamic acid.   The mutant E. coli DNA polymerase according to claim 1, wherein the mutation in the second motif B comprises an amino acid residue substituted at position 759, wherein the amino acid residue is not alanine. E. coli DNA polymerase.   16. A mutant DNA polymerase according to claim 15 wherein the amino acid residue is arginine.   16. A mutant DNA polymerase according to claim 15, wherein the amino acid residue is asparagine.   16. The mutant DNA polymerase of claim 15, wherein the amino acid residue is proline.   16. The mutant DNA polymerase of claim 15, wherein the amino acid residue is serine.   The mutant DNA polymerase according to claim 1, wherein the misincorporation ratio is at least 10 times higher.   The mutant DNA polymerase according to claim 1, wherein the ratio of misincorporation is at least 100 times higher.   The mutant DNA polymerase according to claim 1, wherein the ratio of misincorporation is at least 1000 times higher.   2. The mutant DNA polymerase of claim 1, wherein an exonuclease domain in the mutant polymerase is inactivated.   2. The mutant DNA polymerase of claim 1 that functions in vivo.   2. The mutant DNA polymerase of claim 1 that functions in vitro.   A vector encoding the mutant DNA polymerase of claim 1.   A host cell comprising the vector of claim 26. A method for generating random mutations by in vivo mutagenesis within a target DNA sequence comprising:
PolI, which contains a mutation in the active site having the first motif A and the second motif B and has been identified to produce a higher proportion of nucleotide misincorporation than that of natural DNA polymerase. Providing a suitable host cell having a first DNA vector expressing a mutant DNA polymerase of a family polymerase;
A second DNA vector encoding a target sequence located downstream of the origin of replication (the second DNA vector has been subjected to mutagenesis by a mutant DNA polymerase expressed from the first DNA vector; Producing a mutated form of the target DNA), and
Growing the transformed cells under a set of conditions that substantially promotes the rate of plasmid-specific mutagenesis to be higher than the rate of chromosomal mutagenesis;
A method comprising: 30. The method of claim 28, for selecting a mutated target DNA that confers a defined biological function:
Contacting the transformed cells with a selective medium (transformed cells surviving therein exhibit a defined biological function); and
Isolating the mutated target DNA from living transformed cells;
A method comprising: A method for generating random mutations by in vivo mutagenesis within a target DNA sequence comprising:
PolI, which contains a mutation in the active site having the first motif A and the second motif B and has been identified to produce a higher proportion of nucleotide misincorporation than that of natural DNA polymerase. Generating a suitable host cell expressing a mutant DNA polymerase of a family polymerase;
A DNA vector encoding a target sequence located downstream of the origin of replication, which is subjected to mutagenesis by the expressed mutant DNA polymerase to produce a mutated form of the target DNA Providing said host cell with: and
Growing the transformed cells under a set of conditions that substantially promotes the rate of plasmid-directed mutagenesis higher than the rate of chromosomal mutagenesis;
A method comprising: 32. The method of claim 30, for selecting a mutated target DNA that confers a defined biological function:
Contacting the transformed cells with a selective medium (transformed cells surviving therein exhibit a defined biological function); and
Isolating the mutated target DNA from living transformed cells;
A method comprising: A method according to claim 28 or 30, wherein the set of conditions to be controlled is:
Growing a culture of transformed cells in a rich medium; and
Allowing the culture to reach and maintain a growth phase;
Including methods. A method according to claim 28 or 30, wherein obtaining the set of conditions to be controlled is:
Initiating culture of transformed cells with a low inoculum of starter cells;
Growing a culture of transformed cells in a rich medium;
Incubating the culture at a limiting temperature before shaking; and
Allowing the culture to reach and maintain a growth phase;
Including methods.   31. A method according to claim 28 or 30, wherein the target DNA is represented by a prokaryotic or eukaryotic sequence.   31. A method according to claim 28 or 30, wherein the suitable host cell represents a prokaryotic strain.   36. The method of claim 35, wherein the prokaryotic strain expresses a temperature sensitive DNA polymerase allele.   36. The method of claim 35, wherein the prokaryotic strain endogenously expresses wild type DNA polymerase.   36. The method of claim 35, wherein the prokaryotic strain endogenously expresses wild-type DNA polymerase and exhibits a wild-type mismatch repair function.   36. The method of claim 35, wherein the prokaryotic strain carries a genetic defect that accepts complementarity.   34. The method of claim 32 or 33, wherein the rich medium comprises nucleoside analogs, the nucleotide analogs being fluorophores, chemiluminescents, bioluminescents or radioisotopes. A method of labeling with a group selected from the group consisting of: A kit for producing a mutation in a DNA molecule, comprising:
A container; and
A vector encoding the mutant DNA polymerase of claim 1. 42. A kit according to claim 41, comprising:
A second container; and
Deoxyribonucleoside triphosphate or related analog.   43. The kit according to claim 42, wherein the deoxyribonucleoside is labeled or unlabeled. A kit for producing a mutation in a DNA molecule, comprising:
A container; and
A vector encoding the mutant DNA polymerase of claim 2. 45. The vector of claim 44, wherein the vector encodes a mutant polymerase comprising one or more of the mutant polymerases described below:
A mutant having asparagine at position 709 (which replaces wild-type isoleucine);
A mutant having phenylalanine at position 709 (which replaces wild-type isoleucine);
A mutant having an alanine at position 709 (which replaces wild-type isoleucine);
A mutant having a methionine at position 709 (which replaces wild-type isoleucine);
A mutant having arginine at position 759 (which replaces wild-type alanine);
A mutant having asparagine at position 759 (which replaces wild-type alanine);
A mutant having a proline at position 759 (which replaces wild-type alanine);
A mutant having a serine at position 759 (which replaces wild-type alanine);
A mutant having glutamic acid at position 756 (which replaces wild-type serine);
A mutant having asparagine at position 709 (which replaces wild-type isoleucine) and arginine at position 759 (which replaces wild-type alanine); and
Mutant with phenylalanine at position 709 (which replaces wild-type isoleucine) and arginine at position 759 (which replaces wild-type alanine).

Images