CN112625858A

CN112625858A - Instrument-free and power-free nucleic acid on-site rapid detection product

Info

Publication number: CN112625858A
Application number: CN201910954901.7A
Authority: CN
Inventors: 陈翀; 刘华勇; 叶月娥; 黄嘉恩
Original assignee: Guangzhou Universal Junan Biotechnology Co ltd; Guangzhou Pushi Lihua Technology Co ltd
Current assignee: Guangzhou Universal Junan Biotechnology Co ltd; Guangzhou Pushi Lihua Technology Co ltd
Priority date: 2019-10-09
Filing date: 2019-10-09
Publication date: 2021-04-09

Abstract

The invention belongs to the technical field of nucleic acid detection, and particularly relates to an instrument-free power-free nucleic acid on-site rapid detection product, which comprises a nucleic acid detection module and a temperature control module for providing a nucleic acid detection reaction temperature environment. The invention provides an instrument-free and power-free nucleic acid on-site rapid detection product which is simple and convenient to operate, does not depend on large or expensive instruments, is power-free and has lower cost, thereby really realizing the nucleic acid detection anytime and anywhere and greatly expanding the application scene of the nucleic acid detection.

Description

Instrument-free and power-free nucleic acid on-site rapid detection product

Technical Field

The invention belongs to the technical field of nucleic acid detection, and particularly relates to an instrument-free power-free nucleic acid on-site rapid detection product.

Background

After decades of development and rapid maturation in recent years, nucleic acid detection technology has been widely used in various fields such as detection of infectious disease pathogens (including bacteria, mycoplasma, viruses, etc.), detection of tumor mutations, detection of genetic diseases, and detection of individual genotypes. In various application fields, such as infectious disease diagnosis, the sensitivity and specificity of the nucleic acid detection technology are greatly superior to those of a colloidal gold/immunofluorescence method, and the method is a gold standard for various diagnoses. However, current nucleic acid detection techniques are almost entirely instrument dependent and require high sample handling, detection environment, and personnel qualifications. One conventional nucleic acid detection usually takes several hours to a longer time from the acquisition of a sample to the purification of nucleic acid, the configuration of a detection system, reaction to the interpretation of a result. These factors limit the realization of rapid detection in situ. Some reports show that a complete process from an original sample to a result is realized through technologies such as microfluidics and the like, and the method does not depend on specific environment and detection technicians, but the detection needs to be based on complex and expensive instruments, the cost is increased, and the rapid detection on site cannot be widely realized.

Since the field rapid detection cannot depend on a large instrument, the field rapid detection of nucleic acid is mainly based on the nucleic acid isothermal amplification technology. Common isothermal amplification detection techniques are: (1) loop-mediated isothermal amplification (LAMP): the technology can realize rapid amplification under the condition of about 60-65 ℃; (2) rolling circle amplification technique (RCA): the technology utilizes DNA ligase and DNA polymerase to carry out strand displacement synthesis of a circular template in a rolling circle replication mode, thereby realizing amplification of a part of circular genome; (3) recombinant polymerase amplification technique (RPA): the core protein of the technology is single-chain DNA binding protein, single-chain nucleic acid recombinase and strand displacement DNA polymerase, the technology has strong amplification capacity, high speed (10-30 minutes), wide temperature range (25-42 ℃), and is a very potential isothermal amplification technology; (4) the earlier research result 201811519861.5 of the inventor group discloses the application of the protein ScCas12a in DNA cleavage and nucleic acid detection, can realize high-sensitivity and high-precision molecular detection at room temperature of 25-42 ℃, and has the advantages of good specificity, high sensitivity, low cost and wide application range.

In the prior art, nucleic acid detection products based on the nucleic acid isothermal amplification technology are all provided with temperature control devices, the temperature control devices for nucleic acid detection at present are electric heating temperature control devices, a power supply is needed, the structure is complex, the cost is high, the advantages of small size, portability, simplicity in operation, convenience in use and the like are not achieved, and the rapid detection of nucleic acid on site is not really realized.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provide an instrument-free and power-free nucleic acid field rapid detection product which is simple and convenient to operate, does not depend on a large or expensive instrument, is power-free and has low cost, so that the nucleic acid detection at any time and any place is really realized, and the application scene of the nucleic acid detection is greatly expanded.

In order to solve the technical problems, the invention adopts the following technical scheme:

the utility model provides an exempt from instrument and exempt from on-spot short-term test product of power supply nucleic acid, includes nucleic acid detection module and the temperature control module who provides nucleic acid detection temperature environment, its characterized in that, temperature control module is including meeting the spontaneous heating material of air and ventilative structure, temperature control module passes through when detecting ventilative structure lets in the outside air.

Preferably, the temperature control module further comprises a sealed breathable bag, and the self-heating substance meeting air is arranged inside the sealed breathable bag.

Preferably, the nucleic acid detecting module comprises a reaction result area, and is preloaded with a reaction reagent and a result display product.

Preferably, the nucleic acid detection module is sequentially connected with a reaction area and a result area in a sealing manner, the reaction area is preloaded with reagents required by nucleic acid detection reaction, and the result area is preloaded with substances required by nucleic acid detection result display.

Preferably, the temperature control module is in adjacent contact with the reaction zone, conducting heat.

Preferably, the reaction zone comprises a first reaction zone and a second reaction zone.

Preferably, the nucleic acid detection module further comprises a sample inlet.

Preferably, the sample inlet is connected with the reaction zone through a liquid channel.

Preferably, the number of the liquid channel, the reaction zone and the result zone is n, wherein n is an integer > 0.

Preferably, the liquid channel is a fixed proportion liquid channel, such as an equal proportion (1: 1) flow equalizing liquid channel.

Preferably, the instrument-free and power-free nucleic acid on-site rapid detection product is stored in an airtight outer package before use, and the inside of the airtight outer package is vacuumized or filled with inert gas to block exothermic reaction.

Preferably, the self-heating material meeting air is a mixture of iron powder.

Preferably, the instrument-free and power-free product for the field rapid detection of nucleic acid further comprises a shell, and the nucleic acid detection module and the temperature control module are fixedly arranged inside the shell.

Preferably, the result region may be displayed by a different method, such as a colloidal gold method, a fluorescence method, a color change reaction, a hybridization method, or a microsphere method.

Preferably, the instrument-free power-free nucleic acid on-site rapid detection product can also be provided with a sample pretreatment device to finish pretreatment of a sample to be detected.

Preferably, the sample pretreatment device has a precise quantitative sampling function, and meets different detection requirements.

By adopting the technical scheme, the invention has the following beneficial effects:

1. the temperature control module without a power supply is adopted to provide a nucleic acid detection temperature environment, a power supply is not required to be equipped when the product is used, the application scene is greatly widened, and the rapid detection of nucleic acid at any time and any place is realized.

2. The method is simple and convenient to operate, rapid and not prone to error, only needs non-professional operation, greatly reduces errors and errors caused by different operators, avoids aerosol pollution risks, has low requirements on detection environment and personnel quality, and is low in pollution risk and extremely low in false positive rate.

3. Preferably, a flow equalizing liquid channel is adopted, so that the detected amount of the samples flowing into each reaction area is consistent, the influence of errors among the sample amounts in each reaction area on the reaction result is reduced, and the multiple nucleic acid detection is realized.

4. According to different detection contents, the device can be compatible with different sample pretreatment devices, the application of the detection card is expanded to a larger extent, and samples such as blood, saliva, sputum, urethral/genital secretion and the like can be detected.

5. Different air spontaneous heating substances are selected and the formula is adjusted to provide different detection temperatures, so that the rapid on-site detection of nucleic acid can be completed by matching with different nucleic acid isothermal amplification technologies.

6. The whole detection cost is low, and the method is suitable for large-scale popularization.

Drawings

FIG. 1 is a schematic structural view of the present invention;

FIG. 2 is a schematic external view of the present invention;

FIG. 3 is a thermodynamic diagram of the infrared detection inside the temperature control module of the present invention at a reaction time of 2 min;

FIG. 4 is a diagram of the external infrared detection thermodynamic diagram of the temperature control module of the present invention at a reaction time of 2 min;

FIG. 5 is a graph showing the internal temperature change of the temperature control module according to the present invention;

FIG. 6 shows the result of the nucleic acid agarose gel electrophoresis test in example 4 of the present invention;

FIG. 7 is a diagram showing a result area of embodiment 4 of the present invention;

FIG. 8 shows the results of detection of sample 1 in example 5 of the present invention;

FIG. 9 shows the results of detection of sample 2 in example 5 of the present invention;

FIG. 10 shows the results of detection of sample 1 in example 6 of the present invention;

FIG. 11 shows the results of detection of sample 2 in example 6 of the present invention;

FIG. 12 shows the results of detection of sample 3 in example 6 of the present invention;

the reference numbers in the figures are: 1 sample inlet, 2 gas permeable structure, 3 liquid channel, 4 first reaction zone, 5 second reaction zone, 6 result zone, 7 shells, 8 HPV16 result display zone, 9 HPV18 result display zone, 10 CT result display zone, 11 NG result display zone, 12 UU result display zone, 13 HSV result display zone.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the present invention are commercially available.

EXAMPLE 1 Instrument-free, Power-free, Single-reaction, and result-area nucleic acid on-site Rapid detection card

The kit comprises a shell (7), a nucleic acid detection module and a temperature control module, wherein the nucleic acid detection module and the temperature control module are fixedly arranged in the shell (7).

The detection card is preserved in airtight extranal packing before using, and airtight extranal packing is inside for evacuation or fill inert gas, separation reaction.

The temperature control module comprises a substance capable of automatically heating in the presence of air, a sealed breathable bag and a breathable structure (2), wherein the substance capable of automatically heating in the presence of air is an iron powder mixture, and the temperature control module is preassembled with the iron powder mixture and is arranged in the sealed breathable bag. The temperature control module is introduced with external air through the ventilation structure (2) during detection, and the iron powder mixture starts self-heating when meeting the air to provide detection temperature for the nucleic acid detection module.

The nucleic acid detection module is provided with a reaction result area (6), and the temperature control module is in adjacent contact with the reaction result area (6), so that heat is better conducted, and heat loss is reduced.

The reaction result area (6) is pre-loaded with an amplification reaction and result display system, the reaction system is a freeze-dried product of a constant temperature amplification method system, and the result display method is a color-changing reaction method. During detection, after the reaction is finished, the reaction product reacts with the result display reagent to generate color change, and the result is judged according to the color change.

EXAMPLE 2 Instrument-free Power-free nucleic acid on-site quick detection card

The device comprises a shell (7), a nucleic acid detection module and a temperature control module, wherein the nucleic acid detection module and the temperature control module are fixedly arranged in the shell (7), and the device further comprises a sample pretreatment device.

The nucleic acid detection module is sequentially connected with a sample inlet (1), a reaction area and a result area (6) in a sealing manner, and the reaction area comprises a first reaction area (4) and a first reaction area (5). The temperature control module is adjacent to and contacts with the reaction area, so that heat is better conducted, and heat loss is reduced.

The reaction area is pre-loaded with an amplification reaction system, the display method of the result area (6) is a colloidal gold method, and the result area (6) is colloidal gold test paper.

EXAMPLE 3 Instrument-free multiple-power-free nucleic acid on-site quick detection card

The temperature control module comprises a substance capable of automatically heating in the presence of air, a sealed breathable bag and a breathable structure (2), wherein the substance capable of automatically heating in the presence of air is an iron powder mixture, and the temperature control module is preassembled with the iron powder mixture and is arranged in the sealed breathable bag. When the detection is carried out with the temperature control module, external air is introduced through the ventilation structure (2), and the iron powder mixture starts to self-heat when meeting the air so as to provide detection temperature for the nucleic acid detection module.

The nucleic acid detection module is sequentially connected with a sample inlet (1), a first reaction area (4), a first reaction area (5) and a result area (6) in a sealing manner, and the temperature control module is in adjacent contact with the nucleic acid detection module, so that heat is better conducted, and heat loss is reduced.

The sample inlet (1) is hermetically connected with the first reaction area (4) through a liquid channel (3), and a flow equalizing liquid channel (3) is arranged on the liquid channel (3), so that the flow equalization of the liquid to be measured is realized. The liquid channel (3), the first reaction area (4), the first reaction area (5) and the result area (6) are arranged in a plurality of numbers, so that multiple nucleic acid detection is realized.

The using method of the detection card comprises the following processes:

the first step is as follows: the detection card outer package is disassembled, the temperature control module is introduced with external air through the ventilation structure (2), and the iron powder mixture starts self-heating when meeting the air so as to provide detection temperature for the nucleic acid detection module.

The second step is that: the liquid sample or the liquid sample after pretreatment is added into a detection card from a sample inlet (1), the liquid to be detected is equalized through an equalizing liquid channel (3), the liquid sample after the flow equalization is transferred to a first reaction area (5) after reacting in the first reaction area (4), the liquid sample after the flow equalization is transferred to a result area (6) after reacting in the first reaction area (5), and the result is read after the reaction is completed. The liquid sample is transferred by pushing the key of the detection card to achieve the effect of physical contact.

Example 4 instrument-free power-free nucleic acid on-site rapid detection card for detecting African Swine Fever Virus (ASFV) containing sample by using CRISPR/Cas12a technology

The structure and composition of the test card were the same as those of example 2.

The principle of nucleic acid detection: recombinant polymerase amplification techniques.

And (3) testing the functionality of the temperature control module: the temperature control module is monitored in real time by using a handheld thermal infrared imager of the company FlIR, the detection is started until the reaction is carried out for 45min, and the temperature inside and outside the temperature control module is recorded every 1 min.

As shown in FIGS. 3 and 4, the temperature of the reaction zone reached the temperature range of 25-42 ℃ for the recombinant polymerase amplification technique 2min after the start of the reaction.

The specific amplification primer and gRNA of the detection card are designed aiming at African Swine Fever Virus (ASFV).

The detection card using steps:

1) sample lysis: taking 5ml of blood of pig ear venous blood by using a disposable syringe, collecting serum, adding a prepared serum sample into a sampling bottle of a sample pretreatment device, and uniformly mixing by shaking; the sampling bottle contains lysis solution, and the lysis solution comprises the following components: 5% (V/V) NP-40, 4% Triton X-100, 0.2M NaOH, 2mM EDTA-2 Na;

2) after the cracking step is finished, a cap with a filter membrane system is replaced on a sampling bottle of the sample pretreatment device, and then the sampling bottle is vertically inserted into a sample inlet (1) of the detection card. And extruding the sampling bottle to ensure that a sample in the bottle enters the first reaction zone (4) through the sample inlet (1) of the detection card after cracking of the cracking liquid, simultaneously introducing external air into the temperature control module through the air permeable structure (2), and enabling the iron powder mixture to start self-heating when meeting the air to provide detection temperature for the nucleic acid detection module. The first reaction zone (4) is pre-loaded with a constant temperature amplification freeze-drying reagent, and the reagent composition is as follows: 120ng/ul of Ys40UvsX, 60ng/ul of Ys40UvsaK, 300ng/ul of T4gp32, 200uM of dNTP, 500nM of Primers, 2mM of DTT, 50mM of inositol, 200ng/ul of Ckase, 1.5mM of ATP, 14mM of MgAc, 2U of Bsu, 100mM of Tris-acetic acid, 50mM of sodium acetate and 5% of PEG 20000.

Designing primers for isothermal amplification according to the specific target sequence of the African swine fever virus, wherein the size of an amplified fragment is 80-120nt, the denaturation temperature of the primers can be 54-67 ℃, Opt & ltSUB & gt 60 & lt/SUB & gt, the length of the primers is 30-35nt, Opt & ltSUB & gt 32 & lt/SUB & gt, the GC content in the primers is 40-60%, and synthesizing DNA primers according to the designed sequence.

Exemplary primers are as follows:

ASFV-F1:TACARGATATTTATAMGAAGCTTGAGGGTC

ASFV-R2:CTGAAATTAATGTAAATTTTAAAGCTCGTT

3) after reacting for 20 minutes at 39 ℃, the first reaction area (5) (gene shearing reaction module) is driven to be butted with the first reaction area (4) (constant temperature amplification reaction module), and the constant temperature amplification reaction product and the moisture enter the gene shearing reaction module through the action of chromatography.

The gene cleavage reaction module is preassembled with a freeze-drying reagent of a detection system of CRISPR/Cas12a, and the reagent composition is as follows: scCas12a 45nM, gRNA 22.5nM, digoxin and biotin labeled nucleic acid probe 100nM, Tris 20mM, NaCl 60mM, MgCl 210 mM, pH 7.3.

The grnas used in this patent are specific grnas designed for target sequences. gRNA primer sequence design principle: when selecting a target sequence, the 5 ' end of the target sequence should have a 5 ' -TTTN-3 ' sequence; and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences. The gRNA primer structure is: 5 '- "TAATTTCTACTAAGTGTAGAT" -targeting sequence-3'.

4) After the reaction is carried out for 10 minutes at the temperature of 39 ℃, a button for observing the result is opened, the result area (6) (the colloidal gold reagent strip) is butted with the first reaction area (5) (the gene shearing reaction module), the digoxin and biotin-labeled nucleic acid probe and water in the first reaction area (5) (the gene shearing reaction module) are subjected to the reagent strip through the action of chromatography, and the result is read after the chromatography is finished.

Preparing the used immunochromatographic test paper and judging the result: the colloidal gold particles mark the mouse digoxin antibody; the detection line is a T line and marks streptavidin; the control line, i.e., line C, labeled goat anti-mouse antibody. Analyzing the result, wherein if the blood sample contains the African swine fever virus under the condition that the C line of the detection card is developed, the T line of the detection card is not developed, and the result is judged to be positive; if the African swine fever virus does not exist, the T line of the detection card is developed, and the result is judged to be negative.

The experimental results are as follows: to verify the reaction effect of the first reaction zone (4) (isothermal amplification reaction module), we performed a nucleic acid agarose gel electrophoresis test on the sample, and the result is shown in FIG. 6. In 1 sample tested, there was a target band, and amplification was successful. And (3) judging the result of the detection card colloidal gold, wherein the result is shown in figure 7, and 1 sample to be detected has the color of the C line, the color of the T line is not developed, and the result is judged to be positive, which indicates that the detection sample contains the African swine fever virus.

Example 5 instrument-free power-supply-free dual nucleic acid on-site rapid detection card for detecting samples containing Human Papillomavirus Type 16 (Human papillomavir Type 16, HPV16) and Human Papillomavirus Type 18 (Human papillomavir Type 18, HPV18) by using CRISPR/Cas12a technology

The structure and composition of the detection card are the same as those of example 3, wherein the number of the liquid channel (3), the first reaction area (4), the first reaction area (5) and the result area (6) is set to be 2, and the detection card is used for double nucleic acid detection.

The using steps of the detection card are as follows:

1) sample lysis: samples of female cervical or male urethral secretions were taken using sterile swabs. The urethral orifice secretion sample sampling method comprises the following steps: and (3) forbidding urination within at least 1 hour before sampling, cleaning the urethral orifice with sterile normal saline, inserting a sterilized swab into the urethra for 2-4 cm, rotating, staying for 10-20 seconds, and taking out the swab. The cervical secretion sampling method comprises the following steps: the cervical mucosa was applied with a sterilized swab and rotated gently for two weeks to obtain secretions and exfoliated cells. After sampling, adding the swab sample into a sample bottle of a sample pretreatment device, and uniformly mixing the sample with the swab sample in a shaking way; the sampling bottle contains lysis solution, and the lysis solution comprises the following components: 5% (V/V) NP-40, 4% Triton X-100, 0.2M NaOH, 2mM EDTA-2 Na;

2) after the cracking step is finished, a cap with a filter membrane system is replaced on a sampling bottle of the sample pretreatment device, and then the sampling bottle is vertically inserted into a sample inlet (1) of the detection card. The sampling bottle is extruded, so that samples in the bottle are split by the cracking liquid and then enter the sample inlet (1) of the detection card into the first reaction areas (4) through the liquid channel (3), meanwhile, the temperature control module is introduced into the external air through the air permeable structure (2), and the iron powder mixture starts to self-heat when meeting the air to provide detection temperature for the nucleic acid detection module. The first reaction zone (4) is pre-loaded with a constant temperature amplification freeze-drying reagent, and the reagent composition is as follows: 120ng/ul of Ys40UvsX, 60ng/ul of Ys40UvsaK, 300ng/ul of T4gp32, 200uM of dNTP, 500nM of Primers, 2mM of DTT, 50mM of inositol, 200ng/ul of Ckase, 1.5mM of ATP, 14mM of MgAc, 2U of Bsu, 100mM of Tris-acetic acid, 50mM of sodium acetate and 5% of PEG 20000. Designing primers for isothermal amplification according to specific target sequences of human papillomavirus type 16 and human papillomavirus type 18, wherein the size of an amplified fragment is 152nt, the denaturation temperature of the primers can be 54-67 ℃, Opt is 60, the length of the primers is 30-35nt, the GC content in the primers is 40-60%, and synthesizing DNA primers according to the designed sequences.

Exemplary primers are as follows:

HPV16-F1-1:ACAACCATTAGCAGATGCCAAAATAGGTATG

HPV16-R1-1:GCCACCT(A/G)GAATCTGTACCAGCATTAATGT

HPV18-F1-1:GCAATATT(C/T)TTTGCAGCAAGGGAACATGGC、

HPV18-R1-1:GTAGGTTCTGTATTCCATAGTTCCTCGCAT

3) after reacting for 20 minutes at 39 ℃, driving the first reaction area (5) (gene shearing reaction module) to be butted with the corresponding first reaction area (4) (constant temperature amplification reaction module), and enabling the constant temperature amplification reaction product and water to enter the gene shearing reaction module through the action of chromatography.

The gene cleavage reaction module is preassembled with a freeze-drying reagent of a detection system of CRISPR/Cas12a, and the reagent composition is as follows: ScCas12a 45nM, gRNA 22.5nM, digoxin and biotin-labeled nucleic acid probe 100nM, Tris 20mM, NaCl 60mM, MgCl₂10mM, pH 7.3. The grnas used in this patent are specific grnas designed for target sequences. gRNA primer sequence design principle: when selecting a target sequence, the 5 ' end of the target sequence should have a 5 ' -TTTN-3 ' sequence; and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences. The gRNA primer structure is: 5 '- - "TAATTTCTACTAAGTGTAGAT" -targeting sequence-3'

4) After the reaction is carried out for 10 minutes at the temperature of 39 ℃, the result zone (6) (colloidal gold reagent strip) is butted with the corresponding first reaction zone (5) (gene shearing reaction module), digoxin and biotin-labeled nucleic acid probes and water in the first reaction zone (5) (gene shearing reaction module) are subjected to the reagent strip through the action of chromatography, and the result is read after the chromatography is finished. The immunochromatographic test paper in the device is prepared as follows: the colloidal gold particles mark the mouse digoxin antibody; the detection line is a T line and marks streptavidin; the control line, i.e., line C, labeled goat anti-mouse antibody. Analyzing the result, wherein if the blood sample contains the human papillomavirus 16 type or the human papillomavirus 18 type under the condition that the C line of the detection card is developed, the T line of the detection card is not developed, and the result is judged to be positive; if the test card does not contain the human papilloma virus type 16 or human papilloma virus type 18, the test card T line is developed, and the result is judged to be negative.

And (4) interpretation of results: 2 clinical urinary/genital secretion swabs were tested for infection with human papillomavirus type 16 (HPV16) or human papillomavirus type 18 (HPV 18). The result of the detection card colloidal gold is judged, the result of the sample 1 is shown in figure 8, and the result is specifically shown as C line coloration in an HPV16 result display area (8), T line coloration, result judgment positive, C line and T line coloration in an HPV18 result display area (9), and result judgment negative. Indicating that the sample 1 was infected with human papillomavirus type 16 (HPV 16). The results of sample 2 are shown in FIG. 9, which shows that both C-line and T-line are colored in the HPV16 result display region (8), the result is judged to be negative, C-line is colored in the HPV18 result display region (9), T-line is not colored, and the result is judged to be positive. Indicating the detection of human papillomavirus type 18 (HPV18) infection in sample 2.

Example 6 Instrument-free Power-free quadruple nucleic acid on-site Rapid detection card for detecting samples containing Chlamydia trachomatis/Neisseria gonorrhoeae/ureaplasma urealyticum/Herpes simplex virus (Chlamydia trachoma, CT/Neisseria gonorrhoeae, NG/Urealamasarulyticum, UU/Herpes simplex virus, HSV) by using CRISPR/Cas12a technique

The structure and composition of the detection card are the same as those of example 3, as shown in FIGS. 1 and 2, wherein the number of the liquid channel (3), the first reaction region (4), the first reaction region (5) and the result region (6) is set to 4, and the detection card is used for quadruple nucleic acid detection.

The detection card using steps:

1) sample lysis: and (4) taking secretion samples of the urethra and the genital tract by using a sterilized swab. The urethral orifice secretion sample sampling method comprises the following steps: and (3) forbidding urination within at least 1 hour before sampling, cleaning the urethral orifice with sterile normal saline, inserting a sterilized swab into the urethra, rotating and staying for 10-20 seconds, and taking out the swab. Vaginal secretion sampling method is as follows: secretions in the 4 cm inner wall or the rear cavity of the vagina were collected with a sterilized swab. After sampling, adding the swab sample into a sample bottle of a sample pretreatment device, and uniformly mixing the sample with the swab sample in a shaking way; the sampling bottle contains lysis solution, and the lysis solution comprises the following components: 5% (V/V) NP-40, 4% Triton X-100, 0.2M NaOH, 2mM EDTA-2 Na.

2) After the cracking step is finished, a cap with a filter membrane system is replaced on a sampling bottle of the sample pretreatment device, and then the sampling bottle is vertically inserted into a sample inlet (1) of the detection card. And extruding the sampling bottle to ensure that the sample in the bottle is subjected to cracking by the cracking liquid and then flows into each first reaction area (4) through the liquid channel (3) through the sample inlet (1) of the detection card. Each first reaction zone (4) is pre-loaded with a constant temperature amplification freeze-drying reagent, and the reagent composition is as follows: 120ng/ul of Ys40UvsX, 60ng/ul of Ys40UvsaK, 300ng/ul of T4gp32, 200uM of dNTP, 500nM of Primers, 2mM of DTT, 50mM of inositol, 200ng/ul of Ckase, 1.5mM of ATP, 14mM of MgAc, 2U of Bsu, 100mM of Tris-acetic acid, 50mM of sodium acetate and 5% of PEG 20000.

Designing primers for constant-temperature amplification according to specific target sequences of chlamydia trachomatis, neisseria gonorrhoeae, ureaplasma urealyticum and herpes simplex virus, wherein the denaturation temperature of the primers can be 54-67 ℃, Opt is 60, the length of the primers is 30-35nt, the GC content in the primers is 40-60%, and synthesizing DNA primers according to the designed sequences.

Exemplary primers are as follows:

CT-F1-1:GTGATCAAGTATGTTATTGTAAAGAAATAATCAT

CT-R1-1:CAATGCCAAGGCATYCACCAATAGCTCTTA

NG-F1-1GCCTATCCGATTTGGCGGCATTTRGGCCGG

NG-R1-1GCCCGGYGCTYCATYACCTTAGGGAAYCGT

UU-F1-1:GATAATGATGGAAATTTAGAAATTCACAC

UU-R1-1:CATCAATACTTACATCTATCTCATGTTCTA

HSV-F1-1:GGAGTCCGTCTTCCAGATGTACACCCGCATHSV-R1-1:GTAGTT GCGGGTCCCCAGGTTCAGCATGGC

The gene cleavage reaction module is preassembled with a freeze-drying reagent of a detection system of CRISPR/Cas12a, and the reagent composition is as follows: ScCas12a 45nM, gRNA 22.5nM, digoxin and biotin labeled nucleic acid probe 100nM, Tris 20mM，NaCl 60mM,MgCl₂10mM, pH 7.3. The grnas used in this patent are specific grnas designed for target sequences. gRNA primer sequence design principle: when selecting a target sequence, the 5 ' end of the target sequence should have a 5 ' -TTTN-3 ' sequence; and a stable secondary structure is not formed among the targeting sequence, the targeting sequence and the rest sequences. The gRNA primer structure is: 5 '- - "TAATTTCTACTAAGTGTAGAT" -targeting sequence-3'

4) After the reaction is carried out for 10 minutes at the temperature of 39 ℃, a button for observing the result is opened, the result area (6) (the colloidal gold reagent strip) is butted with the corresponding first reaction area (5) (the gene shearing reaction module), the digoxin and biotin-labeled nucleic acid probe and water in the first reaction area (5) (the gene shearing reaction module) are subjected to the reagent strip through the action of chromatography, and the result is read after the chromatography is finished.

The immunochromatographic test paper used was prepared as follows: the colloidal gold particles mark the mouse digoxin antibody; the detection line is a T line and marks streptavidin; the control line, i.e., line C, labeled goat anti-mouse antibody. Analyzing the result, wherein if the sample contains chlamydia trachomatis, neisseria gonorrhoeae, ureaplasma urealyticum or herpes simplex virus under the condition that the detection card C line is developed, the detection card T line corresponding to the detection item is not developed, and the result is judged to be positive; if the sample does not contain the chlamydia trachomatis, the neisseria gonorrhoeae, the ureaplasma urealyticum or the herpes simplex virus, the T line of the detection card corresponding to the detection item is developed, and the result is judged to be negative.

And (4) interpretation of results: 3 clinical genital secretion swabs were tested for infection with Chlamydia Trachomatis (CT), Neisseria Gonorrhoeae (NG), Ureaplasma Urealyticum (UU), Herpes Simplex (HSV). The result of the detection card colloidal gold is interpreted, the result of the sample 1 is shown in figure 10, and the concrete results are that the C line in the CT result display area (10) is colored, the T line is not colored, the result interpretation is positive, and the C line and the T line in the NG result display area (11), the UU result display area (12) and the HSV result display area (13) are colored, which indicates that the Chlamydia Trachomatis (CT) infection exists in the detection sample 1. The results of sample 2 are shown in fig. 11, and are specifically shown in the manner that the C line in the UU result display area (12) and the NG result display area (11) is colored, the T line is not colored, the result interpretation is positive, and the C line and the T line in the CT and HSV result display area (13) are both colored, and are negative results, which indicates that Ureaplasma Urealyticum (UU) and Neisseria Gonorrhoeae (NG) infection exist in the detected sample 2. The results of sample 3 are shown in FIG. 12, wherein C-line is colored, T-line is not colored, and the result is judged to be positive, and C-line and T-line are colored in the result display areas (12) of CT, NG and UU, and the result is negative, which indicates that Herpes Simplex (HSV) infection exists in the detected sample 3.

The above description is only an embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that are not thought of through the inventive work should be included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope defined by the claims.

Claims

1. The utility model provides an exempt from instrument and exempt from on-spot short-term test product of power supply nucleic acid, includes nucleic acid detection module and the temperature control module who provides nucleic acid detection reaction temperature environment, its characterized in that, temperature control module is including meeting the spontaneous heating material of air and ventilative structure, temperature control module passes through when detecting ventilative structure lets in the outside air.

2. The instrument-free and power-free nucleic acid field rapid detection product of claim 1, wherein the nucleic acid detection module comprises a reaction result region or a reaction region and a result region which are sequentially connected in a sealing manner.

3. The instrument-free, power-free, nucleic acid rapid site assay product of claim 1, wherein the temperature control module is in contiguous contact with the nucleic acid detection module and conducts heat.

4. The instrument-free power-free nucleic acid field rapid detection product according to claim 2, wherein the nucleic acid detection module comprises a sample inlet.

5. The instrument-free power-free nucleic acid rapid on-site detection product according to claim 4, wherein the sample inlet is connected to the reaction region through a liquid channel.

6. The instrument-free and power-free nucleic acid field rapid detection product according to claim 5, wherein the number of the liquid channel, the reaction region and the result region is n, wherein n is an integer > 0.

7. The instrument-free power-free nucleic acid field rapid detection product according to claim 6, wherein when n >1 and is an integer, the liquid channel is a fixed-ratio liquid channel.

8. The instrument-free and power-free nucleic acid field rapid detection product according to claim 1, wherein the temperature control module further comprises a sealed air-permeable bag, and the self-heating material meeting air is disposed inside the sealed air-permeable bag.

9. The instrument-free power-free nucleic acid spot rapid detection product according to any one of claims 1 to 8, wherein the instrument-free power-free nucleic acid spot rapid detection product is provided with a simple sample pretreatment device, and the simple sample pretreatment device is an instrument-free power-free pretreatment device.

10. The instrument-free and power-free nucleic acid rapid field detection product according to any one of claims 1 to 8, wherein the instrument-free and power-free nucleic acid rapid field detection product is stored in an airtight outer package before use, and the inside of the airtight outer package is evacuated or filled with inert gas to block reaction.