CN112813069B - Rice brown planthopper feeding induction type promoter and application - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses a nilaparvata lugens feeding induction type promoter and application thereof. The nilaparvata lugens feeding inducible promoter is named Ptps31, the length of the promoter is 2346bp, and the nucleic acid sequence of the promoter is shown in a sequence table SEQ ID NO. 1. The promoter is a promoter of a terpene substance key gene namely terpene synthase gene OsTPS31 cloned and synthesized from a rice variety RH, and fragment deletion with different lengths is carried out on 5' of a promoter Ptps31, so that researches show that positive regulatory elements of specific expression of food intake by brown planthopper exist in two regions, and negative regulatory elements of specific expression of food intake by brown planthopper exist in one region. The nine promoters and the corresponding expression vector preparation method thereof have potential application value in rice insect-resistant genetic engineering breeding.

Description

Rice brown planthopper feeding induction type promoter and application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a nilaparvata lugens feeding induction type promoter and application thereof.

Background

The rice is the main grain of more than half of the population all over the world and is also an important grain crop in China, the yield and the quality of the rice are greatly influenced by insect pests, wherein brown planthopper is one of the most serious insects harmful to the rice, and 10 percent of yield loss of the rice every year is caused by the insect pests. In 2005 to 2008, the total area of rice affected by brown planthopper in China is about 2500 million hectares, which causes the loss of rice yield of 270 million tons, thus improving the insect resistance of rice is necessary.

The main strategy for crop protection of insects has been the use of chemical insecticides over the last 50 years, but in china and other countries, the use of insecticides will be less and less. Insect-resistant rice varieties are being sought as effective comprehensive pest control strategies in rice production. One of the major goals of rice breeding programs is to integrate pest resistance into modern rice varieties.

With the continuous development of transgenic technology, genetic engineering is used as a main tool for crop improvement and gene function research, a promoter used in the genetic transformation process is one of key elements, and the promoter is more and more concerned as an important component of an expression vector in the genetic engineering. The most commonly used constitutive promoters are CaMV35S, Act1, ZmUbi1 and the like, and the constitutive expression of an exogenous gene under the transcriptional control of the constitutive promoter often causes unexpected phenotypic change, most commonly causes the growth of plants to be slowed down. Transcriptional regulation of constitutive promoters often leads to reduced plant growth due to the negative effects of accumulating molecules during cellular metabolism and energy expenditure.

The brown planthopper inducible promoter is used for driving the resistance gene to express in the rice, so that the resistance gene is efficiently expressed when the brown planthopper eats, excessive energy consumption caused by constitutive expression can be avoided, and the brown planthopper resistance of the rice is improved. At present, the research on inducible promoters in plants is mostly seen in hormone, abiotic stress and disease resistance, the research on insect feeding inducible promoters is less, and the immature insect feeding inducible promoters can be practically applied.

Therefore, a promoter capable of solving the defects is provided for experimental research and insect-resistant breeding, and the development of a promoter capable of being applied to insect-resistant transgenic engineering is very urgent.

Disclosure of Invention

The invention aims to provide a rice brown planthopper feeding induction type promoter, which can improve or not improve the expression level of exogenous genes in transgenic rice under the condition of feeding brown planthoppers.

The invention also aims to provide application of the promoter in cultivation of brown planthopper resistant transgenic rice.

The technical scheme of the invention is as follows:

the invention provides a brown planthopper feeding inducible promoter for rice, which is a promoter of a terpene synthase gene OsTPS31(LOC _ Os08g07100) cloned from the genome of a brown planthopper-resistant rice variety RH (Rathu Heenati, a conventional indica rice variety) for synthesizing a rice terpene substance. The nilaparvata lugens feeding inducible promoter is named Ptps31, the length of the promoter is 2346bp, and the nucleic acid sequence of the promoter is shown as SEQ ID NO. 1.

The invention further intercepts a series of 5 ' end deletion fragments of the rice brown planthopper feeding inducible promoter, the 5 ' end deletion fragments are respectively named as P-2060, P-1828, P-1265, P-941, P-782, P-645, P-482 and P-218, the lengths of the fragments are 2060bp, 1828bp, 1265bp, 941bp, 782bp, 645bp, 482bp and 218bp, and the 5 ' deletion fragment sequence is shown as SEQ ID N0:2-SEQ ID NO. 9.

The nilaparvata lugens feeding inducible promoter is derived from chip data of nilaparvata lugens feeding rice transcriptome of rice team transformation group Li Chanyan doctor in China key laboratory of China center agricultural university crop genetic improvement, the expression level of TPS31 gene in the chip data is obviously adjusted after nilaparvata lugens are fed for 6h and 24h, and the detection is carried out through RT-PCR. Separating the promoter to obtain promoter fragments with different lengths, which are respectively named as: ptps31, P-2060, P-1828, P-1265, P-941, P-782, P-645, P-482 and P-218, the sequences of which are shown in sequence tables SEQ ID NO 1 to SEQ ID NO 9, and then carrying out functional identification. A series of promoter fragments were fused into transformation vector DX2181, which were designated DX2181-Ptps31, DX2181-P-2060, DX2181-P-1828, DX2181-P-1265, DX2181-P-941, DX2181-P-782, DX2181-P-645, DX2181-P-482 and DX2181-P-218, respectively. The expression mode of the GUS reporter gene driven by the promoter in transgenic rice is analyzed, and the following results are found: the promoter can specifically drive GUS gene expression after brown planthopper eats, and meanwhile, the GUS enzyme activity detection is consistent with the GUS histochemical staining result. The promoter P-2060, P-1828, P-1265, P-941, P-782, P-645, P-482 and P-218 sequences are respectively sequences shown in a sequence table SEQ ID N0:2, a sequence table SEQ ID N0:3, a sequence table SEQ ID N0:4, a sequence table SEQ ID N0:5, a sequence table SEQ ID N0:6, a sequence table SEQ ID N0:7, a sequence table SEQ ID N0:8 and a sequence table SEQ ID N0: 9. They are the sequences of 2060bp, 1828bp, 1265bp, 941bp, 782bp, 645bp, 482bp and 218bp truncated by the promoter Ptps31 respectively. After 8 transgenic plants are inoculated with brown planthoppers, the region from-1265 to-941 contains a brown planthopper feeding negative regulation element, the region from 941 to-782 contains a brown planthopper positive regulation element, and the region from 482 to-218 contains a brown planthopper feeding induction expression core regulation element.

The cloned OsTPS31 promoter can specifically respond to the nilaparvata lugens after eating, but does not respond to physical damage, and the research on the promoter is favorable for further understanding the relationship between nilaparvata lugens eating and terpene synthase gene expression; the promoter is beneficial to the improvement of brown planthopper resistant rice in genetic engineering.

The promoter of the present invention can be used to construct an expression vector for tissue-specific expression by those skilled in the art. In addition, the exogenous gene can be operably connected to the promoter of the invention to construct an expression cassette, and the expression cassette can be further introduced into a plant expression vector to obtain a recombinant expression vector for tissue-specific expression. Therefore, the invention also comprises an expression cassette constructed by the promoter, and an expression vector or a recombinant vector containing the expression vector or the expression cassette.

The promoter can be used for preparing transgenic rice. For example, transgenic rice is obtained by Agrobacterium-mediated transformation, particle gun method, pollen tube pathway and the like. Thus, the insect-resistant and disease-resistant rice can be cultivated by introducing insect-resistant and disease-resistant genes and the like, and the insect-resistant and/or disease-resistant activity of the rice is improved.

The P-2060, P-1828, P-1265, P-941, P-782, P-645 and P-482 promoters, expression cassettes thereof, recombinant expression vectors and transgenic cells can improve the expression level of exogenous genes in transgenic rice under the condition that brown planthoppers feed. The promoter sequence and the exogenous gene are fused to construct a recombinant expression vector, the recombinant expression vector is introduced into rice by a genetic transformation method, and the expression quantity of the exogenous gene in the transgenic rice is increased under the condition of feeding induction of the brown planthopper.

The P-218 promoter sequence and the exogenous gene are fused to construct a recombinant expression vector, are introduced into rice by a genetic transformation method, cannot improve the expression level of the exogenous gene in transgenic rice under the condition that brown planthopper eats, and can be used as a core promoter sequence for research on synthetic promoters.

The foreign gene of the present invention may be a reporter gene, such as a GUS gene; or other genes with special functions, such as rice insect-resistant, disease-resistant, stress-resistant, yield-increasing genes and the like.

The invention has the beneficial effects that:

the invention identifies the nilaparvata lugens feeding induction promoter Ptps31 and a core region for controlling the expression quantity thereof, and enriches the species of nilaparvata lugens induction promoters.

The brown planthopper feeding induction positive control region and the brown planthopper feeding induction negative control region obtained by the invention provide a new promoter resource for the genetic engineering and molecular breeding of brown planthopper resistance of rice.

The promoter can be used for breeding insect-resistant transgenic rice and improving rice genetic engineering, and greatly enriches the selectivity of insect-resistant genetic engineering promoter tools.

Drawings

FIG. 1: general technical roadmap of the invention.

FIG. 2: DX2181 plasmid map, transformation vector used in the present invention.

FIG. 3: ptps31 and its series deletion fragments.

FIG. 4: southern blot detection of copy number of Ptps 31T 0 generation transformed plants. M represents marker, and 1-26 represent different transgenic plant samples respectively.

FIG. 5: ptps31 genetic transformation material GUS histochemical staining.

FIG. 6: the gene expression quantity of TPS31(LOC _ Os08g07100) gene of rice transcriptome chip taken by brown planthopper is changed, and the GUS gene expression condition and GUS enzyme activity detection of Ptps31 genetic transformation material are carried out after the brown planthopper takes the rice transcriptome chip. a is TPS31 expression quantity chip data, b is GUS gene expression level detection; and c, detecting the GUS enzyme activity.

FIG. 7: and (3) detecting the expression level of GUS gene of genetic transformation material of the brown planthopper feeding series deletion fragment.

Detailed Description

According to the invention, through analyzing the data of the Landrania fuliginea brown planthopper rice inoculation chip transformed by the key laboratory of the Huazhong agricultural university crop genetic improvement country, a gene Loc _ Os08g07100(TPS31) which can be efficiently up-regulated after the Landrania fuliginea is fed is discovered. The expression level of OsTPS31 gene in rice leaf sheath tissue after brown planthopper eats is detected by RT-PCR, the used databases for sequence query are NCBI (https:// www.ncbi.nlm.nih.gov /) and TIGR (http:// rice. plant biology. msu. edu), the total 1389bp of OsTPS31 gene is shown in SEQ ID NO:10, RT-PCR primers are designed by the 1389bp sequence for the detection, and the result shows that the OsTPS31 gene can be up-regulated and expressed by the specific induction of brown planthopper eating and is not up-regulated and expressed by physical injury induction.

On the result, primers were designed, a candidate promoter fragment was obtained by PCR amplification from the rice "RH" genome, the length of the promoter was 2346bp, which was named Ptps31, and the promoter fragment was inserted into the multiple cloning site (see FIG. 2 for information on vector map and multiple cloning site) of the promoter function analysis vector DX2181 (this vector was designed and stored by Proc. Natl. Rev. cham. Sum. Conn. Sum. of the national Central laboratory for the genetic improvement of crops of university of Huazhong agriculture), and then the DX2181-Ptps31 vector (FIG. 3) was assembled, and then the DX2181-Ptps31 vector was transformed into the rice variety "Zhonghua 11" callus, T.sub. 11 "callus by Agrobacterium-mediated genetic transformation method₀The transgenic plants are subjected to southern blot detection (figure 4) and hygromycin germination test to determine transgenic positive plants, and transgenic positive families are obtained for subsequent inoculation experiments.

And (3) inspecting the expression condition of the promoter in the rice leaf sheath tissue through GUS enzyme activity detection and GUS histochemical staining. The detection result shows that the expression activity of the promoter is not changed under the conditions of no treatment and mechanical injury treatment, the expression activity is obviously up-regulated after the promoter is fed by the brown planthopper, and the data are consistent with the data of a transcriptional chip of rice fed by the brown planthopper (figure 5 and figure 6).

8 5' -end deletion fragments derived from DX2181-Ptps31 were constructed by fragment deletion method and ligated into transformation vector DX2181 (FIG. 3) to transform rice variety "Zhonghua 11" in the same manner and obtain T₀The generation transformed plants are used for the brown planthopper inoculation experiment. The expression pattern of the fragments showed: the promoter region-1265 to-941 contains a brown planthopper feeding negative regulatory element, the region 941 to-782 contains a brown planthopper positive regulatory element, and the region 482 to-218 contains a brown planthopper feeding inducible expression core regulatory element (figure 7).

The present invention will be described in detail with reference to examples in order to make the objects, technical solutions and advantages of the present invention more apparent, but they should not be construed as limiting the scope of the present invention.

Example 1: acquisition of nilaparvata lugens feeding inducible promoter Ptps31 and corresponding deletion fragment thereof

Unless otherwise specified, all references to methods and corresponding molecular biological basic operations used herein may be had by reference to: J. sambrook et al, "guide to molecular cloning experiments (second edition), version of the book, science publishers, 1996 edition.

Extracting the genome DNA of the rice 'Zhonghua 11': a3 cm-long fresh leaf of rice at the four-leaf stage is taken, and the method refers to a CTAB extraction method published by Murray in 1980 (Murray MG, Thompson WF. Rapid isolation of high-motion mu 1ar weight plant DNA. nucleic Acids Res.1980, 8: 4321-5. the extracted DNA is completely dissolved and then stored in a refrigerator at-20 ℃.

Obtaining an ATG upstream sequence of an initiation codon of an OsTPS31(LOC _ Os08g07100) gene sequence in NCBI and TIGR databases, designing specific primers Ptps31-F and Ptps31-R (table 1), amplifying to obtain a brown planthopper feeding inducible promoter, 2346-1 (the initiation codon base A is +1) to 2346bp in total, and naming the promoter as Ptps31 under the PCR reaction conditions: 5min at 95 ℃, 30sec at 58 ℃, 2min at 72 ℃, 30 cycles, and 7min at 72 ℃, and the nucleic acid sequence is shown in the list SEQ ID NO: 1.

Taking 2 mu 1 of PCR product of Ptps31 to detect by 0.8% agarose gel electrophoresis, using the residual product for TA cloning, using a kit of a Peasy-T3 carrier system of Beijing Quanji Biotech company, and a reaction system of 5 mu 1, wherein the specific operation is described in the kit specification. After the clone grows out, selecting a single clone, culturing for 8-10h by using a corresponding resistant LB culture medium, extracting plasmids, carrying out double enzyme digestion on the plasmids by using Hind III and Pst I and carrying out gel running detection, sending the positive clone plasmids to Shanghai Biotech company for sequencing, and reserving the positive single clone plasmids for subsequent DX2181 vector connection.

The 8 5' -deleted fragments and the full-length promoter share a right primer Ptps31-R (Table 1), and the left primers are respectively named as P2060-F, P1828-F, P1265-F, P941-F, P782-F, P645-F, P482-F and P218-F (Table 1) according to the sizes of the amplified fragments. The PCR template was the correctly sequenced TA-Ptps31 plasmid. The subsequent operation and the mode of constructing TA-Ptps31 are the same, namely 8 5' deletion promoters which are respectively named as DX2181-P-2060, DX2181-P-1828, DX2181-P-1265, DX2181-P-941, DX2181-P-782, DX2181-P-645, DX2181-P-482 and DX2181-P-218, and the sequences are shown in the lists of SEQ ID NO 2-SEQ ID NO 9.

Example 2: construction of promoter transformation plant vector

Utilizing HindIII and PstI double enzyme digestion vector DX2181, recovering vector fragments by using a DNA gel recovery kit of Tiangen Biochemical technology Co., Ltd, specifically operating according to the kit instruction, detecting the enzyme digestion integrity by electrophoresis, and storing in a refrigerator at-20 ℃.

The plasmid was cloned by using HindIII and Pst I double-digested Ptps31 and the corresponding TA cloning fragment. Recovering target fragment and detecting integrity of the fragment by the same method, and storing in a refrigerator at-20 deg.C.

Constructing the fragment recovered by enzyme digestion and the corresponding deletion fragment on a vector DX2181 through the cohesive end of the enzyme digestion site (the information of a vector diagram, a multiple cloning site and the like are shown in a figure 2), and electrically transforming Escherichia coli DH5 alpha competent cells. After enzyme digestion detection and sequencing, a recombinant expression vector DX2181-Ptps31 and a corresponding deletion fragment vector are obtained. The vector DX2181-Ptps31 is introduced into Agrobacterium EHA105 competent cell by electrotransformation method to obtain positive Agrobacterium monoclonal cell, and then equal volume of 50% glycerol is added into a 1.5ml centrifuge tube to preserve bacterial liquid at-70 ℃ for Agrobacterium mediated rice callus genetic transformation.

TABLE 1 primer sequences used in the present invention

Note: the underlined sequences in Table 1 represent the cleavage sites. The AAGCTT sequence represents a Hind III cleavage site, and the CTGCAG sequence represents a Pst I cleavage site.

Example 3: agrobacterium mediated rice variety Zhonghua 11 callus genetic transformation

The Agrobacterium-mediated genetic transformation method used in the present invention is described in "A Manual of Agrobacterium-mediated genetic transformation operations" published in the national laboratory for genetic improvement of crops, university of agriculture in Huazhong (Lin champion et al, 2002). The embryogenic callus induced by the variety of the transformed rice Zhonghua 11 (from the institute of crop science of Chinese academy of agricultural sciences). Respectively carrying out callus induction culture, callus subculture, agrobacterium infection and co-culture, screening to obtain resistant callus with hygromycin resistance, and carrying out differentiation, rooting, seedling hardening and transplanting to obtain a transgenic plant. The agrobacterium-mediated genetic transformation procedure and the medium formulation involved in the present invention are described below.

1. Reagent and solution abbreviations

Kan (kanamycin); 6-BA (6-benzyladenine); KT (Kinetin ); NAA (theacetic acid); IAA (indoleacetic acid); 2,4-D (2, 4-dichlorophenoxyacetic acid); AS (acetosyringone); CH (hydrolyzed casein); HN (hygromycin); DMSO (dimethyl sulfoxide); n6max (N6 bulk solution); n6min (N6 minor ingredient solution); MSmax (MS bulk solution); MSmin (MS small component solution)

2. Agrobacterium-mediated genetic transformation

1) Inducing callus

a. Removing glume from mature seed, soaking in 75% ethanol for 30sec-lmin, and adding 0.15% HgCl₂Soaking for 15-20min, finally rinsing for 6-8 times by using sterile distilled water, and cleaning residual HgCl₂And (3) solution.

b. Inoculating 8-10 seeds into each bottle of induction culture medium, and performing dark culture at 26 ℃ for 35 d.

2) Callus subculture

a. The subculture medium was prepared 2-3d in advance, and the medium was allowed to dry:

b. and (3) selecting light yellow, compact, dry and strong-activity embryonic callus, transferring the embryonic callus into a subculture medium, and performing dark culture at 26 ℃ for 20 days.

3|) preculture

The compact, relatively dry embryogenic callus was selected and placed on pre-culture medium for 2 weeks in the dark at 25 ℃.

4) Agrobacterium culture

a. Thawing agrobacterium liquid containing a transformation vector on ice, streaking the agrobacterium liquid on a Kan resistance LA culture medium, and culturing for 2d at 28 ℃;

b. streaked Agrobacterium was scraped into suspension medium (1 each)Adding 100 mu 1AS into 00ml of culture medium), carrying out shaking culture at 28 ℃ and 200rpm for 2-3 h, and then adjusting the concentration of the bacterial liquid to OD₆₀₀≈0.5。

5) Infection with Agrobacterium

a. Collecting the induced callus in a sterilized bottle;

b. mediation of Agrobacterium suspension to OD₆₀₀≈0.8-1.0；

c. Soaking the callus in the agrobacterium tumefaciens suspension for 30 min;

d. transferring the callus to sterilized filter paper for blotting: culturing in co-culture medium at 19-20 deg.C.

6) Washing and screening culture of callus

a. And (3) washing the callus with sterilized water until no agrobacterium can be seen:

b. soaking in sterilized water containing Carbenicillin (CN) 400mg/L for 30 min;

c. transferring the callus to sterilized filter paper for blotting:

d. transferring the callus to the screening medium for 2 weeks, and repeating the above steps 2-3 times.

7) Callus differentiation

Transferring the vigorous resistant callus into a differentiation culture medium, and placing the differentiation culture medium in a light culture chamber for light culture until a regeneration seedling is differentiated.

8) Rooting

When the bud of the regenerated plantlet grows to 2-3cm high, the plantlet can take root. The roots growing on the regenerated plant differentiation culture medium are cleaned by scissors and forceps, and are inserted into a rooting culture medium and placed in a light culture room for culture until new white roots grow.

9) Hardening and transplanting seedlings

When the new root grows to about 2cm, hardening the seedling: and removing the sealing membrane of the rooting culture medium, adding a proper amount of tap water, and continuously culturing for 3d in an illumination culture room. Transplanting: residual medium on the roots was washed off and seedlings with good root system were transferred to the greenhouse while keeping the water moist for the first few days.

3. Main solution formulation

1) MSmax stock solution (10x)

Dissolving one by one, adding dH₂And (4) metering the volume of O to 1000mL, and storing at room temperature.

2) MSmin stock solution (100x)

Note: na2 MoO₄·2H₂O must be dissolved separately, mixed with the other components, and dH added₂And (4) metering the volume of O to 1000mL, and storing at room temperature.

3) N6max stock solution (10x)

Dissolving one by one, then adding dH₂And (4) metering the volume of O to 1000mL, and storing at room temperature.

4) N6min stock solution (100x)

5) Fe2+ -EDTA stock solution (100x)

Adding 300mLdH into a reagent bottle₂O and

FeSO₄·7H₂O 2.785g

adding 300mLdH into another reagent bottle₂O, and heating to 70 ℃, then

Adding Na₂·EDTA·2H₂O 3.73g

Dissolving respectively, mixing the two solutions, keeping the temperature at 70 deg.C for 2 hr, and adding dH₂The volume of O is up to 1000mL, and the product is stored at 4 ℃ in the dark.

6) Vitamin stock solution (100x)

Adding dH₂The volume of O is up to 1000mL, and the mixture is stored at 4 ℃.

7)6-BA stock solution (1mg/mL)

6-BA 100mg

1mL of 1M KOH was added and stirred until 6-BA dissolved, followed by addition of dH₂And (4) keeping the volume of O to 100mL, and storing at room temperature.

8) KT stock solution (1mg/mL)

KT 100mg

Adding 1mL of 1M KOH, stirring until KT is dissolved, and then adding dH₂And (4) keeping the volume of O to 100mL, and storing at room temperature.

9)2, 4-D stock solution (1mg/mL)

2，4-D 100mg

1mL of 1M KOH was added and stirred until 2,4-D dissolved, then dH was added₂And (4) keeping the volume of O to 100mL, and storing at room temperature.

10)100mMAS stock solution

AS 0.196g

DMSO 10mL

Subpackaging with a 1.5mL centrifuge tube, and storing at 4 ℃.

11) IAA stock solution (1mg/mL)

IAA 100mg

1mL of 1M KOH was added and stirred until IAA dissolved, then dH was added₂And (4) keeping the volume of O to 100mL, and storing at room temperature in a dark place.

12) NAA stock solution (1mg/mL)

IAA 100mg

Adding 1mL of 1M KOH, stirring until NAA is dissolved, and then adding dH₂And (4) keeping the volume of O to 100mL, and storing at room temperature in a dark place.

13)1N KOH stock solution

KOH 5.6g

By dH₂O constant volumeTo 100mL, and stored at room temperature.

14)0.15％HgCl₂

1.5g HgCl₂Dissolving with 1mL of absolute ethyl alcohol, and then using dH₂And (4) adding O to 1000mL, and stirring for 4-8 h.

4. Culture medium formula

1) Induction medium

dH compensation₂O to 1000mL, adjusted to pH 5.9 with 1M KOH.

2) Subculture medium

dH compensation₂O to 1000mL, adjusted to pH 5.9 with 1M KOH.

3) Co-culture medium

dH compensation₂O to 250mL, adjusted to pH 5.6 with 1M KOH.

4) Suspension culture medium

dH compensation₂O to 100mL, adjusted to pH 5.4 with 1M KOH.

5) Screening Medium

dH compensation₂O to 250mL, adjusted to pH 6.0 with 1M KOH.

6) Differentiation medium

dH compensation₂O to 1000mL, adjusted to pH 6.0 with 1M KOH.

7) Rooting culture medium

dH compensation₂O to 1000mL, adjusted to pH 5.8 with 1M KOH.

8) LA medium (LB medium without agar powder)

dH₂Dissolving O, fixing the volume to 250ml, filling into a 500ml triangular flask, sterilizing, and storing at room temperature for later use.

Example 4: PCR method for detecting transgenic positive plant

Transferring the transformed seedling into a greenhouse, growing to a leaf stage more than four, then dividing a single plant into 1-2cm tender leaves, extracting the genome DNA of the tender leaves as a template, and detecting positive plants by a PCR method. The amplified fragment is a partial fragment of the reporter gene GUS, and the size of the fragment is 699 bp.

The primer sequence is as follows:

GUS-F:GGGCGAACAGTTCCTGATTA，

GUS-R:AACGTATCCACGCCGTATTC。

and (3) PCR reaction conditions: PCR products at 95 ℃ for 5min, 95 ℃ for 30sec, 58 ℃ for 30sec, 72 ℃ for 30sec, 30 cycles, and 72 ℃ for 7min were detected by 0.8% agarose gel electrophoresis. To what is neededHaving a T₀Carrying out PCR detection on the generation plants, and rejecting false positive transformation plants according to results.

The extraction method of the small sample DNA comprises the following steps:

1) 2cm long young leaves were placed in a 2mL centrifuge tube, ground with a sample grinder, and 800. mu.L of 1.5 × CTAB (formulation: 15g CTAB +75mL 1M Tris-HCl (pH 8.0) +30mL 0.5M EDTA +61.4g NaCl + ddH₂O＝1000mL)。

2) Water bath at 65 deg.C for 30min, and mixing up and down once every 5 min.

3) In a fume hood, 600. mu.L of chloroform was added to each tube and inverted from top to bottom for 5-10 min.

4) Centrifuging at 8000r/min for 10min, sucking 400 μ L supernatant into a new centrifuge tube, adding 600 μ L isopropanol, and mixing.

5) Centrifuging at 12000r/min for 15 min.

6) Pouring off the liquid, reversing the liquid on the absorbent paper, sucking the surface liquid, adding 1mL of 75% ethanol, and mixing uniformly.

7)7500r/min and 5 min.

8) Pouring out the liquid, reversely covering on absorbent paper to suck the surface liquid, drying the liquid on an ultra-clean bench, adding 100 μ L of sterilized ddH₂O dissolves the DNA. (1-2. mu.L of DNA template can meet the general PCR requirements.)

Example 5: single copy homozygous family plant detection

Extracting the genome DNA of the rice 'Zhonghua 11': about lg of a fresh leaf of rice at a tillering stage is taken, the method refers to a CTAB extraction method (Murray MG, Thompson WF. Rapid isolation of high-molecular mu 1ar weight plant DNA. nucleic Acids Res.1980, 8:4321-5) published in 1980 by Murray, and the extracted DNA is completely dissolved and then stored in a refrigerator at the temperature of-20 ℃ for southern blot experiment.

Preparation of southern blot probe: the probe was labeled with Digoxin (DIG) by PCR method, using DX2181 vector as template, and hygromycin gene (HPT) sequence as probe sequence.

The primer sequence is

HPT-F:AGAATCTCGTGCTTTCAGCTTCGA，

HPT-R:TCAAGACCAATGCGGAGCATATAC。

The PCR reaction conditions are as follows: 5min at 95 ℃, lmin at 95 ℃, 30sec at 58 ℃, 30sec at 72 ℃, 32 cycles, 7min at 72 ℃.

Rice genome is enzyme-digested, and the carrier DX2181 contains the selection marker gene hygromycin and does not contain HindIII enzyme-digested sites, so that enzyme digestion is completed on 8 mu g of rice genome by selecting HindIII. The digested DNA samples were subjected to 30v, 24h electrophoresis on a 1% TAE agarose gel. The labeled hygromycin probe was hybridized with T-DNA as described in Southern 1975 (Southern EM.detection of specific sequences and DNA fragments segmented by gel electrophoresis. J.mol.biol.1975, 98: 503-. The results of single copy DX2181 Ptps31 are shown in FIG. 4.

And (3) performing single plant harvest on the obtained T0 generation single copy plants, sowing single plants in the later period, and simultaneously independently harvesting each T1 generation single plant. And carrying out a germination experiment on the obtained seeds to determine whether the seeds are of a single-copy homozygous family. The specific method comprises the following steps: removing glume from mature seed, soaking in 75% ethanol for 30sec-1min, and adding 0.15% HgCl₂Soaking for 15-20min, and sterilizing with dH₂Rinsing for 6-8 times with O, and cleaning residual HgCl₂And (3) solution. Placing the seeds in the rooting culture medium (round dish) containing hygromycin, placing 50 seeds in each dish, placing the dishes in a light culture room for culture for 7 days, and then counting the germination rate, wherein the germination rate of the seeds is over 95 percent if the seeds are homozygous positive plants, the germination rate of the seeds is about 75 percent if the seeds are heterozygous positive plants, and the germination rate of the seeds is about 0 percent if the seeds are homozygous negative plants.

Example 6: GUS tissue staining method for analyzing expression condition of Ptps31 candidate fragment and GUS gene of corresponding deletion fragment

Carrying out brown planthopper inoculation experimental detection on DX2181-Ptps31 positive single-copy homozygous family plants, taking leaf sheath tissues for GUS histochemical staining after the brown planthopper eats for 6 hours, taking ungrooved rice as a control, and simulating physical damage caused by the brown planthopper by mechanical damage. The leaf sheaths were cut to 0.5-lcm length, immersed in about 400. mu.1 GUS stain, reacted overnight at 37 ℃ and then decolorized with 75% alcohol. The staining solution formulation was according to the method reported by Jefferson (Jefferson et al, 1987). As shown in the results of FIG. 5 and FIG. 6, DX2181-Ptps31 showed significant increase in GUS gene expression level and deepening of GUS staining only after the brown planthopper took food, and the GUS gene expression levels of mechanically damaged and uneaten plants were not significantly changed and the color was not deepened after GUS staining. This result confirmed that Ptps31 is a promoter for feeding-induced expression of Nilaparvata lugens.

The expression of GUS gene driven by the Ptps31 series deletion fragment was analyzed in the same manner (see FIG. 7). The results show that DX2181-P-2060, DX2181-P-1828, DX2181-P-1265, DX2181-P-941, DX2181-P-782, DX2181-P-645 and DX2181-P-482 have the function of inducing expression by food intake of Nilaparvata lugens, and meanwhile, after the DX2181-P-218 is truncated, no matter whether the Nilaparvata lugens eat or not, the function of activating expression is existed any more, so that the core element which is induced by food intake of Nilaparvata lugens is contained in the segment from-482 to-218.

Example 7: detection of GUS enzyme activity induced by feeding of brown planthopper on Ptps31 promoter

The full-length promoter single-copy homozygous family plant is used for carrying out the test detection of inoculation with the brown planthopper, leaf sheath tissues of the fed plant and the non-fed plant (control) of the brown planthopper are taken, the total protein of the leaf sheath tissues is extracted, and the GUS enzyme activity of the leaf sheath tissues is measured (see figure 6). Specific methods reference is made to the method reported by Bradford in 1976 (Bradford MM. Arapid and reactive method for the standardization of microorganisms of protein designing the principal of protein-dye binding. 1976, 72: 248-54). The results show that the Ptps31 transformed plants have higher expression activity after being fed by brown planthopper than the unphaged plants.

The invention obtains the nilaparvata lugens feeding inducible promoter Ptps31, and provides high-efficiency nilaparvata lugens feeding inducible promoter resources for genetic engineering and molecular breeding.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> brown planthopper feeding induction type promoter and application thereof

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2346

<212> DNA

<213> Oryza sativa

<400> 1

gagattaggg gtatctgtac atttttcttt ttgttattag aaggtctaaa atagttaatt 60

ttataataac aaatatcata gagactaaca cataaataga taggggctga aacacaaaat 120

atatttagca gtggtatcca ttgtagacat cgtggttttt attggcctta tcctatgtga 180

cagcctgagg ccacaggtgc ttatgatctc cattgtacat gcccttatat agcatcgtag 240

ggcacatgct acatgtgact accaacatat aaattgcatc agctaggtga ggtgggacat 300

aatccaagcc acacgttgct tctctagctc ttgcagtgtg agtgtcttgg cccacttgag 360

ccttacatat gggacctttt ctcttaaatt cgatgcaatt ttttagaaac aaatgacagt 420

atagagtgac acaactacta cttaaaaaaa aatcgacttc aaacttaata ttcatttgaa 480

aaaaaggata tgataatttt aggtgtgaat ataataccgc taccattcat acgcttgatt 540

tgccttttta aaacatgata aaaaaatcga atgtataaga cgagtttaga cttgagattt 600

tgcagagtgc aatatatgtt tgttacatga atatatgctg tcaatttttt gagatatttt 660

ttatgactgt ttggatagtg tttgaacaaa cgagtggaga tccgctagag agattaaaag 720

agttccatta cattctcata tttgtgtcaa gctggcattt caaagtccat ttatgcacac 780

taaaagaatg tggctatgct ccatgcatgc atcggccatg ctatattaat gttaattaat 840

gctatatatg cccgagtgtg accgatgatg caagctgaac cagtgatcaa tagctggcca 900

tatttgaatg ttttctggga gaatagtata cacgtaccaa tcatcaatca atctcatggt 960

atgtttgtcc ttgtgactgt gagctactac tacatgtttc acgtacgtga gaattttccc 1020

ttgtaattac ttatgtattt gaagaagaaa taaaaagaaa ataagggaca gcctatttat 1080

tagttaggac actggtatca aatcaatcag cagaaattaa aaacaagacc acttgaatta 1140

atggaatcaa tcgtacgtgg aaggggtacg ttgtacactg tatacacatg gcccctccta 1200

ccaaccgatc gagacatacc ttgtttatcg tgagtatata tgtttattca actaataaac 1260

gatacatttt ttaaatacgt acttttcttt ataaaaattg tcttaaaaga tcaaataatt 1320

tttttttagt ttttcatact taatacaaaa ctaattttgt gctaatgact catcttgttt 1380

cagttgtcgc cgaaaagcta agctaaagaa gcagtttcat actaagccag acttggttct 1440

tatttgataa aagagcaatg gtacttctca aggaaattca tacttctaga tatttttttt 1500

ttaaaaaaag aaacccctcc tactttcagt atttgcctat agaataatta aacacataca 1560

tgaatcatat ttagtgcggt ggtggagtcg tggtcttatg agcgcatgac ttcatctatc 1620

atatttaact cttggtttct gtagttacca catgtaaatg tatgctttta ataaaatgtt 1680

ggttagctag gtaacggtag tctaatagat taagaacctg tttagatggg attaaaactt 1740

ttaaatccct atcacatcgg atgtttggac actaattata aatattaaac atagactatt 1800

aataaaaccc atctataatc ttggactact tcgcgagaca aatctattga gcctaattaa 1860

tccatgatta gcctatgtga tgctacagta aacattctct aattatggat taattaggct 1920

taaaaaattt gttttgcaaa ttagctttca tctatataat tagttttgta agtagtctat 1980

atttaatatt ctaaattagt gtctaaatat agagactaaa gttaagtccc tggatccaaa 2040

ttaacaccac ctaactgttt gctaccatct ctcgagcttg tttaaggggt gtgtactcgt 2100

aggtatctgc ttgagtcatg acatatgtgt gtatgtatct ctaagcagtc agggaaaaaa 2160

aatacacatg tggatcacgc aagcatgagt acatcattct gacttggcaa catgaaatca 2220

tgctgatgct tgctcagcta gcctgcctgt gcaactgtct ataaatacca tgcgagatgc 2280

agcaaatagt agacactcac cagatagttg cagaacaata aaattaggtt ggcaacaatt 2340

aatagg 2346

<210> 2

<211> 2060

<212> DNA

<213> Oryza sativa

<400> 2

gtgaggtggg acataatcca agccacacgt tgcttctcta gctcttgcag tgtgagtgtc 60

ttggcccact tgagccttac atatgggacc ttttctctta aattcgatgc aattttttag 120

aaacaaatga cagtatagag tgacacaact actacttaaa aaaaaatcga cttcaaactt 180

aatattcatt tgaaaaaaag gatatgataa ttttaggtgt gaatataata ccgctaccat 240

tcatacgctt gatttgcctt tttaaaacat gataaaaaaa tcgaatgtat aagacgagtt 300

tagacttgag attttgcaga gtgcaatata tgtttgttac atgaatatat gctgtcaatt 360

ttttgagata ttttttatga ctgtttggat agtgtttgaa caaacgagtg gagatccgct 420

agagagatta aaagagttcc attacattct catatttgtg tcaagctggc atttcaaagt 480

ccatttatgc acactaaaag aatgtggcta tgctccatgc atgcatcggc catgctatat 540

taatgttaat taatgctata tatgcccgag tgtgaccgat gatgcaagct gaaccagtga 600

tcaatagctg gccatatttg aatgttttct gggagaatag tatacacgta ccaatcatca 660

atcaatctca tggtatgttt gtccttgtga ctgtgagcta ctactacatg tttcacgtac 720

gtgagaattt tcccttgtaa ttacttatgt atttgaagaa gaaataaaaa gaaaataagg 780

gacagcctat ttattagtta ggacactggt atcaaatcaa tcagcagaaa ttaaaaacaa 840

gaccacttga attaatggaa tcaatcgtac gtggaagggg tacgttgtac actgtataca 900

catggcccct cctaccaacc gatcgagaca taccttgttt atcgtgagta tatatgttta 960

ttcaactaat aaacgataca ttttttaaat acgtactttt ctttataaaa attgtcttaa 1020

aagatcaaat aatttttttt tagtttttca tacttaatac aaaactaatt ttgtgctaat 1080

gactcatctt gtttcagttg tcgccgaaaa gctaagctaa agaagcagtt tcatactaag 1140

ccagacttgg ttcttatttg ataaaagagc aatggtactt ctcaaggaaa ttcatacttc 1200

tagatatttt ttttttaaaa aaagaaaccc ctcctacttt cagtatttgc ctatagaata 1260

attaaacaca tacatgaatc atatttagtg cggtggtgga gtcgtggtct tatgagcgca 1320

tgacttcatc tatcatattt aactcttggt ttctgtagtt accacatgta aatgtatgct 1380

tttaataaaa tgttggttag ctaggtaacg gtagtctaat agattaagaa cctgtttaga 1440

tgggattaaa acttttaaat ccctatcaca tcggatgttt ggacactaat tataaatatt 1500

aaacatagac tattaataaa acccatctat aatcttggac tacttcgcga gacaaatcta 1560

ttgagcctaa ttaatccatg attagcctat gtgatgctac agtaaacatt ctctaattat 1620

ggattaatta ggcttaaaaa atttgttttg caaattagct ttcatctata taattagttt 1680

tgtaagtagt ctatatttaa tattctaaat tagtgtctaa atatagagac taaagttaag 1740

tccctggatc caaattaaca ccacctaact gtttgctacc atctctcgag cttgtttaag 1800

gggtgtgtac tcgtaggtat ctgcttgagt catgacatat gtgtgtatgt atctctaagc 1860

agtcagggaa aaaaaataca catgtggatc acgcaagcat gagtacatca ttctgacttg 1920

gcaacatgaa atcatgctga tgcttgctca gctagcctgc ctgtgcaact gtctataaat 1980

accatgcgag atgcagcaaa tagtagacac tcaccagata gttgcagaac aataaaatta 2040

ggttggcaac aattaatagg 2060

<210> 3

<211> 1828

<212> DNA

<213> Oryza sativa

<400> 3

gctaccattc atacgcttga tttgcctttt taaaacatga taaaaaaatc gaatgtataa 60

gacgagttta gacttgagat tttgcagagt gcaatatatg tttgttacat gaatatatgc 120

tgtcaatttt ttgagatatt ttttatgact gtttggatag tgtttgaaca aacgagtgga 180

gatccgctag agagattaaa agagttccat tacattctca tatttgtgtc aagctggcat 240

ttcaaagtcc atttatgcac actaaaagaa tgtggctatg ctccatgcat gcatcggcca 300

tgctatatta atgttaatta atgctatata tgcccgagtg tgaccgatga tgcaagctga 360

accagtgatc aatagctggc catatttgaa tgttttctgg gagaatagta tacacgtacc 420

aatcatcaat caatctcatg gtatgtttgt ccttgtgact gtgagctact actacatgtt 480

tcacgtacgt gagaattttc ccttgtaatt acttatgtat ttgaagaaga aataaaaaga 540

aaataaggga cagcctattt attagttagg acactggtat caaatcaatc agcagaaatt 600

aaaaacaaga ccacttgaat taatggaatc aatcgtacgt ggaaggggta cgttgtacac 660

tgtatacaca tggcccctcc taccaaccga tcgagacata ccttgtttat cgtgagtata 720

tatgtttatt caactaataa acgatacatt ttttaaatac gtacttttct ttataaaaat 780

tgtcttaaaa gatcaaataa ttttttttta gtttttcata cttaatacaa aactaatttt 840

gtgctaatga ctcatcttgt ttcagttgtc gccgaaaagc taagctaaag aagcagtttc 900

atactaagcc agacttggtt cttatttgat aaaagagcaa tggtacttct caaggaaatt 960

catacttcta gatatttttt ttttaaaaaa agaaacccct cctactttca gtatttgcct 1020

atagaataat taaacacata catgaatcat atttagtgcg gtggtggagt cgtggtctta 1080

tgagcgcatg acttcatcta tcatatttaa ctcttggttt ctgtagttac cacatgtaaa 1140

tgtatgcttt taataaaatg ttggttagct aggtaacggt agtctaatag attaagaacc 1200

tgtttagatg ggattaaaac ttttaaatcc ctatcacatc ggatgtttgg acactaatta 1260

taaatattaa acatagacta ttaataaaac ccatctataa tcttggacta cttcgcgaga 1320

caaatctatt gagcctaatt aatccatgat tagcctatgt gatgctacag taaacattct 1380

ctaattatgg attaattagg cttaaaaaat ttgttttgca aattagcttt catctatata 1440

attagttttg taagtagtct atatttaata ttctaaatta gtgtctaaat atagagacta 1500

aagttaagtc cctggatcca aattaacacc acctaactgt ttgctaccat ctctcgagct 1560

tgtttaaggg gtgtgtactc gtaggtatct gcttgagtca tgacatatgt gtgtatgtat 1620

ctctaagcag tcagggaaaa aaaatacaca tgtggatcac gcaagcatga gtacatcatt 1680

ctgacttggc aacatgaaat catgctgatg cttgctcagc tagcctgcct gtgcaactgt 1740

ctataaatac catgcgagat gcagcaaata gtagacactc accagatagt tgcagaacaa 1800

taaaattagg ttggcaacaa ttaatagg 1828

<210> 4

<211> 1265

<212> DNA

<213> Oryza sativa

<400> 4

agttaggaca ctggtatcaa atcaatcagc agaaattaaa aacaagacca cttgaattaa 60

tggaatcaat cgtacgtgga aggggtacgt tgtacactgt atacacatgg cccctcctac 120

caaccgatcg agacatacct tgtttatcgt gagtatatat gtttattcaa ctaataaacg 180

atacattttt taaatacgta cttttcttta taaaaattgt cttaaaagat caaataattt 240

ttttttagtt tttcatactt aatacaaaac taattttgtg ctaatgactc atcttgtttc 300

agttgtcgcc gaaaagctaa gctaaagaag cagtttcata ctaagccaga cttggttctt 360

atttgataaa agagcaatgg tacttctcaa ggaaattcat acttctagat attttttttt 420

taaaaaaaga aacccctcct actttcagta tttgcctata gaataattaa acacatacat 480

gaatcatatt tagtgcggtg gtggagtcgt ggtcttatga gcgcatgact tcatctatca 540

tatttaactc ttggtttctg tagttaccac atgtaaatgt atgcttttaa taaaatgttg 600

gttagctagg taacggtagt ctaatagatt aagaacctgt ttagatggga ttaaaacttt 660

taaatcccta tcacatcgga tgtttggaca ctaattataa atattaaaca tagactatta 720

ataaaaccca tctataatct tggactactt cgcgagacaa atctattgag cctaattaat 780

ccatgattag cctatgtgat gctacagtaa acattctcta attatggatt aattaggctt 840

aaaaaatttg ttttgcaaat tagctttcat ctatataatt agttttgtaa gtagtctata 900

tttaatattc taaattagtg tctaaatata gagactaaag ttaagtccct ggatccaaat 960

taacaccacc taactgtttg ctaccatctc tcgagcttgt ttaaggggtg tgtactcgta 1020

ggtatctgct tgagtcatga catatgtgtg tatgtatctc taagcagtca gggaaaaaaa 1080

atacacatgt ggatcacgca agcatgagta catcattctg acttggcaac atgaaatcat 1140

gctgatgctt gctcagctag cctgcctgtg caactgtcta taaataccat gcgagatgca 1200

gcaaatagta gacactcacc agatagttgc agaacaataa aattaggttg gcaacaatta 1260

atagg 1265

<210> 5

<211> 941

<212> DNA

<213> Oryza sativa

<400> 5

aagaagcagt ttcatactaa gccagacttg gttcttattt gataaaagag caatggtact 60

tctcaaggaa attcatactt ctagatattt tttttttaaa aaaagaaacc cctcctactt 120

tcagtatttg cctatagaat aattaaacac atacatgaat catatttagt gcggtggtgg 180

agtcgtggtc ttatgagcgc atgacttcat ctatcatatt taactcttgg tttctgtagt 240

taccacatgt aaatgtatgc ttttaataaa atgttggtta gctaggtaac ggtagtctaa 300

tagattaaga acctgtttag atgggattaa aacttttaaa tccctatcac atcggatgtt 360

tggacactaa ttataaatat taaacataga ctattaataa aacccatcta taatcttgga 420

ctacttcgcg agacaaatct attgagccta attaatccat gattagccta tgtgatgcta 480

cagtaaacat tctctaatta tggattaatt aggcttaaaa aatttgtttt gcaaattagc 540

tttcatctat ataattagtt ttgtaagtag tctatattta atattctaaa ttagtgtcta 600

aatatagaga ctaaagttaa gtccctggat ccaaattaac accacctaac tgtttgctac 660

catctctcga gcttgtttaa ggggtgtgta ctcgtaggta tctgcttgag tcatgacata 720

tgtgtgtatg tatctctaag cagtcaggga aaaaaaatac acatgtggat cacgcaagca 780

tgagtacatc attctgactt ggcaacatga aatcatgctg atgcttgctc agctagcctg 840

cctgtgcaac tgtctataaa taccatgcga gatgcagcaa atagtagaca ctcaccagat 900

agttgcagaa caataaaatt aggttggcaa caattaatag g 941

<210> 6

<211> 782

<212> DNA

<213> Oryza sativa

<400> 6

tcatatttag tgcggtggtg gagtcgtggt cttatgagcg catgacttca tctatcatat 60

ttaactcttg gtttctgtag ttaccacatg taaatgtatg cttttaataa aatgttggtt 120

agctaggtaa cggtagtcta atagattaag aacctgttta gatgggatta aaacttttaa 180

atccctatca catcggatgt ttggacacta attataaata ttaaacatag actattaata 240

aaacccatct ataatcttgg actacttcgc gagacaaatc tattgagcct aattaatcca 300

tgattagcct atgtgatgct acagtaaaca ttctctaatt atggattaat taggcttaaa 360

aaatttgttt tgcaaattag ctttcatcta tataattagt tttgtaagta gtctatattt 420

aatattctaa attagtgtct aaatatagag actaaagtta agtccctgga tccaaattaa 480

caccacctaa ctgtttgcta ccatctctcg agcttgttta aggggtgtgt actcgtaggt 540

atctgcttga gtcatgacat atgtgtgtat gtatctctaa gcagtcaggg aaaaaaaata 600

cacatgtgga tcacgcaagc atgagtacat cattctgact tggcaacatg aaatcatgct 660

gatgcttgct cagctagcct gcctgtgcaa ctgtctataa ataccatgcg agatgcagca 720

aatagtagac actcaccaga tagttgcaga acaataaaat taggttggca acaattaata 780

gg 782

<210> 7

<211> 645

<212> DNA

<213> Oryza sativa

<400> 7

ctaatagatt aagaacctgt ttagatggga ttaaaacttt taaatcccta tcacatcgga 60

tgtttggaca ctaattataa atattaaaca tagactatta ataaaaccca tctataatct 120

tggactactt cgcgagacaa atctattgag cctaattaat ccatgattag cctatgtgat 180

gctacagtaa acattctcta attatggatt aattaggctt aaaaaatttg ttttgcaaat 240

tagctttcat ctatataatt agttttgtaa gtagtctata tttaatattc taaattagtg 300

tctaaatata gagactaaag ttaagtccct ggatccaaat taacaccacc taactgtttg 360

ctaccatctc tcgagcttgt ttaaggggtg tgtactcgta ggtatctgct tgagtcatga 420

catatgtgtg tatgtatctc taagcagtca gggaaaaaaa atacacatgt ggatcacgca 480

agcatgagta catcattctg acttggcaac atgaaatcat gctgatgctt gctcagctag 540

cctgcctgtg caactgtcta taaataccat gcgagatgca gcaaatagta gacactcacc 600

agatagttgc agaacaataa aattaggttg gcaacaatta atagg 645

<210> 8

<211> 482

<212> DNA

<213> Oryza sativa

<400> 8

tgattagcct atgtgatgct acagtaaaca ttctctaatt atggattaat taggcttaaa 60

aaatttgttt tgcaaattag ctttcatcta tataattagt tttgtaagta gtctatattt 120

aatattctaa attagtgtct aaatatagag actaaagtta agtccctgga tccaaattaa 180

caccacctaa ctgtttgcta ccatctctcg agcttgttta aggggtgtgt actcgtaggt 240

atctgcttga gtcatgacat atgtgtgtat gtatctctaa gcagtcaggg aaaaaaaata 300

cacatgtgga tcacgcaagc atgagtacat cattctgact tggcaacatg aaatcatgct 360

gatgcttgct cagctagcct gcctgtgcaa ctgtctataa ataccatgcg agatgcagca 420

aatagtagac actcaccaga tagttgcaga acaataaaat taggttggca acaattaata 480

gg 482

<210> 9

<211> 218

<212> DNA

<213> Oryza sativa

<400> 9

gtgtatgtat ctctaagcag tcagggaaaa aaaatacaca tgtggatcac gcaagcatga 60

gtacatcatt ctgacttggc aacatgaaat catgctgatg cttgctcagc tagcctgcct 120

gtgcaactgt ctataaatac catgcgagat gcagcaaata gtagacactc accagatagt 180

tgcagaacaa taaaattagg ttggcaacaa ttaatagg 218

<210> 10

<211> 5119

<212> DNA

<213> Oryza sativa

<400> 10

agacactcac cagatagttg cagaacaata ataaaattag gttggcaaca attaatagga 60

aagagctttt tgttaagaga tcagaagatg tcatcgacac ctgcagctaa tttctccaat 120

gaagacgatg agcgaaaggc tcctaccggc ttccacccca gcctctgggg cgatttcttc 180

atcagttacc agccacctac tgcacctaag gtaattatac ttgtttaatt atatatattc 240

tctggctctg tgtagatagg aaattaataa gtgagacatt ttacactatg tgatagctga 300

acgttataaa ctctaataat aaactaattt ctccagtgtt catggatatt tttatattgg 360

gcataagaaa taagatagaa taatattttg aaacacttca gcattagtat tacatttaca 420

ctgcgttttt actaattata ttaccatagt aaattattag cggatgagtg tatatattgg 480

agattaattg tgtatctgtg ccatctgtcg gtaacattac tgatatttat atttatacac 540

ggagaattct ctgttgcatc gttgacagac gtgtattcct taatttgcag catgcttaca 600

tgaaagaaag ggctgaagtg ctaaaagaag aagttagaaa ggtagtaaag ggctcaaatg 660

aagtaccaga gatattggat cttgtgatca cgctgcaacg acttggattg gatagttact 720

acaaggccga gatagatgag cttctctgca ctgtttacaa caccgactac aacgataaag 780

atttacacct agtttctctt cgattttacc ttctacggaa gaacggctat gatgtgtcat 840

ctggtaattt taaggcctta ttgatgataa gaattaatta ggattttcaa ataaacaaac 900

caataatttt gcagatagat gcaaggacat gcattttcta ctggcctata attaaaccct 960

tagcacatag gaacattcct ttttttttta ctttccctgt tccaaaacca caagaaggat 1020

ttgataccct attagttttt ttaaaaaata tatagtttgc atctatgaac tgaatatatt 1080

atatactaat aacatccctg gcaactggta actgaaatat tttaaacaag ctagctatat 1140

agattagatt ggagaaattt aaatgaagta tatttcagta taatgtattt catgtatact 1200

catgcatgca gcctaataac tatattgtgt tgcatattct cctatacata tatagctggg 1260

gacatgcaat taatgttcgt atttttaagt taacatgatc aacctttgca ttgcagacat 1320

atttcaacat tttaaagaca aagaggggag ttttgttgct gatgacacaa gaagtctttt 1380

aagcttatat aatgcggcat atatgaggac tcatggtgaa aaagtacttg atgaagcagt 1440

tgttttcact actaaccgcc taagatcaga attgaaacat ttgaaatctc cggtagccga 1500

tgaagtgtct cttgctcttg atacaccact attccggagg gttagaataa tagaaacaca 1560

aaactatatt cctatttatg aaagcgcgac tacacgaaat gaagccatat tagaatttgc 1620

aaagttgaat gtcaatctcc ttcaacttat ttattgtgag gagttaaaaa ctatcacacg 1680

gtaagttaat tactttaaag tgcataatga ttctacaatt tcgtgaaatt atgataaata 1740

agttagtact tacatttatg tacaatacag atggtggaaa gagcttaacg ttgaatccaa 1800

cttaagcttc attcgggata gaatagtgga aatgcatttt tggatgacag gagcatgctc 1860

ggagccccat tattctcttt tacgaattat acttacaaag atgacagcat ttatcaccat 1920

tctagatgat atatttgata catatgctac aaccgaggag agcatgatgc ttgccaaagc 1980

gatatatatg taagccttca ttataatatg tggtaatatt aattgcatct ttattttgta 2040

gtagctagtt tatactaagt gtgaaatttc tagttgtatg tggaatcaat ttcacaatag 2100

actaaacaca taaaaagtaa attataacaa aatcatagta taaaggagcc aaataactct 2160

atgaaattat atatatgcaa tgcacatgta tatccgtaca tgttctgata cttgtaatct 2220

attcaccatg ttgtattaat atattaatcc catgtatgcc tcattaattg agaaaaagag 2280

taagcatatt aaattttctc ctatatataa ttaccaaaga tcaaggaaaa caattttctc 2340

ttagaaaaag aaatgcaaac atttaaccta tctgggcatt aattgtaacg gttacttaaa 2400

acctcattgt aatattaaca gttggtcatt tgctgccatg catgttttat gcaatatgaa 2460

gttgatacat aagttaaatc ataatattct tcgatacagg caatgatata aaatccacaa 2520

ataccatgct tacatatatt gcaattatca aaattattct gaggttaaat aaaaaaataa 2580

aaacatagat ataaaacatg gcagaattga taataattca ttcatttcat ttaaagtaat 2640

tcatcctaaa aatttaaatc aaagaacaca tactatggac ataaagtagt ggaaagacaa 2700

tgtgaggtca aaaaaaatat aatccagagc aatcatcata atgcaaacat caaaagataa 2760

atttagcatg gattatctag acaaagtaat gatttggcaa tatcctacat gtatgcaaca 2820

acactagctt atatttggga cactgctact gaacacacca tgagtccatg atcatgagta 2880

atactttgaa cctatgtcat gccatacacc aacctttgcc aagaatatat aatgcttcca 2940

ttttatttaa ccttaggagt ttaggaaggt agaacagaca atcaagctag ccacgtaatt 3000

aatcttatat cttggatata tgatctacca agaaatgaca taagaactgt tatacataaa 3060

aaaatattaa cgccaataaa ataaatgtgt atactagaca aacttgccaa tcttcaacca 3120

tttaatcaaa aatcactata cgctaataaa tatttgcaat ttggctccct acatgattac 3180

acttttggtt gttttttgtg aaaatattaa atgacactag attgtaaaat ataggtgcaa 3240

tgaatctgca acagttctac ttccaaaata catgaaggat ttctacttat attatttaaa 3300

gacatttgat tcatttgaag aggcactagg tccaaacaaa agttatcgag tgctttattt 3360

caaagagctg gtaagtctcc tatctcaaaa caatttgtgg caaaacttat atatatgaca 3420

attaaatatg tagttaccat atccttgtat tagattcgta gtatttggat atgctttcat 3480

ataatgttac tttcatagtt gttgatgata tatcatgaaa taaattaatg gtcaaagtac 3540

aatatttggt gaccatgtaa aactcttagt cgctttatat tttgggaaca aggaggggga 3600

ggggagttgg ggggattatt aaatagactg aaatttaatg atatagttat ttatccttga 3660

ttacaatata acttttgtta caaatcgtat agaaacttca ttgttggtca tatcctacat 3720

ataaatcttg atatgattat atatatgctt aatagaatat atgtatttta gaggagagaa 3780

ctgattattt tatccttagc tagggcatca actatgtata tgacaaaatg atccatatag 3840

atgggacaca tataaatgaa ctttaactat agcaatccca caatatatat agacacaagg 3900

tatcattaga aaaagagaga ggagtagaga tagataatat tatttattcc gccatatggg 3960

taatctattt gcatatgggt accttttgtt attttttcta tacggactag ttgcacaaag 4020

gtaataggtg gctgaatgaa atattataat gcttatggac tacttttgca ccacattgtg 4080

gatgccctta gagggaacta tggtaaccac tttattttac gatcttctaa tgacttaatc 4140

atcttttttt tgggtaaaaa gatatttctt caaaattatg ccaatataca gactgaattc 4200

acacttttac atctttaatg tagttcaaga tattaattaa aggatactct gaagagataa 4260

aatggcgtga tgatcattac attccaaaaa caatagagga acacctggaa ctttccagaa 4320

tgactgttgg tgcctttcaa ctagcatgtg cttctttagt tgggatgggt gattttataa 4380

cagaggatac tctcgattat cttttgactt atccaaaact tattaagtct tacacaacat 4440

gtgtacggct ctcaaatgat attgcttcaa caaaggtaat ttaatatctc tctatcttta 4500

cacctatata ttcatttatg ttttataaat attaatcttc aacttcaatt ataaataact 4560

aaaacatgat gctatggaat gtttcagcgt gaacaagcag gggaccacta tgcttccaca 4620

attcagtgtt acatgctgca gcatggtaca acaatacatg aagcatgcat tgggataaag 4680

gagttgatag aagattcgtg gaaggatatg atgaaagaat accttgcacc aacaaacctt 4740

cagccaaaaa tcgtggcaag aacagttatt gattttgcac gaactgggga ttatatatac 4800

aagcaagcag attcattcac cttttcacat acaatcaagg atatgatagc atcactttac 4860

gttgagccat atagcattta aatcaccaca cgcatttaca ttataaatat tatattatca 4920

agtaaggagt ttcacaattg taacaaatat taattagttt tcaataatgt gatggtggct 4980

gctgatcatg aaaccatcgt tagttaagct tcattagaaa gtttccatgg ttaaagaatt 5040

gtttttcctt atcttgttgt cacaatatta tgtgcaatgt tctcccctcc agtaataaga 5100

tatatactaa ttgctcata 5119

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 11

cccaagcttg agattagggg tatctgtac 29

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 12

aactgcagcc tattaattgt tgccaacc 28

<210> 13

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 13

cccaagcttt gaggtgggac ataatccaag cc 32

<210> 14

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 14

cccaagcttt accattcata cgcttgattt gc 32

<210> 15

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 15

cccaagcttt taggacactg gtatcaaatc aatc 34

<210> 16

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 16

cccaagcttg aagcagtttc atactaagcc ag 32

<210> 17

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 17

cccaagctta tttagtgcgg tggtggagtc g 31

<210> 18

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 18

cccaagcttt agattaagac cctgtttaga tgg 33

<210> 19

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 19

cccaagctta tgattagcct atgtgatgc 29

<210> 20

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 20

cccaagcttt gtgtatgtat ctctaagcag tc 32

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 21

gggcgaacag ttcctgatta 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 22

aacgtatcca cgccgtattc 20

<210> 23

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 23

agaatctcgt gctttcagct tcga 24

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 24

tcaagaccaa tgcggagcat atac 24

Claims (8)

1. A nilaparvata lugens feeding inducible promoter is characterized in that: the nilaparvata lugens feeding inducible promoter is named Ptps31, the length of the promoter is 2346bp, and the nucleic acid sequence of the promoter is shown as SEQ ID NO. 1.

2. A nilaparvata lugens feeding inducible promoter is characterized in that: the rice feeding inducible promoter is a sequence of truncated promoters Ptps31 core regions 2060bp, 1828bp, 1265bp, 941bp, 782bp, 645bp, 482bp and 218bp and is named as P-2060, P-1828, P-1265, P-941, P-782, P-645 and P-482 respectively, and the nucleic acid sequence of the promoter is shown in sequence tables SEQ ID NO. 2-SEQ ID NO. 8.

3. An expression cassette, a recombinant expression vector and a transgenic cell comprising the promoter of any one of claims 1 to 2.

4. The promoter of any one of claims 1-2, the expression cassette of claim 3, the recombinant expression vector and the transgenic cell are applied to cultivation of brown planthopper-resistant transgenic rice.

5. The promoter of any one of claims 1-2, the expression cassette of claim 3, the recombinant expression vector and the transgenic cell are used for improving the expression level of the exogenous gene in transgenic rice under the condition of feeding brown planthopper.

6. The application of claim 5, wherein the promoter sequence of any one of claims 1-2 is fused with an exogenous gene to construct a recombinant expression vector, the recombinant expression vector is introduced into rice by a genetic transformation method, and the expression level of the exogenous gene in transgenic rice is increased under the condition of feeding induction of brown planthopper.

7. The use of any one of claims 5 to 6, wherein the exogenous gene is a reporter gene and/or a rice insect-resistant, disease-resistant, stress-resistant, yield-increasing gene.

8. The use according to any one of claims 5 to 6, wherein the transformation vector of the recombinant expression vector is DX 2181.

Images