CN112680449B - Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof - Google Patents
Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof Download PDFInfo
- Publication number
- CN112680449B CN112680449B CN202110124387.1A CN202110124387A CN112680449B CN 112680449 B CN112680449 B CN 112680449B CN 202110124387 A CN202110124387 A CN 202110124387A CN 112680449 B CN112680449 B CN 112680449B
- Authority
- CN
- China
- Prior art keywords
- pef
- ustilago esculenta
- endogenous promoter
- expression
- egfp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
An endogenous promoter pEF of ustilago esculenta, an expression vector and application thereof belong to the technical field of genetic engineering. The invention comprises the following steps: an endogenous promoter pEF of Ustilago esculenta has a nucleotide sequence shown as SEQ ID NO. 1; an expression vector containing an endogenous promoter pEF of smut bacteria; and in driving thereofeGFPTranscription and expression of gene, construction of stable expression system and application in obtaining engineering black rice smuteGFPExpression intensity and fluorescence stability. The invention relates to a Ustilago esculenta endogenous pEF promoter and a strong terminator nosT andeGFPthe genes are connected to construct an effective plasmid vector pUe-cbx-EF, so that more choices are provided for the construction of the Ustilago esculenta genetic transformation vector, and a foundation is laid for the research of the functional genes of the Ustilago esculenta.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an endogenous promoter pEF of smut bacteria, an expression vector and application thereof.
Background
The smut is an important endophytic fungus in the zizania latifolia body, and can inhibit the heading and flowering of the zizania latifolia after infecting zizania latifolia plants, induce the stem base to expand and gradually form a spindle-shaped edible succulent stem, namely the zizania latifolia. The wild rice stem is rich in nutrition, contains sugar, organic nitrogen, fat, protein, fiber and vitamins, has high medicinal value, and has multiple effects of removing heat, promoting fluid production, quenching thirst, removing yellow eyes, relieving alcoholism and the like, so that the economic value of the wild rice stem is high.
At present, the interaction mechanism of the smut bacteria and the zizania latifolia plants is unclear, so that the production, quality control, breeding and the like of the zizania latifolia are guided by experience, and the problems of variety degradation, unstable yield, large quality difference and the like are caused, so that the research on the molecular mechanism of the interaction of the plants and the smut bacteria in the production process of the zizania latifolia is urgent. Among them, a high-efficiency gene expression system is the basic guarantee for effectively researching the function of a target gene. The expression system constructed by heterologous promoter Otef is mainly used at present, although it is driveneGFPThe protein can be normally expressed in the smut bacteria strain, but the expression quantity is not high, and the fluorescence is unstable, so that a strong promoter with high-efficiency and stable expression needs to be screened out, and a foundation is laid for research on functional genes of the smut bacteria and interaction mechanisms of the smut bacteria and wild rice shoots.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to design and provide an endogenous promoter pEF of ustilago esculenta, an expression vector and application thereof.
An endogenous promoter pEF of Ustilago esculenta is characterized in that the nucleotide sequence of the endogenous promoter pEF of Ustilago esculenta is shown as SEQ ID NO. 1.
A preparation method of the endogenous promoter pEF of the smut is characterized in that a CTAB method is adopted to extract a smut total DNA template, and the extracted smut total DNA has clear bands for standby after 0.8% agarose electrophoresis detection; and (3) taking the total DNA of the ustilaginoidea virens as a template, and amplifying by adopting a specific primer EF-F, EF-R to obtain the endogenous promoter pEF of the ustilaginoidea virens.
The preparation method of the Ustilago esculenta endogenous promoter pEF is characterized in that the nucleotide sequence of the primer EF-F is shown as SEQ ID NO.2, and the nucleotide sequence of the primer EF-R is shown as SEQ ID NO. 3.
An expression vector containing the black smut endogenous promoter pEF.
The expression vector is characterized in that the expression vector is driven in Ustilago esculentaeGFPExpression vector pUe-cbx-EF for gene transcription expression.
The preparation method of the expression vector is characterized by comprising the following steps:
1) designing specific primers E-F and E-R according to the sequence of a promoter pEF;
2) carrying out double digestion by using restriction enzymes KpnI and NcoI by using a pUMA932 plasmid as a template, carrying out electrophoresis by using 1% agarose Gel, and recovering a digestion large fragment by using a HiPure Gel Pure DNA Mini Kit;
3) cloning an endogenous promoter pEF of Ustilago esculenta to a pMD19-T vector, carrying out sequencing verification to obtain a pMD19-pEF vector, and carrying out PCR amplification on the pMD19-pEF vector by using a Vazyme high-Fidelity PCR enzyme MaxSuper-Fidelity DNA Polymerase by using a specific primer E-F, E-R;
4) connecting the PCR amplification product obtained in the step 3) with the enzyme digestion large fragment obtained in the step 2) by adopting a seamless connection cloning kit, transforming the connection product into a competent cell of an escherichia coli DH5 alpha strain, screening positive transformants on an LB (lysogeny broth) plate containing ampicillin, carrying out amplification culture, carrying out PCR (polymerase chain reaction) verification on bacteria liquid by using specific primers eYZ-F and eYZ-R, carrying out electrophoresis by using 1% agarose gel, and sequencing the electrophoresis result without errors to obtain the ustilago esculenta transformation expression vector pUe-cbx-EF.
The preparation method of the expression vector is characterized in that the nucleotide sequence of the primer E-F is shown as SEQ ID NO.4, and the nucleotide sequence of the primer E-R is shown as SEQ ID NO. 5.
The preparation method of the expression vector is characterized in that the nucleotide sequence of the primer eYZ-F is shown as SEQ ID NO.6, and the nucleotide sequence of the primer eYZ-R is shown as SEQ ID NO. 7.
The Ustilago esculenta endogenous promoter pEF is used for drivingeGFPTranscription and expression of the gene, construction of a stable expression system and application of the obtained engineering black rice smut.
The endogenous promoter pEF of Ustilago esculenta is improvedeGFPExpression intensity and fluorescence stability.
The Ustilago esculenta is a Ustilago esculenta haploid strain UET1 claimed in an authorized patent number ZL201610058044.9 by the applicant, and the preservation number of the Ustilago esculenta haploid strain is CGMCC No. 11843.
According to the invention, endogenous pEF promoter of Ustilago esculenta and endogenous pEF promoter thereofeGFPThe genes are connected to construct an effective expression vector pUe-cbx-EF (in the specificationE.coliAmpicillin (amp) is used as a selective marker, carboxin cbx is used as a selective marker in Ustilago esculenta, the expression intensity of eGFP is improved, and the initiation of the expression is startedeGFPCompared with the Otef and TFIID2 promoters, the gene transcription level is enhanced by more than 3 times, and a basic material is provided for the research of the gene function of the Ustilago esculenta in the molecular biology level in the future.
Drawings
FIG. 1 is a schematic view of Ustilago esculenta transformation expression vector pUe-cbx-EF;
FIG. 2 is a screening image under a fluorescence microscope;
FIG. 3 is a screening view of a viewer under white light;
FIG. 4 is a composite light lower view screening diagram;
FIG. 5 is a graph of the results of qPCR;
FIG. 6 is a view showing the observation of the expression of eGFP in each promoter under a fluorescent microscope;
FIG. 7 is a graph showing the results of measurement of fluorescence intensity by ImageJ software.
Detailed Description
The invention will be further explained with reference to the drawings and examples.
The Ustilago esculenta described in the following examples is a Ustilago esculenta haploid strain UET1 claimed in the granted patent No. ZL201610058044.9 by the applicant, and the preservation number is CGMCC No. 11843.
Example 1: cloning and sequencing of endogenous pEF promoter of ustilago esculenta
A total DNA template of the Ustilago esculenta UET1 strain is extracted by a CTAB method, and the extracted Ustilago esculenta genome DNA band is clear and complete through 0.8% agarose electrophoresis detection, so that the PCR amplification requirement can be met. With specific primers EF-F: 5'-GTGGTGAGCAAGGCACTTTGA-3' (shown in SEQ ID NO. 2); 5'-CCATACACCAAAAACATCATTCAAA-3' (shown as SEQ ID NO. 3) is amplified to obtain a pEF complete sequence 1314bp (shown as SEQ ID NO. 1), the pEF complete sequence is cloned to a pMD19-T vector, and sequencing verification is carried out to obtain a plasmid pMD19-pEF containing the Ustilago esculenta pEF sequence.
Example 2: ustilago esculenta endogenous pEF promoter drivereGFPGene expression in black mushroom
1. Construction of Ustilago esculenta endogenous pEF promoter and Strong terminator nosT andeGFPgene-linked plasmid vector
Specific primers E-F were designed based on the pEF promoter sequence obtained in example 1: 5' - GTCGAAATTCGAGCTC GTACC GTGGTGAGCAAGGCACTTTGA-3' (shown in SEQ ID NO. 4), in italic GGTACC Is a recognition site of a restriction enzyme KpnI; E-R: 5' - CCATGGCTCGCCCTTGCTCATTTGAATGATGTTTTTGGTGTATGG-3' (shown in SEQ ID NO. 5), in italic CCATGG Is a recognition site for the restriction enzyme NcoI. Underlined, positive letters are fragments homologous to the ends of the vector required for constructing the vector in a seamless ligation manner.
The plasmid pUMA932 was used as a template, and the plasmid was double-digested with restriction enzymes KpnI and NcoI, the eGFP upstream promoter Otef was excised, subjected to 1% agarose Gel electrophoresis, and the digested large fragment (carrying the eGFP gene) was recovered using the HiPure Gel Pure DNA Mini Kit.
The pMD19-pHSP plasmid was used as a template, and E-F and E-R were PCR-amplified using primers for Vazyme high Fidelity PCR enzyme Max Super-Fidelity DNA Polymerase, and the target band was recovered.
The obtained target band was ligated to the large fragment after digestion using Cloneexpress II One Step Cloning Kit C112 by seamless ligation. The ligation products were then transformed into competent cells of E.coli strain DH5 alpha, positive transformants were selected on LB plates containing ampicillin, the positive transformants were grown and cultured with specific primer pairs eYZ-F: GAAC TCGAGCAGCTGAAGCT (shown in SEQ ID NO. 6); eYZ-R: CGCTGAACTTGTGGCCGTTT (shown in SEQ ID NO. 7), the plasmid was subjected to PCR validation, and the gel was electrophoresed with 1% agarose gel, and the plasmid was sequenced without errors by sequencer. Thus obtaining the Ustilago esculenta transformation expression vector pUe-cbx-EF (see figure 1).
2. Obtaining transformant by PEG mediated transformation of Ustilago esculenta protoplast
Linearizing the constructed pUe-cbx-Hsp vector by using restriction enzyme PvuI, mediating and transforming the vector into protoplast of UET1 strain by using PEG, screening the protoplast on a regeneration culture medium containing 10 mu g/mL carboxin, selecting a transformant for expanding culture, observing and screening the transformant under a fluorescence microscope, and displaying the transformant under white light as shown in figure 2; under fluorescence as shown in FIG. 3; under the combined light as shown in fig. 4. The result shows that endogenous promoter pEF of Ustilago esculenta can driveeGFPThe transcription and expression of the gene can be used for the construction of a stable expression system and the acquisition of the engineering black smut.
Example 3: evaluation of strength and stability of endogenous promoter pEF of Ustilago esculenta
1. evaluation of eGFP expression level
The transformant obtained in example 2 and the expression vector (heterologous promoter Otef and endogenous promoter TFIID2 for promoting expression) used by the current Ustilago esculenta are extracted and purified by a general RNA extraction and purification kit of a pillared fungus of a worker companyeGFP) Performing RNA extraction on a transformant obtained by transforming ustilago according to an instruction, wherein all the operations are RNase free operations, determining the concentration and the quality of the extracted RNA by using ultraviolet analysis after the extraction is finished, performing reverse transcription by using a HiScript II Q RT SuperMix for qPCR (+ gDNA wiper) kit of Vazyme company according to the instruction of the kit to obtain a reverse transcription product, and detecting by using a ChamQ Universal SYBR qPCR Master Mix, wherein detection primers are respectively as follows:
primer sequences for eGFP:
qF-AACCGCATCGAGCTGAAG (shown as SEQ ID NO. 8);
qR-TGATGCCGTTCTTCTGCTTG (shown as SEQ ID NO. 9);
primer sequence of internal reference gene (beta-actin):
QF-CAATGGTTCGGGAATGTGC (shown as SEQ ID NO. 10);
QR-GGGATACTTGAGCGTGAGGA (shown as SEQ ID NO. 11).
By using 2-ΔCtThe results of qPCR were analyzed and shown in FIG. 5, and it was found that no wild-type strain was detectedeGFPExpression of (1), promoted by pEF promotereGFPThe expression amount of (a) was 6.66: initiated by the Otef promotereGFPThe expression amount of (a) is 2.01: driven by TFIID2 promotereGFPThe expression amount of (a) is 1.70: the above results show that: pHSP promoter increaseseGFPExpression amount of (2), initiation ofeGFPThe gene transcription level was enhanced by 3.3 and 3.9 fold compared to Otef, TFIID2, respectively.
2. Evaluation of fluorescence intensity and stability
The transformant obtained in example 2 and the expression vector (heterologous promoter Otef and endogenous promoter TFIID 2) used by the current Ustilago esculenta are used for promoting the expressioneGFP) The transformants obtained by transforming Ustilago esculenta were photographed by a Leica DM 6B fluorescence microscope under the same parameter conditions, and the results are shown in FIG. 6, and the fluorescence intensity was measured by ImageJ software, and the results are shown in FIG. 7. As can be seen from the results, expression was promoted by the pHSP promotereGFPFluorescence 100% expression, iteGFPThe fluorescence intensity range of (A) is 23.67-26.98, and the average intensity is 25.14; cells expressing eGFP fluorescence driven by the Otef promoter accounted for 84% of the total cellseGFPThe fluorescence intensity range of (A) is 4.12-8.15, and the average intensity is 6.15; expression promoted by TFIID2 promotereGFPFluorescent cells accounted for 54% of the total cells, whicheGFPThe fluorescence intensity range of (A) is 2.24-4.17, and the average intensity is 3.02. The above results show that: the endogenous promoter pHSP increaseseGFPThe expression intensity of (3), pHSP-initiated expressioneGFPThe fluorescence intensity is respectively enhanced by 4 times and 8 times compared with the Otef and TFIID2 promoter expression, and the endogenous promoter pEF promotes the expressioneGFPThe fluorescence intensity and the expression condition are more stable.
Sequence listing
<110> China metering university
<120> Ustilago esculenta endogenous promoter pEF, and expression vector and application thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1314
<212> DNA
<213> Ustilago esculenta (Ustilago esculenta)
<400> 1
gtggtgagca aggcactttg aattcgacct gtcaatcggg ggctacacgc gaccgctacg 60
gggaccgtca cagccgatgc tttacctccg cattccgaac aaacatgaga actgagcttg 120
tgtcgatgca gattgctgcg accatcgatc ttcttctgaa agtcgaggca gtacttgggc 180
ttcgcgcttc tgttttgcac aaacgatttc agctctggga aaatcaaatc ttatggcgtt 240
aaagactttt gcatacacaa ggcgagacaa gcacaattcg aaagcgattt caaactcttg 300
atactagtct gcgcagtgag cgcgctccag aattggaatc cgttgccgca gtcgactcag 360
caaagtggca aacctgcccg tgcgccaagt ccccctcccc tccaacctgt ttctaaaatg 420
cgaagcgaca cttggttgcg tcgaagaagc cttcatatga gccgtaacaa cgcagccgag 480
tgcgatcttc tggagcaaga aaaacatccg gtagcggcag atctttgcgg caaggcacat 540
ggagcggtgc caatctctgt cgccagccac agcgggccgc gccgatccat gttcctgtga 600
gaaggaggaa cgtgcacgat cagatgcgct ggaccttgct tgccacacga gctgcgtcga 660
ccagcagctc accttaagtg ctgtcggggc gttcgcatcg tgaggccgtg gtgacgagcc 720
cccagaaaag ctcattggat gcaaaggttt gaatttagac tgtctgttct gcttagttct 780
gcttagctct gcttagctct gcacagctct tctttggatt tgaatttgaa ggcgcgcatc 840
gcgaaattag aaagcaattc agattcaagc aattcgtttc tggtcgacgg gtggtctgga 900
attgactgcc cagctgtgca aaaaggagct ccaaagcagt gtcagccctt ctgagcttgg 960
ggcggccgcg cagccgagtt gctgcgcagt tcgttttgtg aagtcggaga agcacaacga 1020
cggttcaagg cctcatggcc tcgagcctgt ccacgcaaat tgaccaatga tcgaggcgca 1080
agaccagtgc aagttggaag ttgagccgca agaaaaattt tctctcgctg cgcagccaag 1140
ttgcggattt gccccccttt ctctgcctct ggagcgcctt gtgcaaaccc tcccccccgt 1200
cgcgctctcc gtgagccagt gcgccaagtg gataaaggtc gtcggctttc gtcaccatct 1260
tcccttcttc cctcatacac cgtatcatac catacaccaa aaacatcatt caaa 1314
<210> 2
<211> 21
<212> DNA
<213> primer (primer)
<400> 2
gtggtgagca aggcactttg a 21
<210> 3
<211> 25
<212> DNA
<213> primer (primer)
<400> 3
ccatacacca aaaacatcat tcaaa 25
<210> 4
<211> 42
<212> DNA
<213> primer (primer)
<400> 4
tcgaaattcg agctcggtac cgtggtgagc aaggcacttt ga 42
<210> 5
<211> 45
<212> DNA
<213> primer (primer)
<400> 5
ctcgcccttg ctcaccatgg tttgaatgat gtttttggtg tatgg 45
<210> 6
<211> 20
<212> DNA
<213> primer (primer)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> primer (primer)
<400> 7
<210> 8
<211> 18
<212> DNA
<213> primer (primer)
<400> 8
aaccgcatcg agctgaag 18
<210> 9
<211> 20
<212> DNA
<213> primer (primer)
<400> 9
<210> 10
<211> 19
<212> DNA
<213> primer (primer)
<400> 10
caatggttcg ggaatgtgc 19
<210> 11
<211> 20
<212> DNA
<213> primer (primer)
<400> 11
Claims (5)
1. An endogenous promoter pEF of Ustilago esculenta is characterized in that the nucleotide sequence of the endogenous promoter pEF of Ustilago esculenta is shown as SEQ ID NO. 1.
2. A preparation method of the Ustilago esculenta endogenous promoter pEF as claimed in claim 1, is characterized in that a CTAB method is adopted to extract a total DNA template of the Ustilago esculenta, and the total DNA band of the extracted Ustilago esculenta is clear and is reserved after 0.8% agarose electrophoresis detection; the total DNA of the smut is taken as a template, and a specific primer EF-F, EF-R is adopted for amplification to obtain the endogenous promoter pEF of the smut, wherein the nucleotide sequence of the primer EF-F is shown as SEQ ID NO.2, and the nucleotide sequence of the primer EF-R is shown as SEQ ID NO. 3.
3. An expression vector comprising the Ustilago esculenta endogenous promoter pEF according to claim 1.
4. The Ustilago esculenta endogenous promoter pEF of claim 1, drivingeGFPTranscription and expression of the gene, construction of a stable expression system and application of the obtained engineering black rice smut.
5. The method for improving endogenous promoter pEF of Ustilago esculenta as claimed in claim 1eGFPExpression intensity and fluorescence stability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110124387.1A CN112680449B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110124387.1A CN112680449B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112680449A CN112680449A (en) | 2021-04-20 |
| CN112680449B true CN112680449B (en) | 2022-03-18 |
Family
ID=75459521
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110124387.1A Active CN112680449B (en) | 2021-01-29 | 2021-01-29 | Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112680449B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560742A (en) * | 2015-01-14 | 2015-04-29 | 浙江省林业科学研究院 | Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof |
| CN108998464A (en) * | 2018-07-25 | 2018-12-14 | 中国计量大学 | PSP107 plasmid and its application, construction method |
| CN109370922A (en) * | 2018-12-18 | 2019-02-22 | 中国计量大学 | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application |
| CN109593769A (en) * | 2018-12-18 | 2019-04-09 | 中国计量大学 | Wild rice brand spores form related gene Itd1 and its application |
| WO2020243431A1 (en) * | 2019-05-29 | 2020-12-03 | The Fynder Group, Inc. | Recombinant fungal strains with reduced levels of mycotoxins |
-
2021
- 2021-01-29 CN CN202110124387.1A patent/CN112680449B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560742A (en) * | 2015-01-14 | 2015-04-29 | 浙江省林业科学研究院 | Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof |
| CN108998464A (en) * | 2018-07-25 | 2018-12-14 | 中国计量大学 | PSP107 plasmid and its application, construction method |
| CN109370922A (en) * | 2018-12-18 | 2019-02-22 | 中国计量大学 | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application |
| CN109593769A (en) * | 2018-12-18 | 2019-04-09 | 中国计量大学 | Wild rice brand spores form related gene Itd1 and its application |
| WO2020243431A1 (en) * | 2019-05-29 | 2020-12-03 | The Fynder Group, Inc. | Recombinant fungal strains with reduced levels of mycotoxins |
Non-Patent Citations (2)
| Title |
|---|
| An efficient genetic manipulation protocol for Ustilago esculenta;Yu Jiajia等;《FEMS Microbiology Letters》;20150630;第362卷(第12期);第1-19页 * |
| 菰黑粉菌MAPK同源基因UeKss1的克隆及表达;张雅芬等;《植物病理学报》;20161031;第46卷(第05期);第634-644页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112680449A (en) | 2021-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20170088845A1 (en) | Vectors and methods for fungal genome engineering by crispr-cas9 | |
| Querol et al. | The application of molecular techniques in wine microbiology | |
| CN109477115A (en) | For Eukaryotic expression system | |
| US20200392484A1 (en) | Compositions and methods for identifying polynucleotides of interest | |
| Gubler et al. | Regulation of the fixA gene and fixBC operon in Bradyrhizobium japonicum | |
| EP3408394B1 (en) | Multigene expression in microalgae | |
| DK2546340T3 (en) | HØJEKSPRESSIONSPROMOTOR, ARISING FROM, Kluyveromyces marxianus | |
| CN112680449B (en) | Ustilago esculenta endogenous promoter pEF as well as expression vector and application thereof | |
| DE69836136T2 (en) | RECOMBINANT CONSTRUCTION FOR INCREASED EXPRESSION OF GENES IN PLANTS. | |
| CN112725341B (en) | Ustilago esculenta endogenous strong promoter pHSP and expression vector and application thereof | |
| KR20120042444A (en) | Yeast expression vectors for integration of chromosome and uses thereof | |
| US20080299616A1 (en) | Malate Synthase Regulatory Sequences for Heterologous Gene Expression in Pichia | |
| EP3802820B1 (en) | Methods for identifying promoters for protein production in yeast | |
| CN112831517B (en) | Lycopene gene-mediated modification cloning vector and application thereof | |
| CN100360673C (en) | Gene promoters | |
| US11866714B2 (en) | Promoter for yeast | |
| CN105886525A (en) | Pichia pastoris strain of high-expression foreign protein | |
| KR101328481B1 (en) | Yeast Expression Vectors for Integration of Chromosome and Uses Thereof | |
| CN116875595A (en) | BDPs activity characterization novel biosensor BDP-SWITCH in corynebacterium glutamicum and preparation method thereof | |
| CN106987601B (en) | Construction of recombinant vector of monascus polyketide synthase gene PKS1 and expression of recombinant vector in recombinant aspergillus oryzae | |
| CN117165583A (en) | Hypoxia inducible promoter for yeast cells and application thereof | |
| EP4308707A1 (en) | Methods for recombinant protein expression in eukaryotic cells | |
| OA19168A (en) | Multigene expression in microalgae. | |
| CN116478996A (en) | Sweet potato U6 promoter, expression cassette, recombinant expression vector and application thereof | |
| CN117568349A (en) | Fungal promoter element P22 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |