CN112725472A

CN112725472A - Gene chip and kit for joint detection of various sheep epidemic diseases

Info

Publication number: CN112725472A
Application number: CN201910974781.7A
Authority: CN
Inventors: 薛青红; 孙淼; 才学鹏; 陈建; 陈延飞; 李岭
Original assignee: China Institute of Veterinary Drug Control
Current assignee: China Institute of Veterinary Drug Control
Priority date: 2019-10-14
Filing date: 2019-10-14
Publication date: 2021-04-30

Abstract

The invention relates to a nucleic acid sequence combination and a gene chip for detecting sheep epidemic diseases, which comprises reaction pore plates, wherein nucleic acid sequences, positive controls, negative controls and blank controls aiming at various sheep epidemic diseases are sampled in each reaction pore; the invention also relates to a detection kit comprising the gene chip.

Description

Gene chip and kit for joint detection of various sheep epidemic diseases

Technical Field

The invention relates to the field of biological assay, in particular to a gene chip detection kit for detecting whether sheep serum or other tissues contain one or more pathogens (of six epidemic diseases), which can be used for epidemiological investigation and auxiliary diagnosis and detection of animal diseases.

Background

The diseases of sheep such as brucellosis, anthrax, foot and mouth disease, sheep pox, aphtha and peste des petits ruminants are very easy to attack, and seriously threaten the development of the livestock industry in China. It is necessary to establish a method for rapidly and efficiently detecting the epidemic diseases of the sheep for preventing and controlling the diseases. The diseases such as brucellosis of sheep, anthrax, foot and mouth disease, sheep pox, aphtha of sheep and peste des petits ruminants are all susceptible to sheep and can be infected through respiratory tract and digestive tract. They can cause emaciation, abortion and even death of the ewes to varying degrees. At present, the detection of the diseases in China mainly comprises pathogen separation, serological tests and molecular biological detection methods. Serological methods include neutralization assays and Elisa. These methods are effective in detecting these diseases, but cannot detect mixed infections of several epidemic diseases simultaneously.

What plays an essential role in gene chips frequently used in the field of bioassays is a gene probe sequence therein, which can be immobilized at a specific position of a solid phase substrate in a reaction well by a spotting instrument to form a microarray. When the detection is carried out, the sample needs to be processed firstly: after extracting nucleic acid from the sample, the nucleic acid is amplified and then incubated with the gene chip so that specific amplification products are bound to the immobilized gene probes on the gene chip. After washing to remove unbound amplification products, horseradish peroxidase-labeled streptavidin (SA-HRP) was added, which formed a complex with the amplification products specifically bound to the gene probes. Finally, unbound SA-HRP is washed away, and a chemochromic substrate TMB is added to generate a bluish purple signal visible to the naked eye, which is scanned and photographed.

The problem that exists among the prior art is that, the epidemic diseases of above-mentioned sheep often merge to take place, under this condition, need use multiple gene chip detect reagent box usually, inefficiency and consume the manual work, take place systematic error easily.

Disclosure of Invention

In order to solve the above problems, the present invention provides:

1. a combination of nucleic acid sequences comprising:

for detecting brucellosis in sheep

SEQ ID NO1:CTGAACCCGGTTATGCCGTACCTCAC

For detecting anthrax 16SRDNA

SEQ ID NO2:ATCCCGAGCAAATGATCCCT

For detecting anthrax POX1 plasmid

SEQ ID NO3:CCGTGACAATGATGGAATCCCT

For detecting foot-and-mouth disease

SEQ ID NO4:TCCTTTGCACGCCGTGGGAC

For detecting sheep pox

SEQ ID NO5:ATGAGCCATCCATTTTCCAACTCT

A be used for detecting sheep aphtha

SEQ ID NO6:TGCATCGAGTTGTAGATCTCGCGGT

For detecting Peste des petits ruminants

SEQ ID NO7:TGGAGGCTAACAACATATTGAACTC。

2. A gene chip, comprising:

a reaction well plate, and

the combination of nucleic acid sequences according to claim 1 or 2 immobilized in each reaction well of the reaction well plate.

3. The gene chip of claim 3, further comprising: and a positive control point, a negative control point and a quality control point which are fixed in each reaction hole of the reaction hole plate.

4. The nucleic acid sequence combination according to claim 1 and the use of the gene chip according to claim 2 or 3 in the preparation of a kit for detecting sheep epidemic diseases.

5. A kit, comprising: the combination of nucleic acid sequences according to claim 1 or the gene chip according to claim 2 or 3.

6. The kit according to claim 5, for detecting the presence or absence of any of brucellosis, anthrax, foot and mouth disease, capripox, aphtha and peste des petits ruminants in a biological sample of biological origin from a subject.

7. The test kit according to claim 5 or 6, wherein the biological sample is whole blood, plasma or serum of sheep.

8. The test kit of claim 5 or 6, further comprising: SSC solution, SDS solution, sodium citrate solution, horseradish peroxidase-labeled streptavidin, TMB solution, amplification primers, and instructions.

9. The test kit according to claim 5 or 6, wherein,

the kit further comprises amplification primers comprising:

for aphtha:

ORFV-F(SEQ ID NO10)：TACACGGAGTTGGCCGTGATCTTGTA

ORFV-R(SEQ ID NO11)：CGCCAAGTACAAGAAGCTGATGA

against brucella melitensis:

Brucella-F(SEQ ID NO12)：GTCAAGCAGGGCTTTGAAGG

Brucella-R(SEQ ID NO13)：CGTCGTCCAAGCCGTTGT

against capripoxvirus:

CapripoxVirus-F(SEQ ID NO14)：TGGGATACATAGTAAGAAAAATCAGG

CapripoxVirus-R(SEQ ID NO15)：CGAAATGAAAAACGGTATATGGAAT

against Peste des petits ruminants:

PPRV-F(SEQ ID NO16)：TCGAGTGGARGTAAGAAAAGG

PPRV-R (SEQ ID NO 17): CGGTGCCGTAACMGCC and

against the anthrax POX1 plasmid:

Anthrax(POX1)-F(SEQ ID NO18)：TCTAGTGATAACTTACAACTGCC

Anthrax(POX1)-R(SEQ ID NO19)：ACCGTATATCCTTCTACCTCT

for anthrax 16 srDNA:

Anthrax(16srDNA)-F(SEQ ID NO20)：ACCCGCAACAATACTCAC

Anthrax(16srDNA)-R(SEQ ID NO21)：

AAAACTACCGATGCCGCTA

for foot-and-mouth disease:

FMDV-F(SEQ ID NO22)：ACTGGGTTTTACAAACCTGTGA

FMDV-R(SEQ ID NO23)：GCGAGTCCTGCCACGGA。

here, the correspondence between the probes for the six diseases mentioned above (wherein anthrax corresponds to two probes) and its abbreviation, and the sequences of the respective gene probes are shown in Table 1 below:

table 1. gene probes used in the sheep epidemic disease joint inspection kit:

technical effects of the invention

The reason for selecting the gene probes for the above six diseases to construct the kit of the present invention is as follows: the diseases of sheep such as brucellosis, anthrax, foot and mouth disease, sheep pox, aphtha and peste des petits ruminants are very easy to attack, and seriously threaten the development of the livestock industry in China. The establishment of a method for rapidly and efficiently detecting the sheep pathogens is necessary for preventing and controlling the diseases. The diseases such as brucellosis of sheep, anthrax, foot and mouth disease, sheep pox, aphtha of sheep and peste des petits ruminants are all susceptible to sheep and can be infected through respiratory tract and digestive tract. In different degrees, the sheep can be emaciated, aborted and even died. At present, the detection of the diseases in China mainly comprises pathogen separation, serological tests and molecular biological detection methods. Serological methods include neutralization assays and Elisa. The methods can effectively detect the diseases, but cannot simultaneously detect the mixed infection of the diseases, have complex experimental process, consume a large amount of manpower and material resources, and have higher requirements on test detection instruments. By adopting the kit, six common epidemic diseases can be detected by using the same kit, the sensitivity is high, and positive results are not interfered with each other; the working efficiency is improved, and the labor cost of detection is reduced.

Detailed Description

Specific embodiments of the present invention will be described in more detail below. While specific embodiments of the invention have been shown, it should be understood that the invention may be embodied in various forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. As one skilled in the art will appreciate, various names may be used to refer to a component. This specification and claims do not intend to distinguish between components that differ in name but not function. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, but is made for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.

In the context of the present specification, brucellosis in sheep (corresponding to gene probe Brucella-P2 in the present specification) refers to a zoonotic chronic infectious disease caused by Brucella. It is characterized by the formation of inflammation, necrosis and granuloma of reproductive organs, fetal membranes and various organ tissues, which cause symptoms of abortion, infertility, testis, arthritis and the like. Various animals have different degrees of susceptibility to the disease, and natural infection is most common in sheep, goats and pigs. Many serological techniques are available for the diagnosis of brucella, and among them, the most widely used serum agglutination test and complement fixation test are also available because of their significance for differential diagnosis. Examples of other serum methods include the tiger red plate agglutination test, the antiglobulin test, and the like. Generally, biological samples are taken from the uterus, vaginal secretions, blood, visceral organs of aborted dams, and aborted fetuses' stomach contents, liver, spleen, lymph nodes, blood for microbiological examination.

In the context of this specification, anthrax (corresponding to gene probes 16srDNA-P1 and PA-P1 in this specification) is caused by Bacillus anthracis and is an acute infectious disease of zoonosis. People become infected by exposure to sick animals and their products, and by eating the meat of the sick animals. Clinically, the symptoms of skin necrosis, ulcer, eschar and extensive edema of peripheral tissues, toxemia and hemorrhagic infiltration of subcutaneous and subplasmic membrane connective tissues are mainly shown; blood coagulation failure, which is coal tar like, occasionally causes acute infections of the lung, intestine and meninges, and may be accompanied by septicemia. Under natural conditions, herbivores are most susceptible and moderately sensitive to humans, and mainly occur to people who have more contact with animal and animal product processing and eat diseased animal meat by mistake. The commonly used detection means include indirect hemagglutination, ELISA (enzyme linked immunosorbent assay), enzyme-labeled SPA, fluorescence immunoassay, etc., which are used for detecting various antibodies in serum, especially capsular antibody and serum anti-toxic antibody, and are generally used for retrospective diagnosis and epidemiological investigation. The Ascoline precipitation test is used when it is difficult to culture bacteria in a rotten or dried specimen. Such as scab of lesion, corpse tissue, blood, skin and hair of infected bacteria and their products, etc. of patient and sick animal, adding water, boiling or high-pressure extracting antigen component and anthrax precipitin serum to make circular precipitation test to indirectly prove the existence of anthrax infection.

In the context of the present specification, foot-and-mouth disease (corresponding gene probe FMDV-P1 in the present specification) is commonly known as "aphtha" and "Pianzaihuang", which is an acute, febrile and highly contagious disease of artiodactyls caused by foot-and-mouth disease virus. It mainly affects artiodactyls, occasionally found in humans and other animals. It is clinically diagnosed as blisters on the oral mucosa, hooves and breast skin. The commonly used detection method is a serological test, ELISA is a diagnosis method which is commonly used for detecting FMDV infection at present, and compared with a knot supplementing test, a neutralization test, an indirect hemagglutination inhibition test and an immunodiffusion precipitation test, the ELISA has the advantages of sensitivity, rapidness, low price and the like.

In the context of this specification, capripox (corresponding to the gene probe: P32-P1 in this specification) is an acute infectious disease, both goats and sheep are susceptible to disease, and mortality of lambs is high after disease. It is mostly infected by sick sheep and dander containing capripoxvirus, which are inhaled into human respiratory tract with wind and dust, and also through injured skin. In the early stage of the disease, the diseased sheep have poor spirit, do not eat or drink, run nasal mucus, drip tears, rise in body temperature and increase in heartbeat and breathing frequency. Small red spots appeared around the nose, eyes and outside lips, vulva, and nipple, etc., and a hard round papule of 3-5 mm in diameter was rapidly formed. After about 6 days, the pimple increases, forming blisters and the body temperature drops slightly. The vacuole becomes a pustule after 2-5 days, and the body temperature rises again, generally lasting for about 2 days. Finally, the pustules dry and turn into black brown crusts. Some diseased sheep may also have limping legs, blindness, cough, diarrhea, etc.

In the context of this specification, aphtha (the corresponding gene probe: ORFV-P3 in this specification) is also called contagious pustule in sheep and goats, and is a contagious infectious disease in sheep and goats caused by viruses, characterized by papules, blisters, pustules and warty scabs formed in the lips, tongue, nose and other areas of the mouth.

In the context of the present specification, peste des petits ruminants (the corresponding gene probe in the present specification: PPRV-N-P1) (PPR) is commonly known as plague, also known as peste des petits ruminants pseudoplague (pseudopetit petits), pneumocystis (pneumoenteritides), and stomatitis-pneumoenteritides complex, is an acute viral infectious disease caused by peste des virus, mainly infecting peste ruminants, characterized by fever, stomatitis, diarrhea, and pneumonia.

In the context of the present application, "sensitivity" is: the minimum concentration of pathogen that is capable of developing a color reaction.

In the context of the present application, the positive control spot is Biotin (Biotin) which is used to monitor the course of the reaction of the chip, and if the operation is normal, color is developed, and if the operation is wrong, no color is developed. The negative control point is probe dilution phosphate Buffer (Buffer).

In the context of the present application, a reaction well plate refers to a substrate of a general gene chip, which is generally made of a chemically stable polymer and divided into a number of reaction wells for parallel testing, and the present application uses a common 48-well reaction well plate.

In the context of the present application, "immobilization" refers to all chemical or physical means which enable the attachment of a specific nucleic acid sequence to the substrate of the gene chip. Common methods are, for example, DNA-hydrogel copolymerization, photochemical in situ immobilization, etc., and the immobilization method used in the present application is chemical in situ immobilization.

Preparation example A

The kit of the present invention may be composed of a plurality of chips, each of which may include a plurality of reaction wells, and particularly, for each well, the probe spotting pattern thereof is shown in the following table 2:

TABLE 2 spotting patterns in each reaction well in the chip

Biotin	Brucella-P2		Buffer
				P32-P1			ORFV-P3
PA-P1		16srDNA-P1	PPRV-N-P1
				C-1	FMDV-P1	FMDV-P1	C-2

Wherein, "Biotin" is a positive control point, "Buffer" is a negative control point, and C-1 and C-2 are quality control points, and specifically, C-1 and C-2 are used for monitoring the PCR process. If C-1 and C-2 do not develop color, the amplification is insufficient, and the detection of negative result is unreliable. If C-1 and C-2 respond sufficiently, the sample probe does not respond, and the negative result of the sample is reliable. Brucella-P2(SEQ ID NO.1), 16srDNA-P1(SEQ ID NO.2), PA-P1(SEQ ID NO.3), FMDV-P1(SEQ ID NO.4), P32-P1(SEQ ID NO.5), ORFV-P3(SEQ ID NO.6) and PPRV-N-P1(SEQ ID NO.7) are gene probes for six epidemic diseases, and respectively represent: brucellosis in sheep, anthrax (16srDNA), anthrax (POX1 plasmid), foot and mouth disease, sheep POX, aphtha, Peste des petits ruminants.

The quality control points C-1 and C-2 are nucleic acid probe sequences, wherein:

c-1 sequence (SEQ ID NO 8): ATTACGGGACCTCTGTACCGATCG

C-2 has the sequence (SEQ ID NO 9): CCTCGAGGTCGCCACCTTGA

The using method of the kit comprises the following steps: first, the sample is processed: after extracting nucleic acids from the sample, the nucleic acids are amplified: amplifying the same sample twice, the first time simultaneously amplifying with a pair of primers Brucella-F and Brucella-R, a pair of primers ORFV-F and ORFV-R, a pair of primers Capripox Virus-F and Capripox Virus-R, and a pair of primers PPRV-F and PPRV-R, the second time simultaneously amplifying with a pair of primers Anthrax (POX1) -F and Anthrax (POX1) -R, a pair of primers Anthrax (16srDNA) -F and Anthrax (16srDNA) -F, and a pair of primers FMDV-F and FMDV-R; specifically, two tubes of primers are used for amplifying the same sample, and 20 mu L of each tube is taken; the amplification reaction is then incubated with the chip to allow specific amplification products to bind to the immobilized probes on the chip. After washing to remove unbound amplification products, horseradish peroxidase-labeled streptavidin (SA-HRP) was added, which formed a complex with the amplification products specifically bound to the probe. Finally, unbound SA-HRP is washed away, and a chemochromic substrate TMB is added to generate a bluish purple signal visible to the naked eye, which is scanned and photographed. The specific operation steps are that after the extraction of nucleic acid and amplification, the following steps are carried out:

1. chip hybridization

mu.L of each PCR product was added to 80. mu.L of solution A (100mL of 20 XSSC, 10mL of 10% SDS and 1000mL of purified water), i.e., a hybridization solution, and mixed well in a boiling water bath for 5 min. The chip was placed in a well plate incubator and preheated at 47 ℃. The denatured PCR product was added to the chip. Reacting at 47 ℃ and 200r/min for 20 min.

2. Chip washing

The solution B (20mL of 20 XSSC, 10mL of 10% SDS and pure water to 1000mL) preheated at 47 ℃ is washed three times by 200. mu.L per well, and washed for 10min by a 47 ℃ well plate incubator.

3. SA-HRP reaction

Solution A, SA-HRP diluted at 2000. mu.L/well, 200r/min, reacted at 47 ℃ for 10 min.

4. Color development

The solution A is leached at room temperature for 2 times, the solution C (100mL of 1M sodium citrate added with pure water to reach the volume of 1000mL) is leached at room temperature for 2 times, and 60 mu L/hole of TMB is added for direct color development.

5. Determination of results

The color of the negative quality control point should not be developed, the color of the positive quality control point is blue-violet which is obviously stronger than that of the negative quality control point, and at least one developed or dark or light blue-violet of the two positive quality control points is an effective experimental result.

TABLE 3 primer sequences used in carrying out the amplification reactions:

primer name	5’-3’	5' end modification
			ORFV-F(SEQ IDNO10)	TACACGGAGTTGGCCGTGATCTTGTA	/
ORFV-R(SEQ IDNO11)	Biotin-CGCCAAGTACAAGAAGCTGATGA	Biotin
			Brucella-F(SEQ IDNO12)	GTCAAGCAGGGCTTTGAAGG	/
Brucella-R(SEQ IDNO13)	Biotin-CGTCGTCCAAGCCGTTGT	Biotin
			CapripoxVirus-F(SEQ IDNO14)	TGGGATACATAGTAAGAAAAATCAGG	/
CapripoxVirus-R(SEQ IDNO15)	Biotin-CGAAATGAAAAACGGTATATGGAAT	Biotin
			PPRV-F(SEQ IDNO16)	Biotin-TCGAGTGGARGTAAGAAAAGG	Biotin
PPRV-R(SEQ IDNO17)	CGGTGCCGTAACMGCC	/
			Anthrax(POX1)-F(SEQ IDNO18)	TCTAGTGATAACTTACAACTGCC	/
Anthrax(POX1)-R(SEQ IDNO19)	Biotin-ACCGTATATCCTTCTACCTCT	Biotin
			Anthrax(16srDNA)-F(SEQ IDNO20)	ACCCGCAACAATACTCAC	/
Anthrax(16srDNA)-R(SEQ IDNO21)	Biotin-AAAACTACCGATGCCGCTA	Biotin
			FMDV-F(SEQ IDNO22)	ACTGGGTTTTACAAACCTGTGA	/
FMDV-R(SEQ IDNO23)	Biotin-GCGAGTCCTGCCACGGA	Biotin

The spotting of the probes was carried out in a single well as described in the above section, and specifically, the kit comprised a gene chip and an attachment, the single gene chip was a 6X 8 48-well reaction plate, and the attachment was provided for each gene chip as shown in Table 4 below:

TABLE 4 Accessories in the kit other than the chip

Experimental example A1 Using the Gene chip kit A of the present invention to detect serum of sheep infected with Brucella melitensis

The kit of the embodiment A is used for detecting the serum of the sheep infected with the brucellosis of the sheep, and the detection result shows that: positive brucellosis in sheep.

Experimental example A2 serum of sheep infected with sheep pox was detected using the Gene chip kit A of the present invention

The kit of example A and the serum of sheep infected with sheep pox are used for detection, and the detection result shows that: and (5) positive tuberculosis.

Experimental example A3 detection of anthrax-infected sheep serum Using the Gene chip kit A of the present invention

The kit of example A and the serum of sheep infected with anthrax are used for detection, and the detection result shows that: anthrax was positive for both the 16srDNA and POX1 plasmids.

Experimental example A4 serum of sheep infected with foot-and-mouth disease was detected using the Gene chip kit A of the present invention

The kit of the embodiment A and the serum of the sheep infected with the foot-and-mouth disease are used for detection, and the detection result shows that: positive for foot and mouth disease.

Experimental example A5 detection of goat serum infected with aphtha Using the Gene chip kit A of the present invention

The kit of example A and the serum of sheep infected with aphtha are used for detection, and the detection result shows that: and the goat aphtha is positive.

Experimental example A6 serum of sheep infected with Peste des petits ruminants was detected using the Gene chip kit A of the present invention

The kit of example A and the serum of sheep infected with Peste des petits ruminants were used for detection, and the detection results show that: peste des petits ruminants is positive.

Experimental example A7 Using the Gene chip kit A of the present invention, serum of sheep infected with both sheep pox and anthrax was detected

The kit of the embodiment A and the serum of the sheep infected with tuberculosis and anthrax at the same time are used for detection, and the detection result shows that: capripox, anthrax 16srDNA and POX1 were all positive.

Experimental example A8 serum of healthy sheep was detected using the Gene chip kit A of the present invention

Sera from healthy sheep were tested using the kit of example a with the following results: six kinds of epidemic diseases to be detected are all negative.

Comparative example D7 detection of serum of sheep infected with both sheep pox and anthrax Using the Gene chip kit of the prior art

The kit in the prior art is used for detecting sheep serum infected with sheep pox and anthrax simultaneously, and the detection result is as follows: the three kits, capripox, anthrax 16srDNA and POX1, showed positive sensitivity similar to that of Experimental example A8, but the experiment was more time-consuming and reagent-consuming.

The experimental results of eight experimental examples and one comparative example are summarized in table 5 below:

TABLE 5 summary of the experimental examples and comparative examples

While embodiments of the present invention have been described above, the present invention is not limited to the specific embodiments and applications described above, which are intended to be illustrative, instructive, and not limiting. Those skilled in the art, having the benefit of this disclosure, may effect numerous modifications thereto without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> China institute for veterinary drug inspection

<120> gene chip and kit for joint detection of various sheep epidemic diseases

<130> PB00292

<141> 2019-10-14

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 1

ctgaacccgg ttatgccgta cctcac 26

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

atcccgagca aatgatccct 20

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 3

ccgtgacaat gatggaatcc ct 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

tcctttgcac gccgtgggac 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 5

atgagccatc cattttccaa ctct 24

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 6

tgcatcgagt tgtagatctc gcggt 25

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 7

tggaggctaa caacatattg aactc 25

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 8

attacgggac ctctgtaccg atcg 24

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

cctcgaggtc gccaccttga 20

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 10

tacacggagt tggccgtgat cttgta 26

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 11

cgccaagtac aagaagctga tga 23

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

gtcaagcagg gctttgaagg 20

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 13

cgtcgtccaa gccgttgt 18

<210> 14

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 14

tgggatacat agtaagaaaa atcagg 26

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 15

cgaaatgaaa aacggtatat ggaat 25

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 16

tcgagtggar gtaagaaaag g 21

<210> 17

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 17

cggtgccgta acmgcc 16

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 18

tctagtgata acttacaact gcc 23

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 19

accgtatatc cttctacctc t 21

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 20

acccgcaaca atactcac 18

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 21

aaaactaccg atgccgcta 19

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 22

actgggtttt acaaacctgt ga 22

<210> 23

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 23

gcgagtcctg ccacgga 17

Claims

1. A combination of nucleic acid sequences comprising:

for detecting brucellosis in sheep

SEQ ID NO1:CTGAACCCGGTTATGCCGTACCTCAC

For detecting anthrax 16SRDNA

SEQ ID NO2:ATCCCGAGCAAATGATCCCT

For detecting anthrax POX1 plasmid

SEQ ID NO3:CCGTGACAATGATGGAATCCCT

For detecting foot-and-mouth disease

SEQ ID NO4:TCCTTTGCACGCCGTGGGAC

For detecting sheep pox

SEQ ID NO5:ATGAGCCATCCATTTTCCAACTCT

A be used for detecting sheep aphtha

SEQ ID NO6:TGCATCGAGTTGTAGATCTCGCGGT

For detecting Peste des petits ruminants

SEQ ID NO7:TGGAGGCTAACAACATATTGAACTC。

2. A gene chip, comprising:

a reaction well plate, and

9. The test kit according to claim 5 or 6, wherein,

the kit further comprises amplification primers comprising:

a first primer set:

ORFV-F(SEQ ID NO10)：TACACGGAGTTGGCCGTGATCTTGTA

ORFV-R(SEQ ID NO11)：CGCCAAGTACAAGAAGCTGATGA

Brucella-F(SEQ ID NO12)：GTCAAGCAGGGCTTTGAAGG

Brucella-R(SEQ ID NO13)：CGTCGTCCAAGCCGTTGT

CapripoxVirus-F(SEQ ID NO14)：

TGGGATACATAGTAAGAAAAATCAGG

CapripoxVirus-R(SEQ ID NO15)：

CGAAATGAAAAACGGTATATGGAAT

PPRV-F(SEQ ID NO16)：TCGAGTGGARGTAAGAAAAGG

PPRV-R (SEQ ID NO 17): CGGTGCCGTAACMGCC and

a second primer set:

Anthrax(POX1)-F(SEQ ID NO18)：TCTAGTGATAACTTACAACTGCC

Anthrax(POX1)-R(SEQ ID NO19)：ACCGTATATCCTTCTACCTCT

Anthrax(16srDNA)-F(SEQ ID NO20)：

ACCCGCAACAATACTCAC

Anthrax(16srDNA)-R(SEQ ID NO21)：

AAAACTACCGATGCCGCTA

FMDV-F(SEQ ID NO22)：ACTGGGTTTTACAAACCTGTGA

FMDV-R(SEQ ID NO23)：GCGAGTCCTGCCACGGA。