CN111808986A - Gene chip and kit for joint detection of various bovine epidemic diseases - Google Patents

Abstract

The invention relates to a nucleic acid sequence and a gene chip for detecting cattle epidemic diseases, which comprises reaction pore plates, wherein nucleic acid sequences, positive controls, negative controls and blank controls aiming at the cattle epidemic diseases are sampled in each reaction pore; the invention also relates to a detection kit comprising the gene chip.

Description

Gene chip and kit for joint detection of various bovine epidemic diseases

Technical Field

The invention relates to the field of biological assay, in particular to a gene chip detection kit for detecting whether the serum or other tissues of cattle contain one or more pathogens (among seven epidemic diseases), which can be used for epidemiological investigation and auxiliary diagnosis and detection of animal diseases.

Background

The diseases of cattle such as brucellosis, tuberculosis, anthrax, foot-and-mouth disease, viral diarrhea and mucous membrane disease, parainfluenza and infectious rhinotracheitis are very easy to attack, and seriously threaten the development of the livestock industry in China. It is necessary to establish a method for rapidly and efficiently detecting the diseases of the cattle for prevention and control of the diseases. Cattle are susceptible to Brucella, tuberculosis, anthrax, FMDV, BVDV, BPIV3 and IBDV, and can be infected through respiratory tract and digestive tract. In different degrees, cattle can be emaciated, cows can be aborted and even die. At present, the detection of the diseases in China mainly comprises pathogen separation, serological tests and molecular biological detection methods. Serological methods include neutralization assays and Elisa. These methods are effective in detecting these diseases, but cannot detect mixed infections of several pathogens simultaneously.

What plays an essential role in gene chips frequently used in the field of bioassays is a gene probe sequence therein, which can be immobilized at a specific position of a solid phase substrate in a reaction well by a spotting instrument to form a microarray. When the detection is carried out, the sample needs to be processed firstly: after extracting nucleic acid from the sample, the nucleic acid is amplified and then incubated with the gene chip so that specific amplification products are bound to the immobilized gene probes on the gene chip. After washing to remove unbound amplification products, horseradish peroxidase-labeled streptavidin (SA-HRP) was added, which formed a complex with the amplification products specifically bound to the gene probes. Finally, unbound SA-HRP is washed away, and a chemochromic substrate TMB is added to generate a bluish purple signal visible to the naked eye, which is scanned and photographed.

The problems existing in the prior art are that the epidemic diseases of the cattle often occur together, under the condition, a plurality of gene chip detection kits are generally needed, the efficiency is low, the labor is consumed, and the system error is easy to occur.

Disclosure of Invention

In order to solve the above problems, the present invention provides:

1. a combination of nucleic acid sequences comprising:

for detecting brucellosis in cattle

SEQ ID NO1:CTGAACCCGGTTATGCCGTACCTCAC

For detecting anthrax 16SRDNA

SEQ ID NO2:ATCCCGAGCAAATGATCCCT

For detecting anthrax POX1 plasmid

SEQ ID NO3:TCCAGCACTTGTACTTCGCTT

For detecting foot-and-mouth disease

SEQ ID NO4:ACGCCGTGGGACCATACAGGA

For detecting infectious bovine rhinotracheitis

SEQ ID NO5:CTCGCGGAGCTGGAGGTGATCAG

For detecting bovine viral diarrhea mucosal disease

SEQ ID NO6:CATGCCCAAAGCACATCTTAACCT

For detecting bovine parainfluenza

SEQ ID NO7:TTTAGGACATTCGCCACAC。

2. The nucleic acid sequence combination of item 1, further comprising:

for detecting bovine tuberculosis

SEQ ID NO8:CATCAGCCTGGCCGCACGAGTTA。

3. A gene chip, comprising:

a reaction well plate, and

the combination of nucleic acid sequences according to item 1 or 2 immobilized in each reaction well of the reaction well plate.

4. The gene chip according to item 3, further comprising: and a positive control point, a negative control point and a quality control point which are fixed in each reaction hole of the reaction hole plate.

5. Use of the nucleic acid sequence combination according to item 1 or 2 and the gene chip according to item 3 or 4 in the preparation of a kit for detecting bovine plague.

6. A kit, comprising:

the combination of nucleic acid sequences according to item 1 or 2 or the gene chip according to item 3 or 4.

7. The kit according to item 6, which is used for detecting the presence or absence of any disease of bovine brucellosis, anthrax, foot-and-mouth disease, infectious bovine rhinotracheitis, bovine viral diarrhea mucosis and bovine parainfluenza in a biological sample of a subject biological origin.

8. The test kit according to item 6 or 7, wherein the biological sample is bovine whole blood, plasma or serum.

9. The detection kit according to item 6 or 7, further comprising: SSC solution, SDS solution, sodium citrate solution, horseradish peroxidase-labeled streptavidin solution, TMB solution, amplification primers, and instructions.

10. The detection kit according to item 6 or 7, wherein,

the kit further comprises amplification primers comprising:

a first primer set:

MTB-F(SEQ ID NO.11)：CTCTGAAATTCGCCTCTGTAGTGC

MTB-R(SEQ ID NO.12)：CATCTTGCTTCGGCGTGTTCC

BPIV3-F(SEQ ID NO.13)：ATCTGCAGCAAAATTAGACC

BPIV3-R(SEQ ID NO.14)：ACTCCWATCATTAGACCTGCTA

Brucella-F(SEQ ID NO.19)：GTCAAGCAGGGCTTTGAAGG

Brucella-R(SEQ ID NO.20)：CGTCGTCCAAGCCGTTGT

IBRV-F(SEQ ID NO.21)：TTGGCGCGGACTACGTGTA

IBRV-R(SEQ ID NO.22)：CCGTGAGGTTTAGGTCCACAA

BVDV-F(SEQ ID NO.23)：AGTCGTCARTGGTTCGA

BVDV-R (SEQ ID NO. 24): ARCACCCTATCAGGCTGT, respectively; and

a second primer set:

Anthrax(POX1)-F(SEQ ID NO15):TTCTAGTGATAACTTACAACTGCC

Anthrax(POX1)-R(SEQ ID NO.16)：TTCCATCATTGTCACGGTCT

16srDNA-F(SEQ ID NO.17)：ACCCGCAACAATACTCAC

16srDNA-R(SEQ ID NO.18)：AAAACTACCGATGCCGCTA

FMDV-F(SEQ ID NO.25)：TACAAACCTGTGATGGCTTC

FMDV-R(SEQ ID NO.26)：TGCCACGGAGATCAACT。

the correspondence between the probes for the seven diseases mentioned above (wherein anthrax corresponds to two probes) and its english abbreviation, and the sequences of the respective gene probes are shown in table 1 below:

table 1. genetic probes used in the bovine plague joint inspection kit:

technical effects of the invention

The reason for selecting the gene probes for the above seven diseases to construct the kit of the present invention is as follows: bovine brucellosis, tuberculosis, anthrax, foot and mouth disease, viral diarrhea mucosis, parainfluenza and infectious rhinotracheitis are easy to attack, and seriously threaten the development of livestock husbandry industry in China. It is necessary to establish a method for rapidly and efficiently detecting the bovine pathogens for the prevention and control of the diseases. Cattle are susceptible to Brucella, tuberculosis, anthrax, FMDV, BVDV, BPIV3 and IBDV, and can be infected through respiratory tract and digestive tract. In different degrees, cattle can be emaciated, cows can be aborted and even die. At present, the detection of the diseases in China mainly comprises pathogen separation, serological tests and molecular biological detection methods. Serological methods include neutralization assays and Elisa. The methods can effectively detect the diseases, but cannot simultaneously detect the mixed infection of the diseases, have complex experimental process, consume a large amount of manpower and material resources, and have higher requirements on test detection instruments. By adopting the kit, the seven common epidemic diseases are detected by using the same kit, the sensitivity is high, and positive results are not interfered with each other; the working efficiency is improved, and the labor cost of detection is reduced.

Detailed Description

Specific embodiments of the present invention will be described in more detail below. While specific embodiments of the invention have been shown, it should be understood that the invention may be embodied in various forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. As one skilled in the art will appreciate, various names may be used to refer to a component. This specification and claims do not intend to distinguish between components that differ in name but not function. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, but is made for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.

Herein, in the present invention, brucellosis (the corresponding gene probe Brucella-P1 in the present application) refers to a chronic infectious disease of zoonosis caused by Brucella. It is characterized by the formation of inflammation, necrosis and granuloma of reproductive organs, fetal membranes and various organ tissues, which cause symptoms of abortion, infertility, testis, arthritis and the like. Various animals have different degrees of susceptibility to the disease, and natural infection is common to sheep, cattle and pigs. Many serological techniques are available for the diagnosis of brucella, and among them, the most widely used serum agglutination test and complement fixation test are also available because of their significance for differential diagnosis. Other serum methods include, for example, the tiger red plate agglutination test, the antiglobulin test. Generally, biological samples are taken from the uterus, vaginal secretions, blood, visceral organs of aborted dams, and aborted fetuses' stomach contents, liver, spleen, lymph nodes, blood for microbiological examination.

Here, anthrax (corresponding gene probes 16srDNA-P1 and PA-P1 in this application) is caused by Bacillus anthracis, an acute infectious disease of zoonosis. People become infected by exposure to sick animals and their products, and by eating the meat of the sick animals. Clinically, the symptoms of skin necrosis, ulcer, eschar and extensive edema of peripheral tissues, toxemia and hemorrhagic infiltration of subcutaneous and subplasmic membrane connective tissues are mainly shown; blood coagulation failure, which is coal tar like, occasionally causes acute infections of the lung, intestine and meninges, and may be accompanied by septicemia. Under natural conditions, herbivores are most susceptible and moderately sensitive to humans, and mainly occur to people who have more contact with animal and animal product processing and eat diseased animal meat by mistake. The commonly used detection means include indirect hemagglutination, ELISA (enzyme linked immunosorbent assay), enzyme-labeled SPA, fluorescence immunoassay, etc., which are used for detecting various antibodies in serum, especially capsular antibody and serum anti-toxic antibody, and are generally used for retrospective diagnosis and epidemiological investigation. The Ascoline precipitation test is used when it is difficult to culture bacteria in a rotten or dried specimen. Such as scab of lesion, corpse tissue, blood, skin and hair of infected bacteria and their products, etc. of patient and sick animal, adding water, boiling or high-pressure extracting antigen component and anthrax precipitin serum to make circular precipitation test to indirectly prove the existence of anthrax infection.

Herein, foot-and-mouth disease (corresponding gene probe FMDV-P1 in the present application) is commonly known as "aphtha" and "Pianhuang", which is an acute, hot, highly contagious infectious disease of artiodactyls caused by foot-and-mouth disease virus. It mainly affects artiodactyls, occasionally found in humans and other animals. Clinical diagnosis is characterized by blisters on the oral mucosa, hooves and breast skin. The commonly used detection method is a serological test, ELISA is a diagnosis method which is commonly used for detecting FMDV infection at present, and compared with a knot supplementing test, a neutralization test, an indirect hemagglutination inhibition test and an immunodiffusion precipitation test, the ELISA has the advantages of sensitivity, rapidness, low price and the like.

Here, infectious bovine rhinotracheitis (corresponding gene probe IBRV-P1 in the present application), also known as "necrotic rhinitis" or "red nose disease", is a bovine respiratory infectious disease caused by bovine herpes virus type I (BHV-1). The clinical manifestations are various, mainly respiratory tract, accompanied by conjunctivitis, abortion, mastitis, and sometimes induced encephalitis in calves. The diagnosis needs to be confirmed by means of laboratory diagnosis, including virus isolation identification and serological tests. Common methods for detecting BHV1 antibodies in serum samples are virus neutralization assay (VN) and various enzyme-linked immunosorbent assays (ELISA). In addition, there are agar diffusion tests and indirect hemagglutination tests.

Here, bovine viral diarrhea/mucosal disease (corresponding gene probe BVDV-P1 in the present application) is an infectious disease caused by viruses, and cattle of various ages are susceptible to infection, and the susceptibility is highest among young cattle. The infection source is mainly diseased livestock. The secretion, excretion, blood and spleen of cattle contain virus and are transmitted by direct contact or indirect contact. The BVD virus and classical swine fever virus have cross reaction in agar diffusion test, neutralization test and immunofluorescence test, and the two viruses may contain common soluble antigen. After the BVD virus is used for inoculating pigs, the immunity to the low-toxicity classical swine fever virus can be generated, but the attack of a virulent strain cannot be resisted. The BVD virus and the sheep boundary disease virus also have cross reaction in agar diffusion test, neutralization test and immunofluorescence test.

Here, bovine parainfluenza (corresponding gene probe BPIV3-P1 in the present application), also called heat of transport, is an acute respiratory infectious disease. Characterized by invasion of respiratory organs causing hyperthermia, dyspnea and cough. The pathogen is bovine parainfluenza virus type 3. The disease is worsened in cases secondary to pasteurella. The main infection source of the sick cattle is discharged from the sick cattle through the respiratory tract to infect the healthy cattle. Adverse factors such as sudden weather change, cold and fatigue during long-distance transportation can promote the onset of diseases, so the diseases are mostly caused in late autumn and winter. Generally, the incubation period is about 2-5 days, and sick cows have high fever, depression, anorexia, cough, liquid nasal discharge, dyspnea and snore. Wet rale can be heard during auscultation, chest rubbing sounds can be heard sometimes, and mucous diarrhea can occur in some sick cattle. The serious patient can die within hours or 3-4 days.

Herein, bovine tuberculosis (corresponding to a gene probe Mycobacterium bovis in the present application) is a chronic infectious disease of zoonosis caused by Mycobacterium bovis, and is classified as two types of animal diseases in China. Characterized by tuberculous granuloma and caseous, calcified necrotic lesions of the tissue and organ. OIE ranks it as a class B epidemic. In international trade, the diagnostic method is designated as tuberculin test, and there is currently no alternative diagnostic method.

In the context of the present application, "sensitivity" is: the minimum concentration of pathogen that is capable of developing a color reaction.

In the context of the present application, the positive control spot is Biotin (Biotin) which is used to monitor the course of the reaction of the chip, and if the operation is normal, color is developed, and if the operation is wrong, no color is developed. The negative control point is probe dilution phosphate Buffer (Buffer).

In the context of the present application, a reaction well plate refers to a substrate of a general gene chip, which is generally made of a chemically stable polymer and divided into a number of reaction wells for parallel testing, and the present application uses a common 48-well reaction well plate.

In the context of the present application, "immobilization" refers to all chemical or physical means which enable the attachment of a specific nucleic acid sequence to the substrate of the gene chip. Common methods are, for example, DNA-hydrogel copolymerization, photochemical in situ immobilization, etc., and the immobilization method used in the present application is chemical in situ immobilization.

Example A

The kit of the present invention may be composed of a plurality of chips, each chip may comprise a plurality of reaction wells, and for each well, the probe spotting pattern thereof is shown in the following table 2:

TABLE 2 spotting patterns in each reaction well in the chip

Biotin		MTB	Buffer
				BPIV3		Anthrax-pox1	Anthrax-16srDNA
	Brucella	IBRV	BVDV
				IC-1		FMDV	IC-2

Wherein, "Biotin" is a positive control point, "Buffer" is a negative control point, and IC-1 and IC-2 are quality control points, specifically, IC-1 and IC-2 are used for monitoring the PCR process. If IC-1 and IC-2 do not develop color, the amplification is insufficient, and the detection of negative result is unreliable. If the IC-1 and the IC-2 respond sufficiently, the sample probe does not respond, and the negative result of the sample is reliable. Brucella-P1(SEQ ID No.1), Anthrax-16srDNA (SEQ ID No.2), Anthrax-pox1(SEQ ID No.3), FMDV-P1(SEQ ID No.4), IBRV-P1(SEQ ID No.5), BVDV-P1(SEQ ID No.6), BPIV3-P1(SEQ ID No.7) and Mycobacterium bovis (SEQ ID No.8) are probes for seven diseases, representing respectively: brucellosis in cattle, anthrax (16srDNA), anthrax (POX1 plasmid), foot and mouth disease, infectious bovine rhinotracheitis, bovine viral diarrhea mucosis, bovine parainfluenza, and bovine tuberculosis.

The quality control points IC-1 and IC-2 are nucleic acid probe sequences, wherein:

IC-1 sequence (SEQ ID NO 9): ATTACGGGACCTCTGTACCGATCG

IC-2 has the sequence (SEQ ID NO 10): CCTCGAGGTCGCCACCTTGA

The using method of the kit comprises the following steps: first, the sample is processed: after extracting nucleic acids from the sample, the nucleic acids are amplified: amplifying the same sample twice, namely, simultaneously amplifying by using a pair of primers of Brucella-F and Brucella-R, a pair of primers of MTB-F and MTB-R, a pair of primers of BVDV-F and BVDV-R, a pair of primers of BPIV3-F and BPIV3-R, and a pair of primers of IBRV-F and IBRV-R for the first time, and simultaneously amplifying by using POX1 (namely Anthrax (POX1) -F and Anthrax (POX1) -R), 16SrDNA primers (16srDNA-F and 16 srDNA-R) and FMDV primers (FMDV and FMDV-F and FMDV-R) for the second time, wherein the same sample is amplified by using two tube primers, and 20 mu L of each tube is taken; the amplification reaction is then incubated with the chip to allow specific amplification products to bind to the immobilized probes on the chip. After washing to remove unbound amplification products, horseradish peroxidase-labeled streptavidin (SA-HRP) was added, which formed a complex with the amplification products specifically bound to the probe. Finally, unbound SA-HRP is washed away, and a chemochromic substrate TMB is added to generate a bluish purple signal visible to the naked eye, which is scanned and photographed. The specific operation steps are that after the extraction of nucleic acid and amplification, the following steps are carried out:

1. chip hybridization

mu.L of each PCR product was added to 80. mu.L of solution A (100mL of 20 XSSC, 10mL of 10% SDS and 1000mL of purified water), i.e., a hybridization solution, and mixed well in a boiling water bath for 5 min. The chip was placed on a well plate incubator and preheated at 47 ℃. The denatured PCR product was added to the chip. Reacting at 47 ℃ and 200r/min for 20 min.

2. Chip washing

The solution B (20mL of 20 XSSC, 10mL of 10% SDS and pure water to 1000mL) preheated at 47 ℃ is washed three times by 200. mu.L per well, and washed for 10min by a 47 ℃ well plate incubator.

3. SA-HRP reaction

Solution A, SA-HRP diluted at 2000. mu.L/well, 200r/min, reacted at 47 ℃ for 10 min.

4. Color development

The solution A is leached at room temperature for 2 times, the solution C (100mL of 1M sodium citrate added with pure water to reach the volume of 1000mL) is leached at room temperature for 2 times, and 60 mu L/hole of TMB is added for direct color development.

5. Determination of results

The color of the negative quality control point should not be developed, the color of the positive quality control point is blue-violet which is obviously stronger than that of the negative quality control point, and at least one developed or dark or light blue-violet of the two positive quality control points is an effective experimental result.

TABLE 3 primer sequences used in carrying out the amplification reactions:

the spotting of the probes was carried out in the single well as described in the above section, and specifically, the kit comprised a gene chip and an attachment, the single gene chip was a 6X 8 48-well reaction plate, and the attachment was provided for each gene chip as shown in Table 4 below:

TABLE 4 Accessories in the kit other than the chip

Experimental example A1 detection of bovine serum infected with Brucella

The kit of the embodiment A is used for detecting the serum of the cattle infected with the brucellosis of the cattle, and the detection result shows that: positive for brucellosis in cattle.

Experimental example A2 detection of bovine serum infected with tuberculosis Using the Gene chip kit A of the present invention

The kit of example A and the serum of cattle infected with tuberculosis are used for detection, and the detection result shows that: and (5) positive tuberculosis.

Experimental example A3 detection of serum from cattle infected with anthrax Using the Gene chip kit A of the present invention

The kit of example A and the serum of cattle infected with anthrax are used for detection, and the detection result shows that: anthrax was positive for both the 16srDNA and POX1 plasmids.

Experimental example A4 detection of serum of cattle infected with foot-and-mouth disease Using the Gene chip kit A of the present invention

The kit of the embodiment A and the serum of the cattle infected with the foot-and-mouth disease are used for detection, and the detection result shows that: positive for foot and mouth disease.

Experimental example A5 Using the Gene chip kit A of the present invention, serum of cattle infected with viral diarrhea mucosal disease was detected

The kit of the embodiment A and the serum of the cattle infected with the viral diarrhea mucosis are used for detection, and the detection result shows that: positive viral diarrhea mucosis.

Experimental example A6 detection of parainfluenza-infected bovine serum Using the Gene chip kit A of the present invention

The kit of example A and the serum of cattle infected with parainfluenza are used for detection, and the detection result shows that: positive for parainfluenza.

Experimental example A7 serum of cattle infected with infectious rhinotracheitis was detected using the Gene chip kit A of the present invention

Using the kit of example A and the serum of cattle infected with infectious rhinotracheitis, the detection results show that: infectious rhinotracheitis positive.

Experimental example A8 Using the Gene chip kit A of the present invention, bovine serum infected with tuberculosis and anthrax simultaneously was detected

The kit of the embodiment A and the serum of the cattle infected with tuberculosis and anthrax are used for detection, and the detection result shows that: tuberculosis, anthrax 16srDNA and POX1 were all positive.

Experimental example A9 serum of healthy bovine was detected using the Gene chip kit A of the present invention

Sera from healthy cattle were tested using the kit of example a with the following results: seven kinds of epidemic diseases to be detected are negative.

Comparative example D8 detection of bovine serum infected with tuberculosis and Strong anthrax Using the Gene chip kit of the prior art

The kit in the prior art is used for detecting the serum of the cattle infected with tuberculosis and anthrax at the same time, and the detection result is as follows: the three kits, tuberculosis, anthrax 16srDNA and POX1, showed positive results, respectively, with sensitivity similar to that of Experimental example A8, but the experiment was more time-consuming and reagent-consuming.

The experimental results of ten experimental examples and one comparative example are summarized in table 5 below:

TABLE 5 summary of the experimental examples and comparative examples

While embodiments of the present invention have been described above, the present invention is not limited to the specific embodiments and applications described above, which are intended to be illustrative, instructive, and not limiting. Those skilled in the art, having the benefit of this disclosure, may effect numerous modifications thereto without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> China institute for veterinary drug inspection

<120> gene chip and kit for joint detection of various bovine epidemic diseases

<130>PB00291

<141>2019-04-11

<160>26

<170>SIPOSequenceListing 1.0

<210>1

<211>26

<212>DNA

<213>Artificial Sequence

<400>1

ctgaacccggttatgccgtacctcac 26

<210>2

<211>20

<212>DNA

<213>Artificial Sequence

<400>2

atcccgagcaaatgatccct 20

<210>3

<211>22

<212>DNA

<213>Artificial Sequence

<400>3

tccagcacttgtacttcgctt 22

<210>4

<211>20

<212>DNA

<213>Artificial Sequence

<400>4

acgccgtgggaccatacagga 20

<210>5

<211>25

<212>DNA

<213>Artificial Sequence

<400>5

ctcgcggagctggaggtgatcag 25

<210>6

<211>24

<212>DNA

<213>Artificial Sequence

<400>6

catgcccaaagcacatcttaacct 24

<210>7

<211>25

<212>DNA

<213>Artificial Sequence

<400>7

tttaggacattcgccacac 25

<210>8

<211>23

<212>DNA

<213>Artificial Sequence

<400>8

catcagcctggccgcacgagtta 23

<210>9

<211>24

<212>DNA

<213>Artificial Sequence

<400>9

attacgggac ctctgtaccg atcg 24

<210>10

<211>20

<212>DNA

<213>Artificial Sequence

<400>10

cctcgaggtc gccaccttga 20

<210>11

<211>24

<212>DNA

<213>Artificial Sequence

<400>11

ctctgaaatt cgcctctgta gtgc 24

<210>12

<211>21

<212>DNA

<213>Artificial Sequence

<400>12

catcttgctt cggcgtgttc c 21

<210>13

<211>20

<212>DNA

<213>Artificial Sequence

<400>13

atctgcagca aaattagacc 20

<210>14

<211>22

<212>DNA

<213>Artificial Sequence

<400>14

actccwatca ttagacctgc ta 22

<210>15

<211>24

<212>DNA

<213>Artificial Sequence

<400>15

ttctagtgat aacttacaac tgcc 24

<210>16

<211>20

<212>DNA

<213>Artificial Sequence

<400>16

ttccatcatt gtcacggtct 20

<210>17

<211>18

<212>DNA

<213>Artificial Sequence

<400>17

acccgcaaca atactcac 18

<210>18

<211>19

<212>DNA

<213>Artificial Sequence

<400>18

aaaactaccg atgccgcta 19

<210>19

<211>20

<212>DNA

<213>Artificial Sequence

<400>19

gtcaagcagg gctttgaagg 20

<210>20

<211>18

<212>DNA

<213>Artificial Sequence

<400>20

cgtcgtccaa gccgttgt 18

<210>21

<211>19

<212>DNA

<213>Artificial Sequence

<400>21

ttggcgcgga ctacgtgta 19

<210>22

<211>21

<212>DNA

<213>Artificial Sequence

<400>22

ccgtgaggtt taggtccaca a 21

<210>23

<211>17

<212>DNA

<213>Artificial Sequence

<400>23

agtcgtcart ggttcga 17

<210>24

<211>18

<212>DNA

<213>Artificial Sequence

<400>24

arcaccctat caggctgt 18

<210>25

<211>20

<212>DNA

<213>Artificial Sequence

<400>25

tacaaacctg tgatggcttc 20

<210>26

<211>17

<212>DNA

<213>Artificial Sequence

<400>26

tgccacggag atcaact 17

Claims (10)

1. A combination of nucleic acid sequences comprising:

SEQ ID NO1: CTGAACCCGGTTATGCCGTACCTCAC for detecting brucellosis in cattle

SEQ ID NO2: ATCCCGAGCAAATGATCCCT for detection of anthrax 16SRDNA

SEQ ID NO3: TCCAGCACTTGTACTTCGCTT for detecting anthrax POX1 plasmid

SEQ ID NO4: ACGCCGTGGGACCATACAGGA for detection of foot and mouth disease

SEQ ID NO5: CTCGCGGAGCTGGAGGTGATCAG for detecting infectious bovine rhinotracheitis

SEQ ID NO6: CATGCCCAAAGCACATCTTAACCT for detecting bovine viral diarrhea mucosal disease

SEQ ID NO7: TTTAGGACATTCGCCACAC for the detection of bovine parainfluenza.

2. The nucleic acid sequence combination of claim 1, further comprising:

SEQ ID NO8: CATCAGCCTGGCCGCACGAGTTA for detecting bovine tuberculosis.

3. A gene chip, comprising:

a reaction well plate, and

the combination of nucleic acid sequences according to claim 1 or 2 immobilized in each reaction well of the reaction well plate.

4. The gene chip of claim 3, further comprising: and a positive control point, a negative control point and a quality control point which are fixed in each reaction hole of the reaction hole plate.

5. Use of the nucleic acid sequence combination according to claim 1 or 2 and the gene chip according to claim 3 or 4 in the preparation of a kit for detecting bovine plague.

6. A kit, comprising:

the combination of nucleic acid sequences according to claim 1 or 2 or the gene chip according to claim 3 or 4.

7. The kit according to claim 6, for detecting the presence of any of brucellosis in cattle, anthrax, foot and mouth disease, infectious bovine rhinotracheitis, bovine viral diarrhea mucosis and bovine parainfluenza in a biological sample of biological origin from a subject.

8. The test kit according to claim 6 or 7, wherein the biological sample is bovine whole blood, plasma or serum.

9. The test kit of claim 6 or 7, further comprising: SSC solution, SDS solution, sodium citrate solution, horseradish peroxidase-labeled streptavidin solution, TMB solution, amplification primers, and instructions.

10. The test kit according to claim 6 or 7, wherein,

the kit further comprises amplification primers comprising:

a first primer set:

MTB-F(SEQ ID NO.11)：CTCTGAAATTCGCCTCTGTAGTGC

MTB-R(SEQ ID NO.12)：CATCTTGCTTCGGCGTGTTCC

BPIV3-F(SEQ ID NO.13)：ATCTGCAGCAAAATTAGACC

BPIV3-R(SEQ ID NO.14)：ACTCCWATCATTAGACCTGCTA

Brucella-F(SEQ ID NO.19)：GTCAAGCAGGGCTTTGAAGG

Brucella-R(SEQ ID NO.20)：CGTCGTCCAAGCCGTTGT

IBRV-F(SEQ ID NO.21)：TTGGCGCGGACTACGTGTA

IBRV-R(SEQ ID NO.22)：CCGTGAGGTTTAGGTCCACAA

BVDV-F(SEQ ID NO.23)：AGTCGTCARTGGTTCGA

BVDV-R (SEQ ID NO. 24): ARCACCCTATCAGGCTGT, respectively; and

a second primer set:

Anthrax(POX1)-F(SEQ ID NO15):TTCTAGTGATAACTTACAACTGCC

Anthrax(POX1)-R(SEQ ID NO.16)：TTCCATCATTGTCACGGTCT

16srDNA-F(SEQ ID NO.17)：ACCCGCAACAATACTCAC

16srDNA-R(SEQ ID NO.18)：AAAACTACCGATGCCGCTA

FMDV-F(SEQ ID NO.25)：TACAAACCTGTGATGGCTTC

FMDV-R(SEQ ID NO.26)：TGCCACGGAGATCAACT。