CN112746072A

CN112746072A - sgRNA for beta-hemoglobinopathy gene editing and application

Info

Publication number: CN112746072A
Application number: CN201911063021.7A
Authority: CN
Inventors: 梁峻彬; 古博; 徐辉; 陈昱
Original assignee: Guangzhou Ruifeng Biotechnology Co ltd
Current assignee: Guangzhou Ruifeng Biotechnology Co ltd
Priority date: 2019-10-31
Filing date: 2019-10-31
Publication date: 2021-05-04

Abstract

The invention relates to an sgRNA for gene editing of β-hemoglobinopathies and its application, and belongs to the technical field of gene editing. The sgRNA includes from 5' to 3': a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a proximal domain and a tail domain; the RNA sequence length of the targeting domain is 17-20nt, and/or the number of base pairings between the first complementary domain and the second complementary domain is 14-18, wherein the number of base pairings close to the targeting domain is 6-8 , and the number of base pairings close to the linking domain is 8-10. The sgRNA of the invention has high gene editing efficiency, can reduce the cost on the premise of ensuring high editing efficiency, and is thus widely used in the preparation of medicines for treating β-thalassemia or sickle cell anemia.

Description

sgRNA for beta-hemoglobinopathy gene editing and application

Technical Field

The invention relates to the technical field of gene editing, in particular to sgRNA for gene editing of beta-hemoglobinopathy and application thereof.

Background

Hemoglobin (Hb) is a specific protein that carries and transports oxygen within red blood cells. Hemoglobin is composed of globin (globin) and heme. During embryonic development and shortly after birth, hemoglobin exists as fetal hemoglobin (HbF), a tetrameric protein consisting of two alpha-globin chains and two gamma-globin chains. As the infant develops, HbF is gradually replaced by adult hemoglobin (HbA), wherein the γ -globin chain of HbF is replaced by the β -globin chain through a process called globin conversion. HbF is more effective at carrying oxygen than HbA, but the proportion of HbF in total hemoglobin in an average adult is typically below 1%. The α -globin gene is located on chromosome 16, while the β -globin gene (HBB), the γ (γ a) -globin chain (HBG1, also known as γ globin a) and the G γ (γ G) -globin chain (HBG2, also known as γ globin G) are clustered within a genomic locus on chromosome 11, known as the β -globin gene cluster.

Mutations in HBB can cause β -hemoglobin disorders (also known as β -hemoglobinopathy), including Sickle Cell Disease (SCD) and β -thalassemia (β -thal). Sickle cell anemia is caused by point mutations in the beta-globin structural gene, resulting in the production of abnormal hemoglobin (HbS). Beta-thalassemia is caused by a partial or complete defect in beta-globin gene expression, resulting in a defect or deletion of adult hemoglobin (HbA). Hemoglobin structure abnormality can be caused by reduction or deletion of globin chains of hemoglobin, the deformability of the hemoglobin-containing red blood cells is reduced, the service life of the red blood cells is shortened, in-situ hemolysis can occur in bone marrow, and the red blood cells are damaged by organs such as spleen and the like in advance after entering peripheral blood circulation, so that anemia, in-vivo iron deposition and even abnormal development can be caused. Because these disorders are associated with mutations in HBB, their symptoms are usually not manifested until the conversion of globin from HbF to HbA. Hemoglobinopathies affect millions of people worldwide, and currently about 330,000 children are born annually with hemoglobinopathies, seriously threatening human health and even life.

Thalassemia and sickle cell disease patients mainly relieve the disease through normative long-term blood transfusion and iron removal treatment, but the mode cannot cure and brings higher potential safety hazard. Allogeneic hematopoietic stem cell transplantation is the only treatment technology capable of radically treating thalassemia and sickle cell disease at present, but is difficult to be clinically applied in a large range due to the limitations of low success rate of bone marrow matching, risk of immunological rejection and other factors. There is therefore an urgent need to develop new safe and effective therapeutic methods.

In recent years, gene editing technologies have been developed in a breakthrough manner, and currently, ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR (regularly clustered interspaced short palindromic repeats)/Cas 9 are relatively mature gene editing technologies. The CRISPR/Cas9 is called as a third-generation gene editing technology, and compared with ZFNs and TALENs, the CRISPR/Cas9 is simple in construction, high in mutation efficiency and convenient to use.

The engineered CRISPR/Cas9 system comprises two main components: (1) cas9 protein, having endonuclease activity. (2) A guide rna (grna) that recognizes the target site DNA by base-complementarity on the one hand, and binds to Cas9 protein on the other hand. The guide RNA may be one RNA, called sgRNA, or may be divided into two parts, called crRNA (containing a sequence that recognizes the DNA of the target site) and tracrRNA. Upon recognition and binding of DNA by the CRISPR/Cas9 system, DNA can be cleaved, forming DNA Double Strand Breaks (DSBs). In living cells, this break can be repaired by non-homologous end joining (NHEJ) repair mechanisms or homology-directed repair (HDR) mechanisms, resulting in sequence changes (mutations, insertions or deletions) at the corresponding genomic sites.

The human BCL11A gene is located on chromosome 2 of genome, encodes a C2H2 type zinc finger binding protein, and has the function of inhibiting the expression of gamma-globin gene. The research shows that the expression of BCL11A is reduced or inhibited to increase the expression of fetal hemoglobin, so that the fetal hemoglobin has a therapeutic effect on beta-hemoglobinopathy.

The group of Stuart Orkin, usa, found that by deleting or disrupting three erythroid-specific enhancer regions (+54, +58, +62) in the genomic intron of BCL11A, the expression of BCL11A in the erythroid could be significantly inhibited, allowing the expression of fetal hemoglobin in mature erythrocytes. The Daniel Bauer group further found that the deletion or disruption of the GATA core element in the +58 enhancer region of the BCL11A gene by CRISPR/Cas9 technology (WO 2016/182917A1, sgRNA target site BCL-01617, the locus of the GATA core element on the GRCh38/hg38 version of the human genome is chr2:60,495,266-60,495,269) can significantly enhance the expression of fetal hemoglobin. Hematopoietic stem cells of patients with beta-thal and SCD are extracted, and the GATA motif can be destroyed by in vitro shock transfection of a CRISPR/Cas9 system targeting the genomic locus, so that differentiated patient red blood cells are induced to successfully express fetal hemoglobin.

However, we found that the Daniel Bauer group provided a lower editing efficiency of CRISPR/Cas9 system targeting the GATA core element (target site BCL _01617) in the BCL11A gene +58 enhancer region, and therefore the Daniel Bauer group used higher doses of the Cas9 protein + sgRNA complex to achieve higher gene editing efficiency. Since the CRISPR/Cas9 system is applied to treatment requiring a large amount of high-purity Cas9 protein + sgRNA complex, the cost is very high.

Disclosure of Invention

In view of the above, it is desirable to provide a sgRNA for β -hemoglobinopathy gene editing, which has high gene editing efficiency and can reduce the cost while ensuring high editing efficiency, and applications thereof.

A sgRNA for β -hemoglobinopathy gene editing, the sgRNA comprising, from 5'to 3': a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a proximal domain and a tail domain; the length of the RNA sequence of the targeting domain is 17-20nt, and/or the number of base pairs between the first complementary domain and the second complementary domain is 14-18, wherein the number of base pairs close to the targeting domain is 6-8, and the number of base pairs close to the connecting domain is 8-10.

The invention improves the efficiency of CRISPR-Cas9 system gene editing by changing the secondary structure or base composition of sgRNA, reduces the length of RNA sequence for recognizing target site in the sgRNA to 17-20nt, can obtain the same gene editing efficiency but can obviously improve the specificity of gene editing, namely reduces off-target effect. Meanwhile, the sequence composition of the conventional sgRNA is optimized, so that the base pairing number of the first complementary domain and the second complementary domain is increased to 14-18, and the aims of improving the efficiency of a Cas9 gene editing system targeting a BCL11A +58 enhancer region GATA core element and/or improving the specificity of gene editing (reducing off-target effect) are achieved by enhancing the stability of the sgRNA and the binding capacity with a Cas9 protein.

In one embodiment, the first or second complementary domain comprises the sequence shown in SEQ ID NO. 1 or the antisense complement thereof. The efficiency and specificity of the Cas9 gene editing system are further improved by adding the sequence shown in SEQ ID NO. 1 into the first complementary domain or the second complementary domain.

In one embodiment, the sgRNA is selected from the sequences shown in SEQ ID NO. 2 to SEQ ID NO. 6.

In one embodiment, the sgRNA is selected from the group consisting of the sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5.

The invention also discloses an expression vector for editing the beta-hemoglobinopathy gene, wherein the expression vector is obtained by connecting the DNA sequence corresponding to the sgRNA to a basic vector, and the sgRNA is obtained by expression of the expression vector.

The invention also discloses a system for beta-hemoglobinopathy gene editing, which comprises the sgRNA and the Cas9 protein.

In one embodiment, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes or an evolved derivative thereof.

The invention also discloses a CRISPR-Cas9RNP for beta-hemoglobinopathy gene editing, wherein the CRISPR-Cas9RNP is formed in vitro by the sgRNA and the Cas9 protein.

The invention also discloses a hematopoietic stem cell which is obtained by transferring the CRISPR-Cas9RNP into the hematopoietic stem cell by adopting an electrotransfer method.

The invention also discloses a kit for beta-hemoglobinopathy gene editing, which comprises:

(1) at least one of a vector expressing Cas9 protein, Cas9 protein, and mRNA corresponding to Cas9 protein;

(2) at least one of the sgRNA and a vector expressing the sgRNA.

The invention also discloses application of the sgRNA, the expression vector, the CRISPR-Cas9 system, the CRISPR-Cas9RNP, the hematopoietic stem cells and the kit in preparation of a medicament for treating beta-thalassemia or sickle anemia.

Compared with the prior art, the invention has the following beneficial effects:

compared with the prior art, the sgRNA for beta-hemoglobinopathy gene editing can efficiently destroy a BCL11A +58 enhancer region GATA core element (the locus on the GRCh38/hg38 human genome is chr2:60,495, 266-.

Experiments prove that under the same conditions, by comparing the editing efficiency of a compound formed by a plurality of different sgRNAs and Cas9 on a BCL11A +58 enhancer region GATA core element, two sgRNAs (sgRNA-4 and sgRNA-5) with the editing efficiency higher than that of the conventional technology are obtained, and particularly the sgRNA-4 can improve the gene editing efficiency by 2-3 times.

Drawings

Fig. 1 is a schematic diagram of an optimized sgRNA expression cassette in an example;

FIG. 2 is a schematic diagram of a PX459-OP carrier;

FIG. 3 shows the result of T7E1 enzyme digestion electrophoresis;

FIG. 4 is a diagram showing the base peaks at the locus of BCL11A gene;

FIG. 5 shows the total percentage of the gene INDEL of BCL 11A;

FIG. 6 shows the type and percentage of the gene INDEL 11A of BCL.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The starting materials used in the following examples are all commercially available.

Examples

The core sequence of BCL11A gene enhancer in 293FT cells was mutated using CRISPR-Sp Cas9 technology.

1. And constructing an sgRNA structure-optimized sgRNA-spCas9 vector.

Based on the sgRNA-spCas9 vector (PX459) used by us, the original sgRNA expression cassette is replaced by a structurally optimized sgRNA expression cassette (as shown in FIG. 1) to obtain a PX459-OP vector (shown in FIG. 2), so that the base pairing number of the first complementary domain and the second complementary domain is increased to 16, and the expressed sgRNA contains SEQ ID NO:1(5'-UGCUG-3') or an antisense complementary sequence (5'-CAGCA-3') thereof in the first complementary domain or the second complementary domain.

The specific operation flow is as follows:

1) the product 1(324bp) is obtained by PCR amplification using PX459 vector DNA as a template and DNAs with sequences as SEQ ID NO:7 and SEQ ID NO:10 in the following table as primers, and the product 2(187bp) is obtained by PCR amplification using DNAs with sequences as SEQ ID NO:8 and SEQ ID NO:9 in the following table as primers. The Takara PrimeSTAR max Hi-Fidelity taq enzyme was used for PCR. After completion of PCR, electrophoresis was performed on a 2% agarose gel to recover product 1 and product 2.

TABLE 1 amplification primers

2) A small amount of product 1 and product 2 are mixed, DNA with sequences shown as SEQ ID NO. 7 and SEQ ID NO. 8 is added as a primer, and a 479bp PCR product 3 is obtained. After completion of PCR, electrophoresis was performed on a 2% agarose gel to recover product 3.

3) Taking 1 mu g of PX459 vector DNA and all recovered PCR products 3, carrying out double enzyme digestion for 30 minutes by using restriction enzymes Psc I and Xba I, detecting the enzyme digestion effect by 1% agarose electrophoresis, recovering the enzyme digestion products of the PX459 vector, directly recovering the enzyme digestion products of the PCR products 3 by using a PCR product purification method, and respectively recovering the enzyme digestion products in 40 mu l of elution buffer solution.

4) The cut product of PX459 vector and the cut product of PCR product 3 were taken, DNA ligation was performed using T4 DNA ligase (Transgen Co.), and the reaction was performed at 25 ℃ for 2 hours in the following reaction system:

5) taking 5 mu l of the ligation product, transforming the escherichia coli competent cell TOP10 by a heat shock method, adding 500 mu l of sterile LB liquid culture medium (without antibiotics) into each centrifuge tube after transformation, uniformly mixing, placing in a constant temperature shaking table at 37 ℃ and 200rpm, and carrying out shaking culture for 45min to recover the thalli.

6) Recovered TOP10 cells were plated on LB solid plates (Amp +), and placed upside down in a incubator at 37 ℃ for static culture for 16 h.

7) Single colonies were picked from the above plates and identified by colony PCR using primers with sequences as SEQ ID NO 7 and SEQ ID NO 10. Colonies with the appropriate insert were inoculated into LB broth (Amp +) for amplification and the resulting bacterial suspension was sequenced using the primer U6-Seq (5'-ATGGACTATCATATGCTTACCGTA-3') (SEQ ID NO: 11).

8) And carrying out amplification culture on the colony with correct sequencing, extracting the plasmid, determining the concentration of the plasmid, and storing at-20 ℃ for later use.

2. Cas9/gRNA vector preparation

The sequences of gRNAs with three lengths of 20nt, 18nt and 17nt are designed according to the sequence of a BCL11A gene enhancer GATA core element, and the target sequences of the gRNAs are shown in SEQ ID NO. 12-SEQ ID NO. 14.

TABLE 2 amplification primers

Sequence name	Sequence (5'to3')
		SEQ ID NO:12	CTAACAGTTGCTTTTATCAC
SEQ ID NO:13	AACAGTTGCTTTTATCAC
		SEQ ID NO:14	ACAGTTGCTTTTATCAC
SEQ ID NO:15	CACCGCTAACAGTTGCTTTTATCAC
		SEQ ID NO:16	AAACGTGATAAAAGCAACTGTTAGC
SEQ ID NO:17	CACCGAACAGTTGCTTTTATCAC
		SEQ ID NO:18	AAACGTGATAAAAGCAACTGTTC
SEQ ID NO:19	CACCGACAGTTGCTTTTATCAC
		SEQ ID NO:20	AAACGTGATAAAAGCAACTGTC

The specific operation method comprises the following steps:

1) respectively synthesizing a sense strand and an antisense strand of a DNA sequence corresponding to the gRNA (the 5' -end of the sense strand is added with cacc, if the first nucleotide at the 5' -end of the sense strand is not guanine G, the 5' -end of the sense strand is added with caccG; adding aaac to the 5' -end of the antisense strand, and adding C to the 3' -end of the antisense strand if the first nucleotide at the 5' -end of the sense strand is not guanine G); the sense strand and antisense strand of gRNAs with three lengths of 20nt, 18nt and 17nt are respectively SEQ ID NO. 15 and SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 18, and SEQ ID NO. 19 and SEQ ID NO. 20.

2) And mixing a sense strand and an antisense strand of the DNA sequence corresponding to the gRNA, treating at 95 ℃ for 5 minutes, naturally cooling to room temperature, and annealing to form double-stranded DNA with a sticky end.

3) The plasmid (PX459_ OP) obtained from PX459 and 1.1(9) is digested by restriction enzyme Bbs I, and the reaction is terminated by adding loading buffer after the digestion is carried out for 1h at 37 ℃. Cutting gel after agarose gel electrophoresis, recovering linearized vector, determining the concentration of recovered product, and storing at-20 deg.C for use.

4) Carrying out connection reaction on the linearized PX459 and PX459_ OP carriers recovered by gel cutting and the annealed double-stranded DNA;

5) and (3) transforming the escherichia coli competent cell TOP10 by a ligation product heat shock method, adding a sterile LB liquid culture medium (without antibiotics) into each centrifuge tube after transformation, uniformly mixing, and placing in a constant temperature shaking table at 37 ℃ and 200rpm for shaking culture for 45min to recover the thalli.

6) Recovered TOP10 cells were plated on LB solid plates (Amp +), and placed upside down in a constant temperature incubator at 37 ℃ for static culture for 14-16 h.

7) Single colonies were picked from the above plates and subjected to colony PCR identification using primers of SEQ ID NO. 7 and 16, SEQ ID NO. 7 and 18, and SEQ ID NO. 7 and 20, respectively.

8) The colonies with the appropriate insert were inoculated into LB liquid medium (Amp +) for amplification and the bacterial suspension was sequenced using SEQ ID NO:11 as primer.

9) And carrying out amplification culture on the colony with correct sequencing, extracting the plasmid, determining the concentration of the plasmid, and storing at-20 ℃ for later use. The 6 obtained plasmids respectively express sgRNA of SEQ ID NO. 21, SEQ ID NO. 2 to SEQ ID NO. 6.

TABLE 3 expression of the resulting sgRNAs

The structure of the sgRNA is shown in fig. 1, the structure of the wild-type sgRNA in fig. 1 is the conventional sgRNA design (sgRNA-1) at present, and the structure is optimized by the invention to obtain the optimized sgRNA structure. And optimizing the target structure domain (sequence for identifying the target site) to obtain sgRNA sequences of sgRNA-2 to sgRNA-6.

3. And (4) cell transfection.

1)293FT cell plating;

2) respectively transfecting 293FT cells with the plasmids extracted in the step 2 and the step 9 by using a Lipofectamine 2000 kit;

3) the transfected cells were cultured for 72 hours and harvested by centrifugation.

4. The T7E1 enzyme digestion analysis mutation efficiency.

1) Extracting cell genome from the cells obtained by transfecting and collecting the cells, and detecting the genome concentration;

2) PCR amplification of a fragment of interest (579bp) comprising the target site using the following primers SEQ ID NO:22 and SEQ ID NO:23

GAGAGTGCAGACAGGGGAAG(SEQ ID NO:22)

CACCCTGGAAAACAGCCTGA(SEQ ID NO:23)

3) Purifying and recovering PCR products, and determining the product concentration;

4) 200ng of the PCR product purified as described above was taken, 10x T7 Endonuclease I Reaction Buffer (1. mu.l) was added thereto, and the mixture was made up to 10. mu.l with sterilized water, and annealing was carried out according to the following procedure:

5) 0.5. mu. l T7 endonuclease 1(T7E1) was added to each tube of the annealed product, and a negative control group (cells transformed with PX459 empty vector) was set and digested at 37 ℃ for 20 minutes.

6) The enzyme digestion effect was checked by 2% agarose gel electrophoresis.

As shown in fig. 3, the numbers of lanes correspond to the numbers of sgrnas, and according to the principle of T7E1 enzyme digestion analysis, higher enzyme digestion efficiency indicates higher mutation efficiency of target sequences corresponding to grnas on target genes.

The electrophoresis results show that sgRNA-1, sgRNA-2, sgRNA-4 and sgRNA-5 have mutation effects on target gene fragments, and the mutation efficiencies of the sgRNA-4, the sgRNA-5, the sgRNA-1 and the sgRNA-2 are sequentially from strong to weak.

5. BCL11A gene mutation efficiency and mutation type were analyzed by sequencing.

1) The PCR product obtained in the T7E1 digestion step was used for sequencing using SEQ ID NO:22 as primer.

2) The peak value diagram of each locus base obtained by sequencing result is shown in fig. 4, and it can be seen from the diagram that in the samples transfected with sgRNA-1, sgRNA-2, sgRNA-4, sgRNA-5, base behind the predicted cleavage site (GA/TA) appears bimodal or multimodal to different degrees, which represents that the sequence after the cleavage site appears with mutation such as insertion or deletion. No bimodal or multimodal phenomena occurred in the sgRNA-3 and sgRNA-6 samples, as well as in the control sample (NC), indicating that no mutations such as insertions or deletions occurred.

3) The total percentage of mutations such as insertions or deletions in each sample was obtained by analyzing the total mutation ratio of the target sites in the sequencing data using ICE software from synthgo, as shown in fig. 5, and the total ratio of insertions or deletions (INDELs) in the samples of sgRNA-1, sgRNA-2, sgRNA-4, sgRNA-5 was: 20%, 11%, 47%, 25%, sgRNA-3 and sgRNA-6 samples did not see insertion or deletion mutations.

4) The major mutation types and percentages of the target sites in the sequencing data were analyzed by using ICE software from Synthego, and the results are shown in FIG. 6, and the types and proportions of insertion or deletion mutations (INDEL) in samples of sgRNA-1, sgRNA-2, sgRNA-4, sgRNA-5 were obtained, with one nucleotide (+1) being most common and 15 nucleotides (-15) being deleted. Deletion of 13 nucleotides (-13), deletion of 7 nucleotides (-7), deletion of 1 nucleotide (-1), and deletion of 2 nucleotides (-2) were also seen in sgRNA-4 samples. Both of these types of mutations disrupt the GATA motif, resulting in reduced or lost enhancer activity.

The results show that the editing efficiency of two sgrnas, namely sgRNA-4 and sgRNA-5, is higher than that of sgRNA-1 in the conventional technology, and particularly, the sgRNA-4 can improve the gene editing efficiency by 2-3 times.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou Ruifeng Biotechnology Ltd

<120> sgRNA for beta-hemoglobinopathy gene editing and application

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ugcug 5

<210> 2

<211> 98

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aacaguugcu uuuaucacgu uuuagagcua gaaauagcaa guuaaaauaa ggcuaguccg 60

uuaucaacuu gaaaaagugg caccgagucg gugcuuuu 98

<210> 3

<211> 97

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acaguugcuu uuaucacguu uuagagcuag aaauagcaag uuaaaauaag gcuaguccgu 60

uaucaacuug aaaaaguggc accgagucgg ugcuuuu 97

<210> 4

<211> 110

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cuaacaguug cuuuuaucac guuucagagc uaugcuggaa acagcauagc aaguugaaau 60

aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 110

<210> 5

<211> 108

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aacaguugcu uuuaucacgu uucagagcua ugcuggaaac agcauagcaa guugaaauaa 60

ggcuaguccg uuaucaacuu gaaaaagugg caccgagucg gugcuuuu 108

<210> 6

<211> 107

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acaguugcuu uuaucacguu ucagagcuau gcuggaaaca gcauagcaag uugaaauaag 60

gcuaguccgu uaucaacuug aaaaaguggc accgagucgg ugcuuuu 107

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctggccttt tgctcacatg tgag 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tatgtaacgg gtacctctag agcc 24

<210> 9

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cagagctatg ctggaaacag catagcaagt tgaaataagg ctagtccgtt atca 54

<210> 10

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caacttgcta tgctgtttcc agcatagctc tgaaacaggt cttctcgaag accc 54

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atggactatc atatgcttac cgta 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctaacagttg cttttatcac 20

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aacagttgct tttatcac 18

<210> 14

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

acagttgctt ttatcac 17

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caccgctaac agttgctttt atcac 25

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aaacgtgata aaagcaactg ttagc 25

<210> 17

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caccgaacag ttgcttttat cac 23

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaacgtgata aaagcaactg ttc 23

<210> 19

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

caccgacagt tgcttttatc ac 22

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaacgtgata aaagcaactg tc 22

<210> 21

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cuaacaguug cuuuuaucac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gagagtgcag acaggggaag 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

caccctggaa aacagcctga 20

Claims

1. an sgRNA for β-hemoglobinopathic gene editing, wherein the sgRNA comprises from 5' to 3': a targeting domain, a first complementary domain, a connecting domain, a second complementary domain , the proximal domain and the tail domain; the RNA sequence length of the targeting domain is 17-20nt, and/or the number of base pairings between the first complementary domain and the second complementary domain is 14 -18, of which the number of base pairings near the targeting domain is 6-8 and the number of base pairings near the linking domain is 8-10.

2. The sgRNA for β-hemoglobinopathy gene editing according to claim 1, wherein the first complementary domain or the second complementary domain comprises the sequence shown in SEQ ID NO: 1 or its antisense complementary sequence.

3 . The sgRNA for β-hemoglobinopathic gene editing according to claim 1 , wherein the sgRNA is selected from the sequences shown in SEQ ID NO:2 to SEQ ID NO:6. 4 .

The sgRNA for β-hemoglobinopathy gene editing according to claim 3, wherein the sgRNA is selected from the sequences shown in SEQ ID NO:4 and SEQ ID NO:5.

5. An expression vector for β-hemoglobinopathy gene editing, characterized in that, the expression vector is obtained by connecting the DNA sequence corresponding to the sgRNA according to any one of claims 1-4 to a base vector, The expression vector is expressed to obtain the sgRNA according to any one of claims 1-4.

6. A system for gene editing of beta-hemoglobinopathies, comprising the sgRNA according to any one of claims 1-4, and a Cas9 protein.

7. A CRISPR-Cas9RNP for gene editing in β-hemoglobinopathies, wherein the CRISPR-Cas9RNP is formed in vitro by the sgRNA and Cas9 protein according to any one of claims 1-4.

8. A hematopoietic stem cell, characterized in that, the CRISPR-Cas9RNP of claim 7 is transferred into hematopoietic stem cells by electroporation and obtained.

9. A kit for gene editing of beta-hemoglobinopathies, comprising:

(1) at least one of a carrier for expressing Cas9 protein, Cas9 protein and mRNA corresponding to Cas9 protein;

(2) at least one of the sgRNA according to any one of claims 1-4 and the vector expressing the gRNA according to claim 5.

10. The sgRNA of any one of claims 1-4, the expression vector of claim 5, the CRISPR-Cas9 system of claim 6, the CRISPR-Cas9RNP of claim 7, and the CRISPR-Cas9 RNP of claim 8 Use of the hematopoietic stem cells and the kit of claim 9 in the preparation of a medicament for the treatment of beta-thalassemia or sickle cell anemia.