CN112725341B - Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof - Google Patents
Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof Download PDFInfo
- Publication number
- CN112725341B CN112725341B CN202110124380.XA CN202110124380A CN112725341B CN 112725341 B CN112725341 B CN 112725341B CN 202110124380 A CN202110124380 A CN 202110124380A CN 112725341 B CN112725341 B CN 112725341B
- Authority
- CN
- China
- Prior art keywords
- phsp
- endogenous
- egfp
- expression
- ustilago
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/375—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Basidiomycetes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An endogenous strong promoter pHSP of Ustilago esculenta, an expression vector and application thereof, belonging to the technical field of genetic engineering. The invention comprises the following steps: an endogenous strong promoter pHSP of Ustilago esculenta, the nucleotide sequence of which is shown in SEQ ID NO. 1; an expression vector containing a ustilago endogenous strong promoter pHSP; and the application of the gene in driving the transcription and expression of eGFP gene, constructing a stable expression system and obtaining the engineering black rice smut, thereby improving the quality of the geneeGFPExpression intensity and fluorescence stability of (a). The invention relates to a gene expression vector of Ustilago esculenta endogenous pHSP promoter and strong terminator nosTeGFPGene connection to construct an effective plasmid vector pUe-cbx-Hsp, and improveeGFPExpression intensity of (2), initiationeGFPThe gene transcription level is enhanced by more than 9 times and 11 times compared with the otef and TFIID2 respectively.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a ustilago esculenta endogenous strong promoter pHSP, an expression vector and application thereof.
Background
The smut is an important endophytic fungus in the zizania latifolia body, and can inhibit the heading and flowering of the zizania latifolia after infecting zizania latifolia plants, induce the stem base to expand and gradually form a spindle-shaped edible succulent stem, namely the zizania latifolia. The wild rice stem is rich in nutrition, contains sugar, organic nitrogen, fat, protein, fiber and vitamins, has high medicinal value, and has multiple effects of removing heat, promoting fluid production, quenching thirst, removing yellow eyes, relieving alcoholism and the like, so that the economic value of the wild rice stem is high.
At present, the interaction mechanism of the smut bacteria and the zizania latifolia plants is unclear, so that the production, quality control, breeding and the like of the zizania latifolia are guided by experience, and the problems of variety degradation, unstable yield, large quality difference and the like are caused, so that the research on the molecular mechanism of the interaction of the plants and the smut bacteria in the production process of the zizania latifolia is urgent. Among them, a high-efficiency gene expression system is the basic guarantee for effectively researching the function of a target gene. The expression system constructed by heterologous promoter Otef is mainly used at present, although it is driveneGFPThe protein can be normally expressed in the smut bacteria strain, but the expression quantity is not high, and the fluorescence is unstable, so that a strong promoter with high-efficiency and stable expression needs to be screened out, and a foundation is laid for research on functional genes of the smut bacteria and interaction mechanisms of the smut bacteria and wild rice shoots.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to design and provide a ustilago aethiopica endogenous strong promoter pHSP and an expression vector and application thereof.
An endogenous strong promoter pHSP of Ustilago esculenta is characterized in that the nucleotide sequence of the endogenous strong promoter pHSP of Ustilago esculenta is shown as SEQ ID No. 1.
A preparation method of the Ustilago esculenta endogenous strong promoter pHSP is characterized by comprising the following steps: extracting total DNA of Ustilago esculenta by CTAB method, and detecting by 0.8% agarose electrophoresis, wherein the extracted total DNA of Ustilago esculenta has clear band for standby; and (3) taking the total DNA of the ustilaginoidea virens as a template, and adopting a specific primer Hs-F, Hs-R to amplify to obtain the endogenous promoter pHSP of the ustilaginoidea virens.
The preparation method is characterized in that the nucleotide sequence of Hs-F is shown in SEQ ID NO.2, and the nucleotide sequence of Hs-R is shown in SEQ ID NO. 3.
An expression vector containing the ustilago zizanioides endogenous strong promoter pHSP.
The expression vector is characterized in that the expression vector is induced and expressed in Ustilago esculentaeGFPExpression vector pUe-cbx-Hsp of gene.
The preparation method of the expression vector is characterized by comprising the following steps:
1) designing specific primers H-F and H-R according to the sequence of the endogenous strong promoter pHSP of the ustilago esculenta;
2) using a pUMA932 plasmid as a template, carrying out double enzyme digestion by using restriction enzymes KpnI and NcoI, carrying out electrophoresis by using 1% agarose Gel, and recovering a large enzyme digestion fragment by using a HiPure Gel Pure DNA Mini Kit for later use;
3) cloning endogenous pHSP of Ustilago esculenta to a pMD 19-T vector, obtaining a pMD19-pHSP vector through sequencing verification, and carrying out PCR amplification on the pMD19-pHSP vector by using Vazyme high-Fidelity PCR enzyme Max Super-Fidelity DNA Polymerase with primers H-F and H-R designed in the step 1);
4) connecting the PCR amplification product obtained in the step 3) with the enzyme digestion large fragment obtained in the step 2) by adopting a seamless connection cloning kit, transforming the connection product into a competent cell of an escherichia coli DH5 alpha strain, screening positive transformants on an LB (lysogeny broth) plate containing ampicillin, carrying out amplification culture, carrying out bacteria liquid PCR verification by using specific primers hYZ-F and hYZ-R, carrying out 1% agarose gel electrophoresis, and sequencing after an electrophoresis result is correct to obtain the ustilago esculenta transformation expression vector pUe-cbx-Hsp.
The preparation method of the expression vector is characterized in that the nucleotide sequence of the primer H-F is shown as SEQ ID NO.4, and the nucleotide sequence of the primer H-R is shown as SEQ ID NO. 5.
The preparation method of the expression vector is characterized in that the nucleotide sequence of the primer hYZ-F is shown as SEQ ID NO.6, and the nucleotide sequence of the primer hYZ-R is shown as SEQ ID NO. 7.
The Ustilago esculenta endogenous strong promoter pHSP is used for drivingeGFPTranscription and expression of gene, construction of stable expression system and obtaining of engineering black rice smutThe use of (1).
The endogenous strong promoter pHSP of the Ustilago esculenta is improvedeGFPExpression intensity and fluorescence stability.
The Ustilago esculenta is a Ustilago esculenta haploid strain UET1 claimed in an authorized patent number ZL201610058044.9 by the applicant, and the preservation number of the Ustilago esculenta haploid strain is CGMCC No. 11843.
The invention relates to a Ustilago esculenta endogenous pHSP promoter and application thereofeGFPGene connection to constitute effective expression vector pUe-cbx-HspE.coliAmpicillin (amp) is used as a selective marker, carboxin cbx is used as a selective marker in Ustilago esculenta, the expression intensity of eGFP is improved, and the initiation of the expression is startedeGFPCompared with the Otef and TFIID2 promoters, the gene transcription level is respectively enhanced by more than 9 times and 11 times, and a basic material is provided for researching the gene function of the ustilago zizanioides in the molecular biology level in the future.
Drawings
FIG. 1 is a structural diagram of Ustilago esculenta transformation expression vector pUe-cbx-Hsp;
FIG. 2 is a screening image under a fluorescence microscope;
FIG. 3 is a screening of the observation under a white light microscope;
FIG. 4 is a view of a synthetic light microscope under observation and screening;
FIG. 5 is a graph of the results of qPCR;
FIG. 6 is a view showing the observation of the expression of eGFP in each promoter under a fluorescent microscope;
FIG. 7 is a graph showing the results of measurement of fluorescence intensity by ImageJ software.
Detailed Description
The invention will be further explained with reference to the drawings and examples.
The Ustilago esculenta described in the following examples is a Ustilago esculenta haploid strain UET1 claimed in the granted patent No. ZL201610058044.9 by the applicant, and the preservation number is CGMCC No. 11843.
Example 1: cloning and sequencing of endogenous pHSP promoter of Ustilago esculenta
A total DNA template of the Ustilago esculenta UET1 strain is extracted by a CTAB method, and the extracted Ustilago esculenta genome DNA band is clear and complete through 0.8% agarose electrophoresis detection, so that the PCR amplification requirement can be met. Using specific primer Hs-F: 5'-CATCGGGCCGCATGGCTGAG-3' (shown as SEQ ID NO. 2); 5'-GATGACGATTCTAAGGCTGTTGC-3' (shown as SEQ ID NO. 3) to obtain a pHSP full sequence 928bp (shown as SEQ ID NO. 1), cloning to a pMD 19-T vector, and sequencing and verifying to obtain a plasmid pMD19-pHSP containing the Ustilago esculenta pHSP sequence.
Example 2: ustilago esculenta endogenous pHSP promoter drivereGFPGene expression in black mushroom
1. Construction of Ustilago esculenta endogenous pHSP promoter and strong terminator nosT andeGFPgene-linked plasmid vector
Specific primers H-F were designed based on the pHSP promoter sequence obtained in example 1: 5' - GCGAAATTCGAGCTC GTACC CATCGGGCCGCATGGCTGAG-3' (shown in SEQ ID NO. 4), in italic GGTACC Is a recognition site of a restriction enzyme KpnI; H-R: 5' - CCATGGCTCGCCCTTGCTCAGATGACGATTCTAAGGCTGTTGC-3' (shown in SEQ ID NO. 5), in italic CCATGG Is a recognition site for the restriction enzyme NcoI. Underlined, positive letters are fragments homologous to the ends of the vector required for constructing the vector in a seamless ligation manner.
The plasmid pUMA932 was used as a template, and cleaved with KpnI and NcoI, the promoter Otef was excised, subjected to 1% agarose Gel electrophoresis, and the large cleaved fragment was recovered using the HiPure Gel Pure DNA Mini Kit.
The pMD19-pHSP plasmid was used as a template, and H-F and H-R were amplified by PCR using primers for Vazyme high Fidelity PCR enzyme Max Super-Fidelity DNA Polymerase, and the target band was recovered.
The obtained target band was ligated to the large fragment after digestion using Cloneexpress II One Step Cloning Kit C112 by seamless ligation. The ligation products were then transformed into competent cells of E.coli strain DH5 alpha, positive transformants were selected on LB plates containing ampicillin, the positive transformants were grown and cultured with specific primer pairs hYZ-F: GAAC TCGAGCAGCTGAAGCT (shown in SEQ ID NO. 6); hYZ-R: CGCTGAACTTGTGGCCGTTT (shown in SEQ ID NO. 7), performing PCR verification on the bacterial liquid, performing electrophoresis on the bacterial liquid by using 1% agarose gel, and sequencing the plasmid without errors in the electrophoresis result by a sequencing company. Thus, Ustilago esculenta expression vector pUe-cbx-Hsp (see figure 1) was obtained.
2. Obtaining transformant by PEG mediated transformation of Ustilago esculenta protoplast
Linearizing the constructed pUe-cbx-Hsp vector by using restriction enzyme NdeI, mediating and transforming the vector into protoplast of UET1 strain by using PEG, screening the protoplast in a regeneration culture medium containing 10 mu g/mL carboxin, picking a transformant for expanding culture, observing and screening the transformant under a fluorescence microscope, and displaying the vector under white light as shown in figure 2; under fluorescence as shown in FIG. 3; under the combined light as shown in fig. 4. The result shows that the endogenous promoter of the smut can driveeGFPThe transcription and expression of the gene can be used for the construction of a stable expression system and the acquisition of the engineering black smut.
Example 3: evaluation of the Strength and stability of Ustilago esculenta endogenous promoter pHSP
1. evaluation of eGFP expression level
The transformant obtained in example 2 and the expression vector (heterologous promoter Otef and endogenous promoter TFIID2 for promoting expression) used by the current Ustilago esculenta are extracted and purified by a general RNA extraction and purification kit of a pillared fungus of a worker companyeGFP) Performing RNA extraction on a transformant obtained by transforming ustilago according to an instruction, wherein all the operations are RNase free operations, determining the concentration and the quality of the extracted RNA by using ultraviolet analysis after the extraction is finished, performing reverse transcription by using a HiScript II Q RT SuperMix for qPCR (+ gDNA wiper) kit of Vazyme company according to the instruction of the kit to obtain a reverse transcription product, and detecting by using a ChamQ Universal SYBR qPCR Master Mix, wherein detection primers are respectively as follows:
primer sequences for eGFP:
qF-AACCGCATCGAGCTGAAG (shown as SEQ ID NO. 8);
qR-TGATGCCGTTCTTCTGCTTG (shown as SEQ ID NO. 9);
primer sequence of internal reference gene (beta-actin):
QF-CAATGGTTCGGGAATGTGC (shown as SEQ ID NO. 10);
QR-GGGATACTTGAGCGTGAGGA (shown as SEQ ID NO. 11).
By using 2-ΔCtThe results of qPCR were analyzed and shown in FIG. 5, and it was found that no wild-type strain was detectedeGFPExpression of (3) by the pHSP promotereGFPThe expression amount of (a) is 19.25: initiated by the Otef promotereGFPThe expression amount of (a) is 2.01: driven by TFIID2 promotereGFPThe expression amount of (a) is 1.70: the above results show that: pHSP promoter increaseseGFPExpression amount of (2), initiation ofeGFPThe gene transcription level is enhanced by more than 9 times and 11 times compared with Otef and TFIID2 respectively.
2. Evaluation of fluorescence intensity and stability
The transformant obtained in example 2 and the expression vector (heterologous promoter Otef and endogenous promoter TFIID 2) used by the current Ustilago esculenta are used for promoting the expressioneGFP) The transformants obtained by transforming Ustilago esculenta were photographed by a Leica DM 6B fluorescence microscope under the same parameter conditions, and the results are shown in FIG. 6, and the fluorescence intensity was measured by ImageJ software, and the results are shown in FIG. 7. As can be seen from the results, expression was promoted by the pHSP promotereGFPFluorescence 100% expression, iteGFPThe fluorescence intensity range of (a) is 36.79-42.14, and the average intensity is 39.73; cells expressing eGFP fluorescence driven by the Otef promoter accounted for 84% of the total cellseGFPThe fluorescence intensity range of (A) is 4.12-8.15, and the average intensity is 6.15; expression promoted by TFIID2 promotereGFPFluorescent cells accounted for 54% of the total cells, whicheGFPThe fluorescence intensity range of (A) is 2.24-4.17, and the average intensity is 3.02. The above results show that: the endogenous promoter pHSP increaseseGFPThe expression intensity of (3), pHSP-initiated expressioneGFPThe fluorescence intensity is respectively enhanced by more than 6 times and 13 times compared with the Otef and TFIID2 promoter expression, and the endogenous promoter pHSP promotes the expressioneGFPThe fluorescence intensity and the expression condition are more stable.
Sequence listing
<110> China metering university
<120> Ustilago esculenta endogenous strong promoter pHSP, expression vector and application thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 928
<212> DNA
<213> Ustilago esculenta (Ustilago esculenta)
<400> 1
catcgggccg catggctgag ctgagtggca aattgagtcg tgtgccaccg aaaagatgga 60
gatgtgcacc cgccaagcgc aaacagatga attgttaaag tgtctcacag ttgtaaaatg 120
tagaatttcc attgcctctt tgctgatccg gatcagatgc gatcggtgat ctgatggctg 180
cgatctggaa acgcgaagaa gagtgtggcg tgtgctagag acttccacaa ttttggagaa 240
gttgcacgac actagtggaa gttgcttttt ggtaaagctg acgcatcatg cttcgttcag 300
ccgaggcatc gtaacgtgga cgcgacgaac atgggattgt cacggaaaga aattccttca 360
ggcactagag ctgtgatcga cttgctcgaa gaacacttcc aatccgttct gcagccttcc 420
tcgcgtcaac tttgcacctc agctgccagg taacgtcacc aaacgaacac attttctgcg 480
agcgccgccc tctggctata gccgcatgtt gaaatcctag tcagcacaag caagtggact 540
gaggtcgaac acagcgtggc ctgcgtacgg tccaaactgg gcccattcag atccgcacca 600
gaagcacttg tcgccacgag ttccgaaact ttgggttgac gcacaaacgt gcgcagccca 660
ttctgcttgt acacattcgt gagtctgtgc gagagtgaga atgcggtatg ggtggccaag 720
atccagccgt tgctgaggcc ttcaaagact tggtacataa gcttgagcct gaacagcaac 780
cttcttcccc gctacccacc aacattcacg tctgcacaca gatcctcgag ttgcacatac 840
ccagcaccgc aaccatcttc agacatactt ccgctttcct cttaaacccc cctttcccct 900
tcacagcaac agccttagaa tcgtcatc 928
<210> 2
<211> 20
<212> DNA
<213> primer (primer)
<400> 2
<210> 3
<211> 23
<212> DNA
<213> primer (primer)
<400> 3
gatgacgatt ctaaggctgt tgc 23
<210> 4
<211> 40
<212> DNA
<213> primer (primer)
<400> 4
cgaaattcga gctcggtacc catcgggccg catggctgag 40
<210> 5
<211> 43
<212> DNA
<213> primer (primer)
<400> 5
ctcgcccttg ctcaccatgg gatgacgatt ctaaggctgt tgc 43
<210> 6
<211> 20
<212> DNA
<213> primer (primer)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> primer (primer)
<400> 7
<210> 8
<211> 18
<212> DNA
<213> primer (primer)
<400> 8
aaccgcatcg agctgaag 18
<210> 9
<211> 20
<212> DNA
<213> primer (primer)
<400> 9
<210> 10
<211> 19
<212> DNA
<213> primer (primer)
<400> 10
caatggttcg ggaatgtgc 19
<210> 11
<211> 20
<212> DNA
<213> primer (primer)
<400> 11
Claims (5)
1. An endogenous strong promoter pHSP of Ustilago esculenta is characterized in that the nucleotide sequence of the endogenous strong promoter pHSP of Ustilago esculenta is shown as SEQ ID No. 1.
2. A preparation method of the Ustilago esculenta endogenous strong promoter pHSP as claimed in claim 1, which is characterized by comprising the following steps: extracting total DNA of Ustilago esculenta by CTAB method, and detecting by 0.8% agarose electrophoresis, wherein the extracted total DNA of Ustilago esculenta has clear band for standby; and (2) taking the total DNA of the ustilaginoidea virens as a template, and adopting a specific primer Hs-F, Hs-R for amplification, wherein the nucleotide sequence of Hs-F is shown as SEQ ID NO.2, and the nucleotide sequence of Hs-R is shown as SEQ ID NO.3, so as to obtain the endogenous promoter pHSP of the ustilaginoidea virens.
3. An expression vector comprising the ustilago endogenous strong promoter pHSP according to claim 1.
4. The Ustilago esculenta endogenous strong promoter pHSP of claim 1, which is used for drivingMovable parteGFPTranscription and expression of the gene, construction of a stable expression system and application of the obtained engineering black rice smut.
5. The method for increasing the endogenous strong promoter pHSP of Ustilago esculenta as claimed in claim 1eGFPExpression intensity and fluorescence stability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110124380.XA CN112725341B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110124380.XA CN112725341B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112725341A CN112725341A (en) | 2021-04-30 |
| CN112725341B true CN112725341B (en) | 2022-03-18 |
Family
ID=75594633
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110124380.XA Active CN112725341B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112725341B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131029A (en) * | 2014-07-23 | 2014-11-05 | 吉林省农业科学院 | Beauveria bassiana genetic transformation method by utilization of corn smut heat shock protein promoter |
| CN104560742B (en) * | 2015-01-14 | 2018-03-23 | 浙江省林业科学研究院 | Agriculture bacillus mediated ustilago esculenta transformant bacterial strain and its preparation method and application |
| CN109022290B (en) * | 2018-07-25 | 2021-06-08 | 中国计量大学 | UeMPTSP (UeMPS) haploid strain and application thereof |
-
2021
- 2021-01-29 CN CN202110124380.XA patent/CN112725341B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112725341A (en) | 2021-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20170088845A1 (en) | Vectors and methods for fungal genome engineering by crispr-cas9 | |
| CN106434651B (en) | Agrobacterium tumefaciens and CRISPR-Cas9 mediated gene site-directed insertion inactivation method and application thereof | |
| CN109477115A (en) | For Eukaryotic expression system | |
| EP3408394B1 (en) | Multigene expression in microalgae | |
| CN111088275A (en) | Cloning method of DNA large fragment | |
| DK2546340T3 (en) | HØJEKSPRESSIONSPROMOTOR, ARISING FROM, Kluyveromyces marxianus | |
| CN112725341B (en) | Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof | |
| CN112680449B (en) | Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof | |
| KR20120042444A (en) | Yeast expression vectors for integration of chromosome and uses thereof | |
| CN105039386A (en) | Method for constructing monascus strain capable of achieving high yield of acid protease | |
| CN112553198B (en) | Active larch enhancer, obtaining method and identification method | |
| CN111979257B (en) | Recombinant DNA and application thereof | |
| EP3802820B1 (en) | Methods for identifying promoters for protein production in yeast | |
| CN112831517B (en) | Lycopene gene-mediated modification cloning vector and application thereof | |
| CN114807218B (en) | Method for improving high-temperature resistance of Phaeodactylum tricornutum algae species by transferring exogenous genes | |
| CN110628799A (en) | Construction method and application of bacterial promoter report vector | |
| US11866714B2 (en) | Promoter for yeast | |
| CN106987601B (en) | Construction of recombinant vector of monascus polyketide synthase gene PKS1 and expression of recombinant vector in recombinant aspergillus oryzae | |
| CN113817736B (en) | Promoter with quorum sensing characteristics and application thereof | |
| KR101328481B1 (en) | Yeast Expression Vectors for Integration of Chromosome and Uses Thereof | |
| CN107828790B (en) | Promoter for inducible expression under acid condition | |
| CN116478996A (en) | Sweet potato U6 promoter, expression cassette, recombinant expression vector and application thereof | |
| Rani et al. | A forward genetics approach identifies pathogenicity genes in Fusarium oxysporum f. sp. carthami, a fungus causing vascular wilt disease of safflower | |
| CN117165583A (en) | Hypoxia inducible promoter for yeast cells and application thereof | |
| CN116875595A (en) | BDPs activity characterization novel biosensor BDP-SWITCH in corynebacterium glutamicum and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |