CN112794893A

CN112794893A - Construction method and application of Haemonchus contortus Hc-H11-2 recombinant protein

Info

Publication number: CN112794893A
Application number: CN202110130034.2A
Authority: CN
Inventors: 胡敏; 李婷婷; 叶莉莎; 王春群; 张挺; 周彩显; 瓦热斯
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-01-29
Filing date: 2021-01-29
Publication date: 2021-05-14

Abstract

The invention discloses a construction method of Haemonchus contortus Hc-H11-2 recombinant protein, belonging to the technical field of genetic engineering. The invention utilizes the genetic engineering technology to modify the candidate antigen H11-2 gene, and connects the IgK signal peptide which is beneficial to the secretory expression of protein on the basis of removing the transmembrane region; the serum-free suspension CHO cell recombinant expression system is used for the first time to successfully secrete and express Haemonchus contortus Hc-H11-2 antigen protein. In animal immunity experiments, the egg discharging amount and the in-vivo adult load amount of goat feces immunized by the antigen are obviously reduced, and the vaccine can provide more effective immune protection for goat species and has the potential of becoming a genetic engineering vaccine for preventing the haemonchus contortus disease of ruminants.

Description

Construction method and application of Haemonchus contortus Hc-H11-2 recombinant protein

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a construction method of recombinant protein Hc-H11-2 of haemonchus contortus, and a recombinant subunit vaccine of haemonchus contortus.

Background

Haemonchus contortus (Haemonchus contortus) is a blood-sucking parasitic nematode that parasitizes the abomasum of sheep, goats, cattle and other ruminants, and is globally distributed and causes anemia and weight loss, and in severe cases death^[1]. The parasite infects hundreds of millions of livestock worldwide, with annual death and production losses estimated to be $ 33 million^[2]. At present, the prevention and control of haemonchus contortus still takes the prevention and control of medicaments (albendazole, levamisole, ivermectin and the like) as main parts, but a plurality of problems of drug resistance of worms, safety of animal products, residue of environmental medicaments and the like caused by long-term overuse of anthelmintics^[3]In such cases, the development of a highly effective vaccine against Haemonchus contortus becomes crucial^[4]。

In 2014, a vaccine consisting of natural protein for haemonchus contortus

(http:// barbervax. com. au /) is published in Australia, but the vaccine can not be widely popularized and applied because the polypide material for producing the vaccine must depend on parasitic animals, polypides can not realize in-vitro culture, the price is high, the immune program is complex and the like. The focus of current research is still on the development of recombinant subunit vaccines that are important candidate antigens for nematodes.

H11 is a transmembrane glycoprotein complex expressed in the intestinal tract of Haemonchus contortus, is the most effective antigen component of natural vaccine, and is alsoThe recombinant vaccine developed "star" molecules. Although the natural H11 protein can induce high-level immune protection, the recombinant protein expressed in recombinant expression systems of bacteria, yeast, caenorhabditis elegans and the like can not provide effective immune protection, the egg reduction rate is lower than 42 percent, and the insect reduction rate is lower than 20 percent^[5-8]. Scientists have shown that the reason for the failure of recombinant vaccines may be due to the lack of correct native conformation or glycosylation modification of recombinant H11.

CHO cells, i.e., Chinese hamster ovary Cells (CHO), are Chinese hamster ovary fibroblast cell lines. CHO cells have become an important expression or production system for biotechnological drugs. The cell line is used as an important biological tool for genetic engineering and biological pharmacy, and has remarkable advantages in the development of parasite recombinant vaccines: the high glycosylation modification of the glycoprotein enables the glycoprotein with an exogenous complex structure to be correctly folded, assembled and post-translationally modified; and is more similar to parasite natural protein in aspects of molecular structure, physicochemical properties and biological activity function^[9]. The CHO cell line is selected for the first time to complete the preparation of the recombinant subunit vaccine H11-2 of the haemonchus contortus, and the vaccine plays a good role in protecting a host animal goat after immunization.

Reference documents:

[1] prussian qing veterinary parasitics beijing: chinese agriculture university press, 2006.

[2]Evans T,Chapple N.The animal health market[J].Nat Rev Drug Discov.2002,1(12):937-938.

[3]Martin RJ,Wolstenholme AJ,Caffrey CR.Anthelmintics:From discovery to resistance II(San Diego,2016)[J].Int J Parasitol Drugs Drug Resist.2016,6(3):297-298.

[4]Geary TG,Sakanari JA,Caffrey CR.Anthelmintic drug discovery:into the future[J].J Parasitol.2015,101(2):125-133.

[5]Newton SE,Meeusen EN.Progress and new technologies for developing vaccines against gastrointestinal nematode parasites of sheep.Parasite Immunol.2003May；25(5):283-96.

[6] Haemonchus contortus recombinant H11 antigen goat immunoprotection assay [ J ] in Chinese veterinary science, 2007(06) 842-844.

[7] Transgenic study using caenorhabditis elegans to express haemonchus contortus H11 protein [ D ]. university of zhejiang, 2010.

[8]Roberts B,Antonopoulos A,Haslam SM,Dicker AJ,McNeilly TN,Johnston SL,Dell A,Knox DP,Britton C.Novel expression of Haemonchus contortus vaccine candidate aminopeptidase H11 using the free-living nematode Caenorhabditis elegans.Vet Res.2013Dec 1；44(1):111.

[9]Kim JY,Kim YG,Lee GM.CHO cells in biotechnology for production of recombinant proteins:current state and further potential[J].Appl Microbiol Biotechnol.2012,93(3):917-930.

Disclosure of Invention

The invention aims to provide a construction method of recombinant protein Hc-H11-2 of haemonchus contortus, and the invention also aims to provide a recombinant subunit vaccine of haemonchus contortus, which contains recombinant protein Hc-H11-2 of haemonchus contortus constructed according to the method.

A construction method of Haemonchus contortus Hc-H11-2 recombinant protein comprises the following steps:

(1) extracting RNA of haemonchus contortus, and performing reverse transcription to obtain cDNA;

(2) designing primers Hc-H11-2-F and Hc-H11-2-R, and carrying out PCR amplification on Hc-H11-2 genes by taking cDNA as a template;

(3) purifying and recovering a PCR product, connecting and transforming a recovered DNA fragment with a pTOPO-Blunt Simple vector, carrying out amplification culture on positive clones, and recovering plasmids;

(4) designing primers Hc-H11-2-IgK-arm-F and Hc-H11-2-His-arm-R, amplifying a DNA fragment containing an IgK signal peptide and a His label by taking the plasmid in the step (3) as a template, carrying out homologous recombination with a pcDNA3.1(+) vector, and removing endotoxin from a greatly-extracted plasmid after the bacterial liquid is correctly identified by PCR to obtain a pcDNA3.1(+) -Hc-H11-2-IgK plasmid;

(5) transfecting pcDNA3.1(+) -Hc-H11-2-IgK plasmid into CHO cells, collecting cell culture solution, performing His-tag recombinant protein affinity purification, dialyzing and concentrating to obtain the target protein.

Preferably, the primer sequences of Hc-H11-2-F and Hc-H11-2-R are as follows:

Hc-H11-2-F：ATGACGGCGGAGTGGCAGAAG

Hc-H11-2-R：CTATGATCTTGCTCTCTTGAAGAATTCCG。

preferably, the primer sequences of Hc-H11-2-IgK-arm-F and Hc-H11-2-His-arm-R are as follows:

Hc-H11-2-IgK-arm-F：CTAGCGTTTAAACTTAAGCTTATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTACTCGTAAAGCATTCGATACCACAC

Hc-H11-2-His-arm-R：TGCTGGATATCTGCAGAATTCCTAATGATGATGATGATGATGTGATCTTGCTCTCTTGAAGAATTCCG。

preferably, in the transfection described in step (5), the ratio of transfection reagent to plasmid used is 3: 1(μ l: μ g).

A recombinant subunit vaccine of Haemonchus contortus contains Hc-H11-2 recombinant protein of Haemonchus contortus and adjuvant, the Hc-H11-2 recombinant protein of Haemonchus contortus is constructed by the method.

Preferably, the adjuvant is Quil A, and the mass ratio of the recombinant protein to the adjuvant is 1-2: 5.

the technical scheme of the invention comprises the following specific steps:

(1) extracting Haemonchus contortus RNA by adopting a Trizol method, and synthesizing cDNA by using a Thermo reverse transcription kit;

(2) designing primers Hc-H11-2-F and Hc-H11-2-R according to the genomic and transcriptome database of Haemonchus contortus and the gene accession number of Hc-H11-2 being (AJ249942), and carrying out PCR amplification to obtain Hc-H11-2 cDNA;

(3) after identifying the PCR product, purifying and recovering;

(4) connecting and transforming the recovered DNA fragment Hc-H11-2 with a pTOPO-Blunt Simple vector, carrying out amplification culture on positive clones, and recovering plasmids;

(5) designing primers Hc-H11-2-IgK-arm-F and Hc-H11-2-His-arm-R, amplifying Hc-H11-2 products of a homology arm of pcDNA3.1(+) plasmid containing IgK signal peptide and His label by taking recovered plasmid as a template, carrying out linearization and recombination connection on the vector, carrying out PCR (polymerase chain reaction) identification on bacterial liquid, carrying out detection, carrying out mass extraction on the plasmid by using a endotoxin-removing mass-improving particle kit after the detection is correct, and obtaining the pcDNA3.1(+) -Hc-H11-2-IgK plasmid;

(6) transfecting pcDNA3.1(+) -Hc-H11-2-IgK plasmid into a suspension CHO cell, after 4 days of transfection, collecting cell culture solution for His-tag recombinant protein affinity purification, and performing subsequent dialysis and concentration to obtain target protein with high purity and concentration;

(7) mixing a certain amount of recombinant protein with adjuvant for immune injection to goats, and performing animal protection tests;

(8) and detecting the egg reduction rate and the insect reduction rate of the goat.

The invention has the beneficial effects that:

the invention utilizes the genetic engineering technology to modify the candidate antigen H11-2 gene, and connects the IgK signal peptide which is beneficial to the secretory expression of protein on the basis of removing the transmembrane region; the serum-free suspension CHO cell recombinant expression system is used for the first time to successfully secrete and express Haemonchus contortus Hc-H11-2 antigen protein.

The invention provides a recombinant subunit vaccine for preventing sheep haemonchus contortus disease, which can obviously reduce the egg laying amount and adult load of goats infected with haemonchus contortus, the egg reduction rate of the goat is up to 70.7%, the insect reduction rate of the goat is up to 63.5%, and the protection rate of the goat is obviously higher than that of the currently known similar vaccine. Can be used for preventing sheep haemonchus contortus infection and has good application value.

Drawings

FIG. 1: agarose gel electrophoresis detection of the PCR amplified Hc-H11-2 full-length cDNA product.

FIG. 2: the signal peptide of Hc-H11-2 gene was analyzed for its transmembrane region.

FIG. 3PCR identification of the bacterial solution of pcDNA3.1(+) -Hc-H11-2-IgK.

FIG. 4Western blot to detect the expression of Hc-H11-2 gene in suspension CHO cells.

FIG. 5 Collection time of the expression of Hc-H11-2 protein by CHO cells.

FIG. 6 effect of eluting target protein at different concentrations.

FIG. 7SDS-PAGE and Western blot analysis of the dialyzed and concentrated Hc-H11-2 protein for purity and content.

FIG. 8 fecal egg counts were monitored 19 to 33 days after challenge.

FIG. 9 adult load counts were performed 35 days after infestation.

Detailed Description

The technical solution of the present invention is specifically described below with reference to specific examples. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Base material:

(1) experimental animals, cells, insect strains and strains

Healthy goats aged about 3 months were purchased from agricultural academy of sciences, Hubei, Hacon-5 strain of Haemonchus contortus was obtained from the Robin B.Gasser laboratory of the university of Melbourne, Australia, suspension CHO cells were purchased from Purey organism, and eukaryotic expression vector plasmid pcDNA3.1(+) was stored in this laboratory.

(2) Principal materials and reagents

Transfection Reagent Lipofectin 2000Reagent (Invitrogen USA), cell genome extraction kit (Tiangen organism), LB medium, cell culture plate and protein molecular weight standard Marker (Thermo Scientific USA), Phonata enzyme, 2PCR buffer and 10mM dNTPs (Vazyme Nanjing), rTaq enzyme, 2.5mM dNTPs and 10PCR buffer (Takara Japan), T4 DNA ligase (Thermo Scientific USA), pTOPO-Blunt Simple vector (Edley Beijing), bovine serum albumin BSA (MBL Japan), His-tagged monoclonal antibody murine source (Bio-Rad USA), HRP-tagged rabbit anti-mouse IgG secondary antibody (Pekin Bizu March), fetal bovine serum, 0.25% trypsin, Opti-MEM medium (Thermo Scientific USA), suspension transfection Reagent, serum-free suspension cell culture medium and suspension cell supplement medium (Therchang Biochemical assay), other reagents are available in pure grades.

Example 1: preparation of Haemonchus contortus recombinant subunit vaccine CHO-Hc-H11-2

1.1 extraction of Haemonchus contortus RNA and cDNA Synthesis

1.1.1 extracting polypide RNA by a Trizol method, which comprises the following steps:

(1) the collected worm material was washed well with distilled water, transferred to a precooled RNAase-free homogenizer, added with 1ml Trizol reagent, and ground well on ice for 30 min.

(2) Transferring the ground liquid into a 1.5ml centrifuge tube without RNAase, standing at room temperature for 5min, centrifuging at 12000g for 5min, taking the supernatant, and removing proteins and polysaccharides in the sample.

(3) Add 200. mu.l chloroform, cover the tube, shake vigorously for 15s, and centrifuge at 12000g for 15 min.

(4) Adding 500. mu.l of isopropanol into a 1.5ml centrifuge tube without RNAase, transferring the centrifugal supernatant obtained in the previous step into a 1.5ml centrifuge tube filled with isopropanol, uniformly mixing, standing at-20 ℃ for 2h, and centrifuging at 12000g for 15 min.

(5) The supernatant was discarded, 1ml of 75% ethanol was added, the tube was gently inverted 4-6 times, and 7500g was centrifuged for 5 min.

(6) The supernatant was discarded, the residual ethanol was aspirated off with a pipette tip, the white RNA precipitate at the bottom of the tube was retained, and the RNA was dried by leaving the tube open and allowing to stand at room temperature for 5 min.

(7) Adding about 20. mu.l of DEPC-treated water to dissolve the precipitate; the concentration and purity of the RNA were determined using a NanoDrop 2000 molecular Spectrophotometer, and the integrity of the RNA was checked using agarose gel electrophoresis and stored at-80 ℃ until use.

1.1.2 Synthesis of Long-chain cDNA, mainly used as a template for amplifying a target gene, using a Thermo reverse transcription kit, and specifically comprising the following steps:

first, gDNA residues were removed, and the following reagents were added to RNAase-free PCR tubes:

after mixing well, incubate for 30min at 37 ℃.

Mu.l of 50mmol EDTA was added to the PCR tube and incubated at 65 ℃ for 10 min. After the incubation was completed, the following reagents were added to the RNAase-free PCR tube:

after mixing well, incubation was carried out at 65 ℃ for 5min, and immediately transferred to ice and left stand for 5 min.

The following reagents were added to the PCR tube:

mixing, incubating at 50 deg.C for 15min, incubating at 25 deg.C for 10min, and incubating at 85 deg.C for 5min to obtain cDNA, measuring the concentration and purity of cDNA with NanoDrop 2000 molecular spectrophotometer, and storing at-80 deg.C.

1.2 acquisition of Hc-H11-2 cDNA and electrophoretic detection

Primers Hc-H11-2-F and Hc-H11-2-R were designed according to Haemonchus contortus genome and transcriptome database, Hc-H11-2 gene accession number (AJ249942), detailed primer sequences are listed in attached Table 1, and then PCR amplification was performed as follows:

the PCR procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 3min for 30s, 35 cycles; final extension at 72 ℃ for 10 min.

Adding 5 mu l of PCR product into a Loading buffer, carrying out electrophoresis on 1% (W/V) agar gel prepared by 1 XTAE electrophoresis buffer solution, carrying out electrophoresis for about 20-25 min under the condition of 120V, and detecting the molecular weight and specificity of the PCR product in a gel imaging system.

1.3PCR product purification and recovery

When the target band after electrophoresis of the PCR product is single, the PCR product is purified by using a PCR product purification kit, and the steps are as follows:

(1) adding 3 volumes of Buffer PCR-A (if the volume of the Buffer PCR-A is less than 100 mu l, adding the volume of the Buffer PCR-A to 100 mu l) in A PCR or enzyme digestion system reaction solution; after mixing, the mixture was transferred to a preparation tube, the preparation tube was placed in a 2ml centrifuge tube, and then centrifuged at 12000g for 1min, and the filtrate was discarded.

(2) The preparation tube was returned to a 2ml centrifuge tube, 700. mu.l of Buffer W2 was added thereto, 12000g was centrifuged for 1min, and the filtrate was discarded.

(3) The preparation tube was returned to a 2ml centrifuge tube, 400. mu.l of Buffer W2 was added, 12000g was centrifuged for 1min, and the filtrate was discarded.

(4) The prepared tube was placed in a clean 1.5ml, 25. mu.l of Eluent was added to the center of the membrane of the prepared tube, and the tube was allowed to stand at room temperature for 1min, and then centrifuged at 12000g for 1min to elute the DNA.

(5) The eluted DNA was tested for concentration and purity using a NanoDrop 2000 spectrophotometer and stored at-20 ℃ for further use.

When the electrophoresis band of the PCR product is not single, the DNA gel recovery kit is used for cutting and recovering the target fragment, and the steps are as follows:

(1) the fragments of interest were rapidly excised from the agarose gel under an ultraviolet lamp, placed in a clean 1.5ml centrifuge tube and weighed.

(2) Adding three times volume of GSB solution into the centrifuge tube, and turning the centrifuge tube up and down continuously and gently in a water bath at 55 ℃ for 10min to ensure that the gel block is completely melted.

(3) Cooling the melted gel solution to room temperature (the binding capacity of the centrifugal column and DNA is weak at high temperature), adding into the centrifugal column, standing for 3min, centrifuging at 10000g for 1min, and discarding the eluate.

(4) Adding 650. mu.l of WB solution, centrifuging at 10000g for 1min, and discarding the effluent.

(5) Centrifuging at 10000g for 1-2 min, and removing residual WB.

(6) Placing the centrifugal column in a clean centrifuge tube, opening the cover, standing for 5min, suspending 25 μ l deionized water in the center of the centrifugal column after the residual ethanol is completely volatilized, and standing for 5 min.

(7) Centrifuging at 10000g for 1min, eluting DNA, and storing the obtained DNA at-20 deg.C for use.

1.4 ligation and transformation of fragments of interest

The recovered DNA fragment Hc-H11-2 was ligated with pTOPO-Blunt Simple vector by the following procedure:

the operation was carried out at room temperature according to the following system:

after the reagent is added, a pipette is used for gently blowing and beating the tube bottom evenly or flicking, all liquid is collected at the centrifugal tube bottom by low-speed centrifugation, and the liquid is connected for 5min at room temperature.

The steps for ligation conversion were as follows:

(1) DH 5. alpha. competent cells were thawed on ice from a-80 ℃ freezer; and adding 5-10 mul of the connecting product into 50 mul of the competent cells, and flicking the tube wall to uniformly mix so as to avoid generating bubbles.

(2) The tube was placed on ice for 30min, hot-shocked in a 42 ℃ water bath for 90s followed by ice-bath for 2 min.

(3) Adding 400 mul of non-resistant LB liquid culture medium into the centrifuge tube, shaking the centrifuge tube for 45min at 37 ℃ by a shaking table at 180r/min, and simultaneously placing the LB solid culture medium plate containing the corresponding antibiotic required in the step (4) into an incubator at 37 ℃ for drying and preheating.

(4) The thalli is collected by centrifugation at 8000r/min for 3min at room temperature, most of supernatant is discarded, 100 mul of liquid is left for resuspension and precipitation, and the precipitate is evenly smeared on a solid culture medium and is cultured in an inverted mode at 37 ℃ overnight.

1.5 PCR identification of bacterial liquid

In order to identify positive clones, a single clone is picked from a plate and transferred into a corresponding resistant LB liquid culture medium, the amplified culture is carried out by oscillating for about 10 hours at 37 ℃ and 180r/min, and then the identification of the positive clones is carried out by taking bacterial liquid as a template, wherein the system is as follows:

the PCR product was subjected to agarose gel electrophoresis detection, and the total length of cDNA of Hc-H11-2 gene was 2919bp bases and 972 amino acids. Agarose gel electrophoresis showed fragment sizes consistent with those expected (FIG. 1). Positive samples were selected for sequencing while 300. mu.l of positive strain was added to 700. mu.l of 50% glycerol and stored at-80 ℃.

1.6 alkaline lysis method for extracting plasmid

Taking 50 mu l of sample bacterial liquid with correct sequencing, transferring the sample bacterial liquid into 5ml of LB liquid culture medium containing corresponding antibiotics, placing the sample bacterial liquid in a shaking table at 37 ℃ for 180r/min oscillation, shaking the bacterial liquid, and extracting plasmids according to the operational guidelines of the AxyPrep plasmid DNA minikit after the bacterial liquid is shaken and mixed, wherein the steps are as follows:

(1) taking 1-4 ml of cultured bacterial liquid, centrifuging at 12000g for 1min, and discarding the supernatant. The bacterial pellet was suspended by adding 250. mu.l Buffer S1 and the suspension was uniform without leaving small clumps.

(2) Adding 250 mu l of Buffer S2, fully turning over for 4-6 times, and uniformly mixing to fully crack the thalli until a clear solution is formed, wherein the step is not more than 5 min. Adding 350 mul of Buffer S3, fully turning over the mixture for 6-8 times, uniformly mixing, and centrifuging for 10min at 12000 g.

(3) And sucking the supernatant after the centrifugation in the previous step, transferring the supernatant into a preparation tube, placing the preparation tube into a 2ml centrifuge tube, centrifuging the solution at 12000g for 1min, and discarding the filtrate. The preparation tube was put back into the centrifuge tube, 500. mu.l of Buffer W1 was added thereto, 12000g was centrifuged for 1min, and the filtrate was discarded.

(4) The prepared tube is put back into a centrifuge tube, 700 mul of Buffer W2 and 12000g are added for centrifugation for 1min, and the filtrate is discarded; the reaction mixture was washed once with 700. mu.l Buffer W2 in the same manner, and the filtrate was discarded. The prepared tube was placed back in a 2ml centrifuge tube and centrifuged at 12000g for 1 min.

(5) Transferring the preparation tube into a new 1.5ml centrifuge tube, adding 50-60 μ l Eluent to the center of the membrane of the preparation tube, standing at room temperature for 1min, and centrifuging at 12000g for 1 min.

(6) The concentration and purity of the plasmid obtained by elution are measured and stored at-20 ℃ for later use.

1.7 construction of pcDNA3.1(+) -Hc-H11-2-IgK plasmid

1.7.1 the N-terminal 1-39 amino acids of the Hc-H11-2 gene are transmembrane regions without signal peptide, the transmembrane regions influence the secretory expression of the recombinant protein, and the addition of strong signal peptide after the transmembrane regions are removed is favorable for the secretory expression (figure 2).

The Ig kappa signal peptide is a common signal peptide for CHO expression, and the amino acid sequence of the IgK signal peptide is METDTLLLWVLLLWVPGSTG according to the literature. Primers Hc-H11-2-IgK-arm-F and Hc-H11-2-His-arm-R were designed, detailed primer sequences are shown in attached Table 1, and a cDNA was used as a template to amplify the Hc-H11-2 product of the homology arm of pcDNA3.1(+) plasmid containing IgK signal peptide and His tag. The system is as follows:

1.7.2 linearization and recombinant ligation of vectors

The PCR procedure was: 3h at 37 ℃; inactivating the enzyme at 85 ℃ for 20min

Preparing a recombination reaction system on ice:

PCR procedure: 30min at 37 ℃; and cooling on ice for 5min, and then transforming into DH5 alpha competent cells.

1.7.3 PCR identification of bacterial liquid

The PCR reaction program is: pre-denaturation at 95 ℃ for 5 min; deformation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; final extension at 72 ℃ for 10 min.

The linearized pcDNA3.1(+) plasmid and the recovered gene fragment are subjected to homologous recombination and connection to obtain a recombinant plasmid, and the gel electrophoresis result of the PCR identification of the bacterial liquid shows that a fragment of about 3000bp is obtained, which is in accordance with the theoretical value and is correctly identified (figure 3).

1.8 endotoxin-removing large quality-improving granule

(1) Selecting a single clone to 5ml of liquid LB culture medium containing corresponding resistance, and carrying out amplification culture at the rotating speed of 2000r/min for 10h at the temperature of 37 ℃;

(2) centrifuging at 8000r/min for 10min at room temperature, and collecting the thallus from the supernatant;

(3) adding 500 mu l of Solution I/RNase A into the thalli, uniformly mixing by vortex or up-down reversal, and then carrying out heavy suspension;

(4) transferring the heavy suspension into a new 2ml microcentrifuge tube, adding 500 mu l of Solution II, slightly inverting the Solution II from top to bottom for several times, and standing for 2-3 min to obtain a clarified lysate;

(5) adding 250 μ l of ice-bath N3 Buffer into the lysate, and slightly turning upside down until white flocculent precipitate appears;

(6) centrifuging at 13000r/min for 10min at room temperature, separating the supernatant from the precipitate, transferring the supernatant into a new 1.5ml centrifuge tube, and measuring the volume;

(7) adding ETR Solution accounting for 0.1 of the total volume content into the liquid with the measured volume, then reversing the Solution from top to bottom for 10 times, completely mixing the Solution, and carrying out ice bath on the Solution for 10 min;

(8) incubating the ice-bath liquid at 42 ℃ for 5min, wherein the eye-observation liquid becomes turbid again;

(9) centrifuging at 12000r/min for 3min at 25 deg.C to obtain ETR Solution forming blue layer at the bottom of the tube;

(10) transferring the upper-layer water phase into a new 1.5ml centrifuge tube, adding 0.5-time volume of normal-temperature absolute ethyl alcohol, slightly reversing the upper-layer water phase for 6-7 times, and standing at room temperature for 1-2 min;

(11) taking the liquid to Hi Bind DNA Mini Column II, centrifuging at 13000r/min for 1min at room temperature, and then discarding the filtrate;

(12) repeating step 11 until the mixture in liquid of step 10 is transferred to a collection tube;

(13) adding 500 μ l HBC Buffer into the collection tube, centrifuging at 13000r/min for 1min at room temperature, and then discarding the filtrate;

(14) adding 700 mu l of DNA Wash Buffer into a collection pipe, centrifuging for 1min at 13000r/min at room temperature, and then discarding the filtrate;

(15) repeating step 14;

(16) centrifuging the Hi Bind DNA Mini Column II for 2min by an empty tube at 13000r/min, and transferring the Hi Bind DNA Mini Column II into a new 1.5ml centrifuge tube;

(17) to the above tube, 80. mu.l to 100. mu.l of Elution Buffer or deionized water (ddH) was added₂O) to a Hi Bind DNA Mini Column middle membrane, and standing for 1min at room temperature;

(18) the DNA was centrifuged at 13000r/min for 1min at 4 ℃ and the eluted DNA was stored at-20 ℃.

1.9 suspension CHO cell transfection

Transfection was performed according to the 20ml transfection system as follows:

(1) preparing materials: expi CHO basal medium, objective plasmid, NanoTransCHO transfection reagent, sterile 1.5ml EP tube, pipettor, gun head, etc.

(2) One day before transfection, cells in logarithmic growth phase were taken at 0.8X 10⁶cells/ml density were passaged.

(3) 2 sterile EP tubes were prepared and 200. mu.l of Expi CHO basal medium was added to each tube, 20. mu.g of DNA and 60. mu.l of Nano Trans CHO transfection reagent were added to each tube, mixed and incubated at room temperature for 5 min.

(4) And (3) quickly adding the Nano Trans CHO transfection reagent diluent into the DNA diluent, gently mixing the obtained mixture by using a pipette gun, and incubating the obtained mixture for 15-20 min at room temperature.

(5) The DNA and transfection reagent mixture is added rapidly to the cell suspension.

(6) Transfection efficiency was measured after 24h of incubation, and 1ml of Expi CHO feed medium (5% of the initial transfection volume) was added 48h, 96h, 144h after transfection, respectively.

(7) And when the cell survival rate is reduced to about 60%, centrifuging to collect cell supernatant for later use or purification.

The transfection amplification protocol was as follows:

western blot detection of the sample shows that the protein extracted from the culture medium transfected with pcDNA3.1(+) -Hc-H11-2-IgK plasmid can show obvious bands (figure 4) and is consistent with a theoretical value of 110 KDa.

After transfection, cell culture fluid was collected at different times for His-tag recombinant protein affinity purification (fig. 5), the amounts of target protein eluted from imidazole at different concentrations were compared (fig. 6), and finally the target protein with higher purity and concentration was obtained by subsequent dialysis concentration (fig. 7).

1.10 preparation of the vaccine

200. mu.g of recombinant protein CHO-Hc-H11-2 was mixed with 500. mu.g of adjuvant Quil A.

Example 2: immunoprotection assay for Haemonchus contortus vaccine

2.1 Experimental plan

Healthy goats, 8, were randomized into 2 groups of 4 goats each.

Quil A is prepared into the concentration of 0.5mg/ml, and 1ml is injected into each sheep;

number of pests attacked: 5000 larvae of Haemonchus contortus iL3 with good activity;

the immunization mode comprises the following steps: subcutaneous multi-point injection;

three immunizations are carried out in total, the immunization interval is 14 days, and the attack on the same day after the third immunization is carried out.

2.2 fecal egg count

After infection of third stage larvae of Haemonchus contortus, faeces were collected from the goat rectum on days 19, 21, 23, 25, 27, 29, 31, 33 post infection for egg counting.

The egg reduction rate is (average value of control group-average value of experimental group)/average value of control group x 100%

The results are shown in the figure, and the number of worm eggs in the immunized group is significantly reduced compared with that in the adjuvant control group (fig. 8). The calculation results show that: the reduction rate of eggs of the CHO-H11-2 protein immune histones is 70.7%.

2.3 Cochler Elapidae count

On day 35 after infection of third-stage larvae, after euthanasia of the experimental animals according to animal welfare, abomasums were removed and haemonchus contortus was isolated and female and male were counted separately.

The female insect reduction rate is (average value of control group-average value of experimental group)/average value of control group x 100%

The male worm reduction rate is (average value of control group-average value of experimental group)/average value of control group x 100%

Adult reduction rate ═ (control mean-experimental mean)/control mean × 100%

The results are shown in fig. 9, and the number of adults in the immunized group is significantly reduced compared to the adjuvant control group. The calculation results show that: the CHO-H11-2 protein immunity group female insect reduction rate is 60.8%, the male insect reduction rate is 66.3%, and the adult insect reduction rate is 63.5%.

Primer sequences of attached Table 1

Sequence listing

<110> university of agriculture in Huazhong

<120> construction method and application of recombinant protein Hc-H11-2 of haemonchus contortus

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgacggcgg agtggcagaa g 21

<210> 2

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctatgatctt gctctcttga agaattccg 29

<210> 3

<211> 106

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctagcgttta aacttaagct tatggagaca gacacactcc tgctatgggt actgctgctc 60

tgggttccag gttccactgg tactcgtaaa gcattcgata ccacac 106

<210> 4

<211> 68

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgctggatat ctgcagaatt cctaatgatg atgatgatga tgtgatcttg ctctcttgaa 60

gaattccg 68

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctctggctaa ctagagaacc cactg 25

Claims

1. A construction method of Haemonchus contortus Hc-H11-2 recombinant protein is characterized by comprising the following steps:

2. The method of construction of claim 1, wherein: the primer sequences of Hc-H11-2-F and Hc-H11-2-R are as follows:

Hc-H11-2-F：ATGACGGCGGAGTGGCAGAAG

Hc-H11-2-R：CTATGATCTTGCTCTCTTGAAGAATTCCG。

3. the method of construction of claim 1, wherein: the primer sequences of Hc-H11-2-IgK-arm-F and Hc-H11-2-His-arm-R are as follows:

4. the method of construction of claim 1, wherein: in the transfection in step (5), the ratio of the transfection reagent to the plasmid used is 3: 1(μ l: μ g).

5. A recombinant subunit vaccine of Haemonchus contortus, comprising Hc-H11-2 recombinant protein of Haemonchus contortus and adjuvant, characterized in that: the recombinant protein Hc-H11-2 of Haemonchus contortus is constructed according to the method of any one of claims 1-4.

6. The recombinant subunit vaccine of haemonchus contortus of claim 5, wherein: the adjuvant is Quil A, and the mass ratio of the recombinant protein to the adjuvant is 1-2: 5.