CN113528348B - Method for separating Eimeria small gametes and application - Google Patents

Abstract

The invention provides a method for separating Eimeria small gametes and application thereof, and relates to the technical field of coccidium separation and purification. The gene sequence of exogenous fluorescent protein is fused with a specific gene by adopting a genome editing technology for the first time, the fused gene is knocked into the Eimeria genome to be fused and expressed, and then the successful integration is judged according to the light-emitting condition of the fluorescent protein, so that the fluorescent coccidia is obtained. The chicken is then infected with the coccidiosis, the gamete-rich cecum is collected, the mixture is obtained by further digestion, filtration, etc., and then the large and small gametes are separated according to fluorescence. The invention can also apply immunofluorescence technology and modern imaging analysis technology, and observe the behavioral change of the coccidium gamete stage by fluorescence, thereby providing an effective chemical screening model for the treatment of coccidiosis, and laying a foundation for researching and developing medicines aiming at coccidium gametes and vaccines based on gametes.

Description

Method for separating Eimeria small gametes and application

Technical Field

The invention belongs to the technical field of coccidium separation and purification, and particularly relates to a method for separating eimeria small gametes and application thereof.

Background

Chicken coccidiosis is a common disease in broiler breeding and is one of diseases with highest drug cost, coccidiosis treatment drugs are also main reasons for polluting environment and generating drug residues, one chicken is infected with coccidia from birth to slaughter, infection is often epidemic in outbreak, and the coccidiosis treatment drugs are listed as one of five diseases with the most serious harm to poultry by the American Ministry of agriculture, after the chicken coccidiosis occurs, the production performance of the chicken is influenced, feed reward is reduced, the growth of chicks is hindered, a large number of chickens can die seriously, once the chicken explodes, economic loss which cannot be compensated is caused, and therefore, research on the molecular biology, genomics, proteomics and immunology of coccidia is necessary.

The separation and purification of coccidia in each stage is the basis for researching coccidia molecular biology, genomics, proteomics, immunology and vaccine development. Coccidiosis has a complex life history, including three developmental stages, namely schizogenesis, gametophyte reproduction and sporozoite reproduction. The polypide is divided into trophozoite, schizont, merozoite, gametophyte, large gamete, zygote, oocyst and sporozoite, but the research on the separation method of the gamete is blank, and the proteomics of the related development stages and the research and development of the medicine and the vaccine aiming at the gamete respectively cannot be finely analyzed.

Disclosure of Invention

In view of the above, the invention aims to provide a method for separating eimeria gamete and an application thereof, and lays a foundation for research and development of a medicine aiming at the eimeria gamete and a vaccine based on the eimeria gamete.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a method for separating Eimeria small gametes, which comprises the following steps: fusing a gene sequence for coding a fluorescent protein with a specific gene of the Eimeria, knocking the fused protein into a genome of the Eimeria, and screening a target coccidium for expressing the fused gene;

infecting the chicken with the target coccidia, and collecting gamete stage polypide 136h after infection, wherein the individuals with fluorescence are Eimeria microgames;

the specific genes are differentially expressed in the small gamete stage and the large gamete stage.

Preferably, the species of Eimeria include Eimeria tenella, Eimeria necatrix, Eimeria maxima, Eimeria acervulina, and Eimeria mitis, Eimeria brunetti, or Eimeria praecox.

Preferably, the fluorescent protein comprises mCherry or EYFP.

Preferably, the specific gene includes a germ cell specific gene GCS-1.

Preferably, the method of typing comprises gene editing.

Preferably, the screening comprises drug screening, and the drug for drug screening comprises pyrimethamine.

Preferably, after the chickens are infected with the positive polypide obtained after screening for 136h, the caecum mucous membrane tissues of the chickens are taken out, the content is removed, and then the precipitate is digested by hyaluronidase, filtered and centrifuged.

Preferably, the filtering comprises sequentially filtering with a 60-mesh molecular sieve, a 260-mesh molecular sieve and a 17-micron high-temperature-resistant polyester film, and filtering the filtrate with a 5-micron high-temperature-resistant polyester film;

the centrifugation comprises the step of centrifuging residues on the film of the high-temperature resistant polyester film;

the rotation speed of the centrifugation is 3200rpm, and the time is 5 min.

Preferably, the screening for individuals with fluorescence is performed using flow sorting.

The invention also provides application of the eimeria gamete separated by the method in preparation of medicines and/or vaccines related to the eimeria gamete.

Has the advantages that: the invention provides a method for separating Eimeria small gametes, which fuses a gene sequence of exogenous fluorescent protein and a specific gene by adopting a genome editing technology for the first time, knocks the fused gene into Eimeria genome to enable the Eimeria genome to be fused and expressed, and then judges that the integration is successful according to the light emitting condition of the fluorescent protein to obtain the fluorescent coccidia. The chicken is then infected with the coccidiosis, the gamete-rich cecum is collected, the mixture is obtained by further digestion, filtration, etc., and then the large and small gametes are separated according to fluorescence. The invention can also apply immunofluorescence technology and modern imaging analysis technology, and observe the behavioral change of the coccidium gamete stage by fluorescence, thereby providing an effective chemical screening model for the treatment of coccidiosis, and laying a foundation for researching and developing medicines aiming at coccidium gametes and vaccines based on gametes.

Drawings

FIG. 1 is a schematic diagram of the gene of the fusion knock-in Eimeria after inserting the mCherry gene into GCS-1 using CRISPR/Cas9 system;

FIG. 2 is an Eimeria tenella oocyst with a gene sequence of the fluorescent protein of mCherry present after EtGCS-1, observed under a fluorescent microscope with red fluorescence, for positive gene knock-in coccidia observed by a fluorescent microscope;

fig. 3 is a picture of fluorescent gametes obtained by flow sorting, wherein fig. 3a and fig. 3b are fluorescence micrographs under mCherry light and white light, respectively.

Detailed Description

The invention provides a method for separating Eimeria small gametes, which comprises the following steps: fusing a gene sequence for coding a fluorescent protein with a specific gene of the Eimeria, knocking the fused protein into a genome of the Eimeria, and screening a target coccidium for expressing the fused gene;

infecting the chicken with the target coccidia, and collecting gamete stage polypide 136h after infection, wherein the individuals with fluorescence are Eimeria microgames;

the specific genes are differentially expressed in the small gamete stage and the large gamete stage.

The species of Eimeria in the present invention preferably include Eimeria tenella, Eimeria necatrix, Eimeria maxima, Eimeria acervulina, and Eimeria mitis, Eimeria brunetti, or Eimeria praecox. The protocol of the present invention is described in the examples of the present invention with Eimeria tenella as the subject of the study, but it should not be construed as the scope of the present invention.

The invention utilizes the encoding gene of the fluorescent protein to be fused with the specificity gene of the eimeria to form a fusion gene, and the fluorescent protein preferably comprises mCherry or EYFP; and the specific gene preferably includes a germ cell specific gene (genetic specific) GCS-1. The GCS-1 gene is only expressed on the surfaces of male gametophytes and male gametophytes in an Eimeria tenella genome, plays an important role in the fusion of gametophytes, the formation of zygotes and the development process of polypody, and plasmodium with GCS-1 gene deletion shows male sterility, so that fertilization failure is caused; in the Eimeria necatrix genome, GCS-1 gene is expressed in the interior of the microgametes in the microgamete stage, but is not expressed in the macrogamete stage, and stage differential expression exists.

In the embodiment of the invention, the nucleotide sequence of the GCS-1 gene is preferably shown as SEQ ID No.1, and is a complete sequence obtained by splicing E.tenella (E.tenella) gene sequences ETH _00017055 and ETH _ 00017055.

In the present invention, it is preferable to fuse a gene sequence encoding a foreign fluorescent protein to a gene sequence encoding a foreign fluorescent protein by inserting the gene sequence of the foreign fluorescent protein downstream of the GCS-1-encoding gene.

The invention preferably utilizes a gene editing method to knock the fusion gene into the genome of Eimeria, and more preferably comprises utilizing a Cas protein family to carry out the gene editing, wherein the Cas protein family preferably comprises Cas9, Cas12a, Cas13 or Cas 14. The method for editing the gene is not particularly limited, but preferably the mCheerry gene is inserted into GCS-1 by using the CRISPR/Cas9 system and fused and knocked into the genome of Eimeria tenella by using the process shown in FIG. 1. The invention preferably designs gRNA gene editing knock-in vector plasmid based on the encoding gene of GCS-1 protein, constructs a target gene donor vector containing two homologous ARMs, namely 5'-ARM and 3' -ARM, and a sequence segment for encoding exogenous fluorescent protein and DHFR (dihydrofolate reductase) exists between the 5'-ARM and the 3' -ARM to obtain donor vector plasmid containing 5'-ARM, GCS-1, exogenous fluorescent protein, DHFR and 3' -ARM segments; and integrating the donor vector plasmid integrated with the gRNA gene editing knock-in vector plasmid and the 5'-ARM, GCS-1, the exogenous fluorescent protein, the DHFR and the 3' -ARM segments into sporozoites in a sporozoite transfection mode.

The invention screens the target coccidium expressing the fusion gene, the target coccidium is used for infecting chickens, the screening preferably comprises the steps of infecting the chickens by using the sporozoites and adding pyrimethamine into drinking water or feed for drug screening, positive insects screened are used for infecting the chickens after three passages, and the positive expression is as follows: and (6) survival.

After the infection, collecting cecum of a chicken infected with Eimeria oocyst for 136h, taking out cecum mucous membrane tissue, removing contents, digesting the cecum mucous membrane tissue with enzyme of hyaluronic acid, filtering the cecum mucous membrane tissue with a 60-mesh molecular sieve, a 260-mesh molecular sieve and a 17-mu m high-temperature-resistant polyester film, filtering the cecum mucous membrane tissue with a 5-mu m high-temperature-resistant polyester film, and taking the unfiltered part of the cecum mucous membrane tissue; after centrifugation at 3200rpm for 5 minutes, the precipitate was taken and washed 2 times by centrifugation in PBS.

The individuals with fluorescence in the precipitate are Eimeria gametes, the invention preferably utilizes a flow sorting method to screen the individuals with fluorescence, for example, when screening the mCherry as the Eimeria gametes with exogenous fluorescence, 488nm and 561nm wavelength lasers are used for sorting, and the red fluorescence excitation laser can be used for separating the gametes fused with the mChery in GCS-1. The invention further carries out flow sorting on the basis of filter membrane purification to obtain the fluorescent microgametes, thereby separating the macrogametes from the microgametes and obtaining the pure microgametes.

The invention also provides application of the eimeria gamete separated by the method in preparation of medicines and/or vaccines related to the eimeria gamete.

By utilizing the method, the Eimeria small gametes can be well separated and screened, so that a foundation is provided for the research and development of medicines and/or vaccines related to the Eimeria small gametes.

The following examples are provided to illustrate the method and application of the present invention for isolating Eimeria gametes in detail, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of knock-in plasmid pCRISPR EtGCS-1 plasmid and homologous template plasmid pEtGCS-1 for drug screening mChery-DHFR plasmid

Designing gRNA according to an Eimeria tenella (E.tenella) gene sequence (SEQ ID NO.1), constructing a sgRNA vector, and designing a primer which is CRISPR-EtGCS-1-F (SEQ ID NO. 2): GTACAATCTTACTTATGTCAGTTTTAGAGCTAGAAATAGC and CRISPR-R (GOI-gRNA-Rv, SEQ ID No. 3): AACTTGACATCCCCATTTAC are provided.

Construction of pCRISPR EtGCS-1 plasmid: the CRISPR-EtGCS-1-F and CRISPR-R are used as primers, pSAG1: (Cas 9-U6: (sgUPRT plasmid) (purchased from addge company)) is used as a template, a Q5 point mutation kit (purchased from NEB company, # E0552S) is used for carrying out PCR reaction, then the PCR product is subjected to KLD reaction, then the KLD mixture is transformed into stbl3 competent cells, then positive clones are identified, and pCRISPR: (EtGCS-1 plasmid) is obtained, and the plasmid with correct sequencing is pSAG1: Cas9-U6: (sgUPRT:: EtGCS-1 plasmid).

TABLE 1PCR reaction amplification System

Q5hotstarhigh-Fidelity2xMasterMix	12.5μL
		10 mu mol/LCRISPR-EtGCS-1-F primer	1.25μL
10 mu mol/LCRISPR-R primer	1.25μL
		pSAG1: Cas9-U6: sgUPRT plasmid template	1μL
Nuclease-freewater	12.5μL

PCR reaction procedure: 30s at 98 ℃; 35 cycles of 98 ℃ for 10s, 55 ℃ for 30s and 72 ℃ for 2 min; 72 ℃ for 2 min.

TABLE 2KLD Room temperature reaction System

PCR product	1μL
		2 XKLD reaction buffer	5μL
10×KLDenzymeMix	1μL
		Nuclease-freewater	3μL

The KLD enzyme mixture contains a mixture of kinase, ligase, and DpnI enzyme, and contains a buffer in which all enzymes remain active. In this system, efficient phosphorylation, intramolecular ligation/cyclization was performed under room temperature conditions for 5 minutes to effect transformation of competent cells.

Then 5 mu L of KLD mix is taken to be put into a competent cell for transformation, CRISPR-EtGCS-1-F and CRISPR-R are adopted for identification and sequencing, thus obtaining the target sequence of the EtGCS-1 specific gRNA sequence replacing the template plasmid and obtaining the pCRISPR:: EtGCS-1 plasmid.

Example 2

Construction of homologous templates

(1) Amplification of upstream 5'-ARM Gene fragment (EtGCS-1-5' -ARM, SEQ ID NO.6)

Designing a primer EtGCS-1-5' -ARM-F (SEQ ID NO. 4): CCGAAGTAAATACCCCAATATACAAA the flow of the air in the air conditioner,

EtGCS-1-5'-ARM-R(SEQ ID NO.5)：TGTGGTGAGCCAAGGCTTCC。

using an Eimeria tenella genome as a template, and amplifying an upstream sequence of the EtGCS-1 as an upstream homology arm sequence, wherein the amplification program is as follows: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

(2) Construction of fragment carrying EtGCS-1, mCherry and DHFR drug-resistant pyrimethamine genes

Amplification of EtGCS-1:

design primer EtGCS-1-F (SEQ ID NO. 7): ATGCTTCTTCTCCTCCTCATCTTG, respectively;

EtGCS-1-R(SEQ ID NO.8)：GCATTCCTGGCTTCTTTTGGA。

using Eimeria tenella cDNA as a template, amplifying EtGCS-1 to obtain an EtGCS-1 sequence (SEQ ID NO.1), wherein the amplification program is as follows: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

Amplification of the mCherry sequence:

design primer mCherry-F (SEQ ID NO. 9): ATGGTGAGCAAGGGCGAGG, respectively; mCherry-R (SEQ ID NO.10) (TTACTTGTACAGCTCGTCCATGCC).

The pCMV-N-mCherry plasmid is used as a template to amplify the mCherry sequence (SEQ ID NO.11), and the amplification procedure is as follows: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

Amplification of DHFR Gene sequence:

design primer DHFR-F (SEQ ID NO. 12): CGCGTAGTTCCTGTGTGTCATT, respectively;

DHFR-R(SEQ ID NO.13)：GGAATTCCATCCTGCAAGTGC。

the DHFR gene (SEQ ID NO.14) was amplified using pSAG: Cas9-U6-sgUPRT as a template, the procedure for amplification was: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

Designing a homology arm to fuse the gene sequences of EtGCS-1, mCherry and DHFR to obtain a fusion gene fragment

Designing a primer:

EtGCS-1-F1(SEQ ID NO.15)：gctcaccacaATGCTTCTTCTCCTCCTCATCTTG；

EtGCS-1-R1(SEQ ID NO.16)：ttgctcaccatGCATTCCTGGCTTCTTTTGGA；

mCherry-F1(SEQ ID NO.17)：caggaatgcATGGTGAGCAAGGGCGAGG；

mCherry-R1(SEQ ID.NO.18)：ctacgcgTTACTTGTACAGCTCGTCCATGCC；

DHFR-F1(SEQ ID.NO.19)：gctgtacaagtaaCGCGTAGTTCCTGTGTGTCATT；

DHFR-R1(SEQ ID.NO.20)：agtgacGGAATTCCATCCTGCAAGTGC。

amplifying by using the obtained EtGCS-1 product, mCherry product and DHFR gene product as templates to obtain a fusion sequence EtGCS-1-mCherry-DHFR gene sequence, wherein the amplification procedure is as follows: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

(3) The upstream 3'-ARM gene fragment (EtGCS-1-3' -ARM, with BamHI cleavage site, SEQ ID NO.26) was amplified.

Designing a primer:

EtGCS-1-3'-ARM-F(SEQ ID NO.21)：GTCACTTAATCTACTGGAGAGACAATATCTG；

EtGCS-1-3'-ARM-R(SEQ ID NO.22)：ccacactggactagtggatccACTTCCACTGTATTTTCTGGAATTAAAA。

using an Eimeria tenella genome as a template, amplifying a downstream sequence of the EtGCS-1 as a downstream homology arm sequence, and performing an amplification procedure: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

Subsequent design of primers

EtGCS-1-5' -ARM-F1(SEQ ID NO.23, containing a HindIII cleavage site): ctagcgtttaaacttaagcttCCGAAGTAAATACCCCAATATACAAA, respectively;

EtGCS-1-5'-ARM-R1(SEQ ID NO.24)：gaagaagcatTGTGGTGAGCCAAGGCTTCC；

EtGCS-1-3'-ARM-F1(SEQ ID NO.25)：caggatggaattccGTCACTTAATCTACTGGAGAGACAATATCTG；

EtGCS-1-3'-ARM-R(SEQ ID NO.22)：ccacactggactagtggatccACTTCCACTGTATTTTCTGGAATTAAAA；

EtGCS-1-F1(SEQ ID NO.15)：gctcaccacaATGCTTCTTCTCCTCCTCATCTTG；

DHFR-R1(SEQ ID.NO.20)：agtgacGGAATTCCATCCTGCAAGTGC。

respectively taking EtGCS-1-5'-ARM, EtGCS-1-3' -ARM and EtGCS-1-mCherry-DHFR gene sequences as templates for amplification to obtain homologous ARMs, wherein the amplification program is as follows: 30s at 98 ℃; 10s at 98 ℃, 30s at 55 ℃, 2min at 72 ℃ and 35 cycles.

Subsequently, the sequences of EtGCS-1-5'-ARM, EtGCS-1-3' -ARM and EtGCS-1-mCherry-DHFR containing homologous ARMs and the sequence of pCDNA3.1(+) vector after digestion with BamHI and HindIII are sequentially connected by a Clon express Multi One Step Cloning Kit to obtain a successful targeting DHFR resistance plasmid pCDNA3.1-EtGCS-1-mChery-DHFR, and the sequence is determined to be correct by sequencing with specific primers (SEQ ID NO.23 and SEQ ID NO. 22).

CRISPR/Cas 9-mediated integration at specific sites was used to insert fluorescent genes and resistance selection elements. The upstream homology ARM EtGCS-5'-ARM of the EtGCS-1 gene, the coding reading frame of EtGCS, the fusion gene segment of mCherry and DHFR and the downstream homology ARM EtGCS-3' -ARM are connected to construct a recombinant plasmid as a targeting plasmid. pEtGCS-1-mCherry-DHFR and pSAG: Cas9-U6: sgUPRT: EtGCS-1 plasmid were co-transfected with the targeting genome, pSAG: Cas9-U6-sgUPRT: EtGCS-1 could cut the genome, and the homologous plasmid pEtGCS-1-mCherry-DHFR was integrated into the genome.

Example 3

Eimeria tenella sporozoite transfection and positive insect strain screening

1000 ten thousand of fresh Eimeria tenella sporozoites are co-transfected with pEtGCS-1-mCherry-DHFR (1 mug) and pSAG (Cas 9-U6) (sgUPRT) and EtGCS-1(5 mug) plasmids under the conditions of electric shock for 2 times (voltage: 2000v, capacitance 25 muF and capacitance infinity), the sporozoites are infected by 3-day-old chicks after the electric transfection, pyrimethamine is added into daily ration or drinking water, 6-9 days of excrement is collected, and oocysts are obtained. And then, screening the medicines for 3 generations, and observing red fluorescence under a fluorescence microscope to obtain the positive insect strain. A coccidian model with red fluorescent protein fused and expressed after the EtGCS-1 gene was successfully constructed, and the body of the coccidia can be imaged by flow luminescence to have size gametes of the separated coccidia (FIG. 2).

Example 4

Gamete collection

Attacking oocysts obtained by screening above to infect chicks, killing chicken at 136h, taking caecum, removing intestinal contents, and adding into SAC solution (170mmol/LNaCl, 10mmol/LTris Base, 5mmol/L glucose, 5mmol/L CaCl) containing 0.5mg/mL hyaluronidase₂1mmol/LPMSF, 1mg/mL BSA, pH 7.0), incubating at 37 deg.C for 1.5 hr, filtering the digested tissue with 60 mesh, 260 mesh, 17 μm high temperature resistant polyester film, collecting the filtrate, filtering with 5 μm high temperature resistant polyester film to collect the substances on the film, centrifuging at 3200rpm for 5min, collecting the precipitate, and centrifuging and washing with PBS for 2 times.

Example 5

Flow sorting

The obtained precipitate is subjected to flow sorting, and sorting is carried out by adopting lasers with wavelengths of 488nm and 561nm, and since the GCS-1 gene is expressed in the stage of the microgametes but not expressed in the stage of the macrogametes, the microgametes fused with the mCherry in the GCS-1 can be separated by adopting red fluorescence excitation laser with 561nm (figure 3). The coccidian gamete is crescent-shaped, the macrogamete is round, the red insect body is the gamete under the microscope, the circular structure is absent, and the obtained gamete is shown. Only red crescent-shaped microgametes can be seen in visual field during microscopic examination, and fluorescence microscopic examination can prove that the method has good accuracy and high accuracy.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> method for separating Eimeria small gametes and application

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2505

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

atgcttcttc tcctcctcat cttgagcttg gcgccacaga cattggaatg ttcaggccag 60

ggtacctcga aagtagagac agcgtgctct tctgggggtt cagggtgtac agacagacta 120

attgttgagc ttgatgtgga caacctggat aaacttcagt ttcagtggga agcaggggat 180

attaacaatc ggtcccccag aaaaagcgat gcaggcaatg ccggagttgt tgtaactgta 240

caaaaaaccg ctgtatctta ctcgtacaat cttacttatg tcaaggcagt gccattcaac 300

tggatagagt acgcccatcg tgctctacta tggcaggtca aagatggtgg ggagaacttc 360

tgttcgcaga catggggttc caagtgccag gatgagcatg gggaaaatgg atatcccatt 420

agtcctaata cgggtcttcc tgtcgatgga gctcagggga aatgttgctg gtgtccttcc 480

gtctggcatc tctggctaaa caaccctaat aggggcaggg agccgatgct aaagtgcaac 540

ttttggggat tacgatttgg aaaaatcccc gatccctacc tgacgaaatt ttgccccgtt 600

gttgaatatc cgtggtatcg tatgctgaaa gtcagcgaaa atagaacatg gttctttaag 660

attctcgtcg gaatatcttg gtggaggcca cccaacccat caagcctctc agatgaagaa 720

tataaagcag agtgtgagaa aagagttcag gaagggagct accctcaaaa tttcgattgc 780

tcgcagcggc ttcacaccga agcggggatg gcggacgcca ttctcgagct ttcagatgcc 840

aaaagtattg caagggacac aacctttgac gttacagcgc gtctagttag ctcagaagta 900

ccggaatccc ctgagccaaa tattaagggc aaatacgttt tcttaccaac agccccttca 960

acaaatgcct gggtgcaaga atcccttgta acggaaggat gctcagactc cgaggaccta 1020

tcacactggg gagtaagcga gacagataat ccagatcttg ctagactctg caaatctggc 1080

tcaccatttt gtaaccctaa gagctgtccg aggcatatga tcgtcctaga cgaacaacac 1140

gtcacagtgg atggcagcac gtgtgatctc ccgggagttt cactgcagca atggggaaga 1200

gacggctttt gtgattacgc acaaggaacg tgctttgcga aaaacttgaa gtggtttcat 1260

gaatacaacg aacaggccgc agagcttggc aggacgcctc tttacgctct agagtatcca 1320

cctggtaatt accctcgtta tcacgttggc ttagataacg tggatgatgc gattgacact 1380

tcaaaagcgg gtccctttga actgcatcgc ttagcctttg cttatccgga tagtcataag 1440

agtaaagtgc gcattgagat gaatgctgga ttgattcgct ggattcagtc tacctctcca 1500

ggtcaaataa ctagcatcgc gcccccagca ccacgtgaat gcgataatgc tcagacgttt 1560

ggttgcccac taaaagtgta tgtgctcaac tcaggcacga tagatgcgac gtactatttg 1620

gagctaccat actgcacaga gcatggcagc gaggagccaa cagacaaatt ggaccctgtg 1680

ccggcaattc agcgtaatgt ccctgccggc gccagtcagg catttgacct aactctgcgg 1740

ctcacagccg ttgtcgagga gtttgacttc aactgcataa tgaagctcta tgattcagag 1800

ctaaaccaac ttgacataaa atcatttgac ctcctgacag gcaaggcagc agagttgcca 1860

gggggtgtaa cgaatcctgc aggagaggtc gtagtcatcg aaccgcctga agacaaacgg 1920

aactggtatc aaaagctaat gaacgttgtg ccggatgacg gggagtgcga ctgctccttt 1980

tggaatgtct tgtgccttcc agccgattgg agcgactgca tgggttcgct taaaaaggtt 2040

ctgaagactg ttcttttcgc gggcattgcc gttgtagctc tctttctttt atggcccata 2100

ctaaagcctc ttattaaatt gctatgcaag tgcatcctta ttccttttaa atgctgccgg 2160

tcaataggca agcatcgtaa gacgctacga aaagaaagga aacaacgaaa aaatgaagca 2220

aagaagcatg caatggagga gaaaaaacgt aaacagaaag caagaaagga aggtgcgaag 2280

gcaagctatc ttgcaaactg ggggcgcagt agcggaggaa agcaaagcag cgacagagga 2340

aacgaaggaa ccgtctcttc ttccggagct gccgcttcag aaagagatac tgaaagcaac 2400

agatggaaag agtctaacga tggtgaaaac cgcagtaaca gcagtaacta tgatgtcaac 2460

aatgaagaaa gcagcctaag ttcatccaaa agaagccagg aatga 2505

<210> 2

<211> 40

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

gtacaatctt acttatgtca gttttagagc tagaaatagc 40

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

aacttgacat ccccatttac 20

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ccgaagtaaa taccccaata tacaaa 26

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

tgtggtgagc caaggcttcc 20

<210> 6

<211> 984

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ccgaagtaaa taccccaata tacaaacttt atacatagtg cgtggaaata tagtgcaatg 60

aaggcataaa aacccacatt ttctcgagca aggccacttc ctttggcgct ggtaatgaca 120

ctgcgtagct ggcacggata tccgtgcatg aggaggcgtc aggcgaagcg aacagagttc 180

agcactttgt ctttgcttag aattaccggc ttttaaccaa ggcaatttga tttactcaag 240

cgtccgaaat acttgtgagt tgaagtacag tggaagctgg ctattaaatc cgattggcca 300

gcgaggcgga actcctcgac acacagaagt agctactcag aatgcttatg aatgatatca 360

ggagaatctc tcttctcctt ttacgcctct gaaatactaa gcactgactt atttttgttt 420

gcaattagga tcttagtaag cgccatctag gactgcagtc gctagctccc ccatgtcagc 480

ctgaagataa ctttacctga ccagtaagag ttgctgaaaa gcagcttcaa gtacttggtg 540

cttttgtttc gcttcgtaat gactcctgag ttttgcactg agaacgtgct tataggtcag 600

ctccaaatgc aactgacgag aacccaaggg aaacgagcgc aagcaacagt gcagcagagg 660

ggaaaactgc tgaggcaaac tagaaatact tgataatggg ataattcaac aattattggg 720

caaacacaaa gagggtcgga ccccactgag caagctggac gacgcataag tgttcggcgt 780

caaagacttc agacaccgag gctgccttga ctgggaagca ctgtcacgga cagcgattcg 840

tagtggccta cacagaacaa ctcaatacat aagtcctaca taagtcctac ttttcatctg 900

gtaaaggact gtaaatgtgg aaaaggcacc atcctctccc tttgtaaatc cgcagccctt 960

agcaggaagc cttggctcac caca 984

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

atgcttcttc tcctcctcat cttg 24

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gcattcctgg cttcttttgg a 21

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

atggtgagca agggcgagg 19

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

ttacttgtac agctcgtcca tgcc 24

<210> 11

<211> 711

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

atggtgagca agggcgagga ggataacaag gccatcatca aggagttcat gcgcttcaag 60

gtgcacatgg agggctccgt gaacggccac aagttcgaga tcgagggcga gggcgagggc 120

cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180

ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240

cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300

gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360

ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420

atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480

gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540

gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600

aacatcaagt tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660

cgcgccgagg gccgccactc caccagcggc atggacgagc tgtacaagta a 711

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

cgcgtagttc ctgtgtgtca tt 22

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 13

ggaattccat cctgcaagtg c 21

<210> 14

<211> 2995

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 14

cgcgtagttc ctgtgtgtca ttcgttgtcg agacaactct gtcccgcccc ggtgctgttc 60

catatgcgtg actttcccgc aattttttca gactttcagg aaagacaggc tccggaacga 120

tctcgtccat gactggtaaa tccacgacac cgcaatggcc cgcagcacct ctatctctcg 180

tgccagggga ctaacgttgt atgcgtctgc gtcttgtctt tttgcattcg ctttccaaaa 240

aagagagcca tccgttcccc cgcacattca acgccgcgag tgcggttttt gtcttttttg 300

agtggtagga cgcttttcat gcgcgaacta cgtggacatt aagttccatt ctctttttcg 360

acagcacgaa accttgcatt caaacccgcc cgcggaagat ccgatcttgc tgctgttcgc 420

agtcccagta gcgtcctgtc ggccgcgccg tctctgttgg tgggcagccg ctacacctgt 480

tatctgactg ccgtgcgcga aaatgacgcc atttttggga aaatcgggga acttcattct 540

ttaaaagtat gcggaggttt cctttttctt ctgttcgttt ctttttctcg ggtttgataa 600

ccgtgttcga tgtaagcact ttccgtctct cctccgtgct ttgttcgaca tcgagaccag 660

gtgtgcagat ccttcgcttg tcgatccgga gacgcgtgtc tcgtagaacc ttttcatttt 720

accacacggc agtgcggagc actgctctga gtgcagcagg gacgggtgaa gtttcgcttt 780

agtagtgcgt ttctgctcta cggggcgttg tcgtgtctgg gaagatgcag aaaccggtgt 840

gtctggtcgt cgcgatgacc cccaagaggg gcatcggcat caacaacggc ctcccgtggc 900

cccacttgac cacagatttc aaacactttc gtcgtgtgac aaaaacgacg cccgaagaag 960

ccagtcgcct gaacgggtgg cttcccagga aatttgcaaa gacgggcgac tctggacttc 1020

cctctccatc agtcggcaag agattcaacg ccgttgtcat gggacggaaa aactgggaaa 1080

gcatgcctcg aaagtttaga cccctcgtgg acagattgaa catcgtcgtt tcctcttccc 1140

tcaaagaaga agacattgcg gcggagaagc ctcaagctga aggccagcag cgcgtccgag 1200

tctgtgcttc actcccagca gctctcagcc ttctggagga agagtacaag gattctgtcg 1260

accagatttt tgtcgtggga ggagcgggac tgtacgaggc agcgctgtct ctgggcgttg 1320

cctctcacct gtacatcacg cgtgtagccc gcgagtttcc gtgcgacgtt ttcttccctg 1380

cgttccccgg agatgacatt ctttcaaaca aatcaactgc tgcgcaggct gcagctcctg 1440

ccgagtctgt gttcgttccc ttttgtccgg agctcggaag agagaaggac aatgaagcga 1500

cgtatcgacc catcttcatt tccaagacct tctcggacaa cggggtaccc tacgactttg 1560

tggttctcga gaagagaagg aagactgacg acgcagccac tgcggaaccg agcaacgcaa 1620

tgagctcctt gacgtccacg agggagacaa ctcccgtgca cgggttgcag gctccttctt 1680

cggccgcagc cattgccccg gtgttggcgt ggatggacga agaagaccgg aaaaaacgcg 1740

agcaaaagga actgattcgg gccgttccgc atgttcactt tagaggccat gaagaattcc 1800

agtaccttga tctcattgcc gacattatta acaatggaag gacaatggat gaccgaacgg 1860

gcgttggtgt catctccaaa ttcggctgca ctatgcgcta ctcgctggat caggcctttc 1920

tacttctcac cacaaagcgt gtgttctgga aaggggtcct cgaagagttg ctgtggttca 1980

ttcgcggcga cacgaacgca aaccatcttt ctgagaaggg cgtgaagatc tgggacaaga 2040

atgtgacacg cgagttcctc gattcgcgca atctccccca ccgagaggtc ggagacatcg 2100

gcccgggcta cggcttccag tggagacact tcggcgcggc atacaaagac atgcacacag 2160

actacacagg gcagggcgtc gaccagctga agaatgtgat ccagatgctg agaacgaatc 2220

caacagatcg tcgcatgctc atgactgcct ggaatcctgc agcgctggac gaaatggcgc 2280

tgccgccttg tcacttgttg tgccagttct acgtgaacga ccagaaggag ctgtcgtgca 2340

tcatgtatca gcggtcgtgc gatgtcggcc tcggcgtccc cttcaacatc gcttcctatt 2400

cgcttttgac gctcatggtt gcacacgtct gcaacctaaa acctaaggag ttcattcact 2460

tcatggggaa cacgcatgtc tacacgaacc atgtcgaggc tttaaaagag cagctgcgga 2520

gagaaccgag accgttcccc attgtgaaca tcctcaacaa ggaacgcatc aaggaaatcg 2580

acgatttcac cgccgaggat tttgaggtcg tgggctacgt cccgcacgga cgaatccaga 2640

tggagatggc tgtctagcgg aaatacagaa gctgcccgtc tctcgttttc ctctcttttc 2700

ggagggatca gggagagtgc ctcgggtcgg agagagctga cgagggggtg ccagagaccc 2760

ctgtgtcctt tatcgaagaa aagggatgac tcttcatgtg gcattccaca cagtctcacc 2820

tcgccttgtt ttctttttgt caatcagaac gaaagcgagt tgcgggtgac gcagatgtgc 2880

gtgtatccac tcgtgaatgc gttatcgttc tgtatgccgc tagagtgctg gactgttgct 2940

gtctgcccac gacagcagac aactttcctt ctatgcactt gcaggatgga attcc 2995

<210> 15

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 15

gctcaccaca atgcttcttc tcctcctcat cttg 34

<210> 16

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 16

ttgctcacca tgcattcctg gcttcttttg ga 32

<210> 17

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 17

caggaatgca tggtgagcaa gggcgagg 28

<210> 18

<211> 31

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 18

ctacgcgtta cttgtacagc tcgtccatgc c 31

<210> 19

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 19

gctgtacaag taacgcgtag ttcctgtgtg tcatt 35

<210> 20

<211> 27

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 20

agtgacggaa ttccatcctg caagtgc 27

<210> 21

<211> 31

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 21

gtcacttaat ctactggaga gacaatatct g 31

<210> 22

<211> 49

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 22

ccacactgga ctagtggatc cacttccact gtattttctg gaattaaaa 49

<210> 23

<211> 49

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 23

ccacactgga ctagtggatc cacttccact gtattttctg gaattaaaa 49

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 24

gaagaagcat tgtggtgagc caaggcttcc 30

<210> 25

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 25

caggatggaa ttccgtcact taatctactg gagagacaat atctg 45

<210> 26

<211> 997

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 26

gtcacttaat ctactggaga gacaatatct gggcctaaaa gggctacggg gtgattttaa 60

cgacatggca gaataaatta cgggaaagcg ccacattgat ttgccagcta atggcagtcc 120

gagatttctt gccagctagt gtgacagatg ttttctctgc caatatcatc taggcgcggt 180

cttccgaaag gcctggaaag cctgaaaagc ctaaaatttt tggagcacaa tgagctcgtc 240

aagtcatgag cgctacagta ggctacaata gttagtgatc agaaatttcc cgagcttgta 300

ggcaaaaatc ctgacatgta ccagcagggc ttagaacagc agaagagaat gcttggaaga 360

agaggtcgga ggagatctaa acgaaagagt ttcgcagcat cgcgcgcaac tgaacatagg 420

agatagcagg tggtcagtgt ccgaactgtg gcagaactat cacacgctag gcccgcatcg 480

gttctgttta actcaaagtt ggtttcatgg ttttatctac aaatgtcgtc ctaagtcgtc 540

gagattgtgc ccaggaaagc tcatgtttat cttccccgtg gcgtgcacgc gctttctgac 600

aataacgcta acggggaaat acgatccgca gcagacaaga tatgttgagg attcaggggg 660

tgcactttca tgattttgtg gtgttctgtc aaataattag tcttcgttgc tatgagcgct 720

acataatgca atcgcttgag gttggcagat gtcccacagg taaggtcact tgtgtatcgc 780

caccgcagtt gctggctcac tacattgctt gattttgacc cagcaaggat ttggcatgta 840

gaaaaattaa aagtcttagg gaataagcgg cattattttg atagtaccct gcaggctccc 900

agttcaagag aaccggggcc gcgggacatt cgtgcagcaa ggtgcagatg acctagcatg 960

agtatttctt tttaattcca gaaaatacag tggaagt 997

Claims (4)

1. A method for isolating eimeria small gametes, comprising the steps of: designing a gRNA gene editing knock-in carrier plasmid based on a coding gene of GCS-1 protein of Eimeria, wherein the coding gene of the GCS-1 protein is shown as SEQ ID NO.1, and designed primer sequences are shown as SEQ ID NO.2 and SEQ ID NO. 3;

constructing a target gene donor vector containing two homologous ARMs, namely 5'-ARM and 3' -ARM, wherein a sequence segment for coding exogenous fluorescent protein and DHFR exists between the 5'-ARM and the 3' -ARM, and obtaining a donor vector plasmid containing the 5'-ARM, GCS-1, exogenous fluorescent protein, DHFR and 3' -ARM segments;

when constructing a homologous template, amplifying a gene segment of upstream EtGCS-1-5' -ARM as shown in SEQ ID NO. 6; constructing a fragment EtGCS-1-exogenous fluorescent protein-DHFR carrying EtGCS-1, exogenous fluorescent protein and DHFR drug-resistant pyrimethamine gene, wherein the sequence of the EtGCS-1 is shown as SEQ ID NO.1, and the DHFR gene is shown as SEQ ID NO. 14; amplifying a gene segment of upstream EtGCS-1-3' -ARM shown as SEQ ID NO. 26; then connecting the sequences of EtGCS-1-5'-ARM, EtGCS-1-3' -ARM and EtGCS-1-exogenous fluorescent protein-DHFR containing homologous ARMs with the sequence of pCDNA3.1(+) vector after enzyme digestion by BamHI and HindIII in sequence to obtain a successful targeting DHFR resistance plasmid pCDNA3.1-EtGCS-1-exogenous fluorescent protein-DHFR;

inserting a fluorescent gene and a resistance screening element by CRISPR/Cas 9-mediated integration at a specific site; connecting an upstream homologous ARM EtGCS-5'-ARM and an encoding reading frame of EtGCS of the EtGCS-1 gene, a fusion gene segment of exogenous fluorescent protein and DHFR and a downstream homologous ARM EtGCS-3' -ARM to construct a recombinant plasmid as a targeting plasmid; integrating donor vector plasmids integrated with gRNA gene editing knock-in vector plasmids and 5'-ARM, GCS-1, exogenous fluorescent protein, DHFR and 3' -ARM fragments into sporozoites in a sporozoite transfection mode;

fusing a gene sequence for coding a fluorescent protein with a specific gene of the Eimeria, knocking the fused protein into a genome of the Eimeria, and screening a target coccidium for expressing the fused gene; the screening preferably comprises the steps of infecting chickens with the sporozoites, adding pyrimethamine into drinking water or feed for drug screening, and infecting the chickens with positive screened polypides after three passages, wherein the positive symptoms are as follows: exhibit exogenous fluorescent protein fluorescence and survive;

collecting ceca of chicken infected with Eimeria oocysts for 136h, taking out ceca mucosal tissue, removing contents, digesting the ceca mucosal tissue with hyaluronidase, filtering the ceca with a filter sieve and a membrane, and taking an unfiltered part of the ceca; then centrifuging for 5 minutes at 3200rpm, taking a precipitate, and centrifuging and washing for 2 times by using PBS liquid;

and screening the individuals with fluorescence by using a flow sorting method, wherein the individuals with fluorescence in the precipitate are Eimeria gametes.

2. The method of claim 1, wherein the species of eimeria comprises eimeria tenella, eimeria necatrix, eimeria maxima, eimeria acervulina, and eimeria mitis, eimeria brunetti, or eimeria praecox.

3. The method of claim 1, wherein the filtering comprises filtering through a 60-mesh molecular sieve, a 260-mesh molecular sieve and a 17 μm high temperature resistant polyester film in sequence, and filtering the filtrate through a 5 μm high temperature resistant polyester film;

the centrifugation comprises the step of centrifuging residues on the film of the high-temperature resistant polyester film;

the rotation speed of the centrifugation is 3200rpm, and the time is 5 min.

4. The method of claim 1, wherein the exogenous fluorescent protein is selected from the group consisting of mCherry and EYFP.

Images