KR20210012553A - Kit for detecting target materials and method for detecting target materials using the same - Google Patents

Abstract

The present invention relates to a kit for multiple detection of target materials, comprising a substrate on which nucleic acid probes or antibodies, capable of specifically binding to isothermal amplification products of target materials on a surface or inside a hydrogel, are immobilized. By using the kit, rapid on-site diagnosis is enabled and a disease diagnostic test system having excellent sensitivity and specificity can be constructed.

Description

Kit for detecting target materials and method for detecting target materials using the same {Kit for detecting target materials and method for detecting target materials using the same}

It relates to a target substance detection kit and a method of detecting a target substance using the same.

Conventional acute respiratory infectious diseases are being tested and treated mainly in large hospitals. At this time, a sample is collected from the patient and sent to a diagnostic laboratory equipped with a special facility. After that, pre-treatment and examination of the sample are performed. In general, it takes several days for the clinician to receive the results. Therefore, clinicians rely on a wide range of antibiotics without an accurate diagnosis until they receive results.

Conventional methods for identifying pathogens of acute respiratory infectious diseases include traditional cell culture, shell vial culture, immunofluorescence staining, rapid antigen detection, and nucleic acid amplification. The traditional cell culture method has the advantage that it is possible to diagnose and isolate various viruses and/or bacteria, but it takes a long period of 3 to 10 days for diagnosis, and an additional method of immunofluorescence staining is required, and is performed by a skilled person. Diagnosis is limited because viruses or bacteria that cannot be cultured exist. In addition, there is a risk of the tester becoming infected. The rapid culture method is useful for diagnosing a virus that is not well cultured, and even an unskilled person can easily confirm the cytopathic effect, but it takes 24 to 72 hours to diagnose, and there are viruses or bacteria that cannot be cultured, so the diagnosis is limited. have. In addition, there is a risk that the examiner will become infected. Recently, methods to identify respiratory pathogens have been developed using a molecular biological method, multiplex PCR. Multiple PCR is a method of simultaneously amplifying several genes by using a combination of more than one pair of primers. However, there is a limit to the number of discrimination and diagnosis, and since it takes about 5 hours or more for diagnosis, there is a limitation to apply to on-site diagnosis.

Therefore, in order to multi-diagnose various pathogens in the medical field, there is a need for research on a detection system capable of quickly and accurately detecting the presence of a target substance.

One aspect relates to a kit for multiple detection of a target substance including a substrate on which a nucleic acid probe or antibody capable of specifically binding to an isothermal amplification product of a target substance is immobilized on or inside a hydrogel.

Another aspect comprises obtaining a nucleic acid sample from a biological sample of the subject; And contacting the sample to a substrate on which a nucleic acid probe or antibody capable of specifically binding to an isothermal amplification product of a target material is immobilized on the surface or inside of the hydrogel, comprising the step of contacting the sample. will be.

One aspect is a substrate on which a nucleic acid probe or antibody capable of specifically binding to an isothermal amplification product of a target nucleic acid is immobilized on the surface or inside of a hydrogel; And it provides a kit for multiple detection of a target substance comprising a set of primers capable of specifically binding to a target nucleic acid. By using the isothermal amplification method, the kit can detect a target substance more quickly and conveniently because it can detect a specific gene in the field even if it is not in a laboratory environment. In addition, by including two or more probes or antibodies on the substrate, different target substances can be simultaneously detected. The antibody may be, for example, anti-hapten. In addition, the target substance detection kit may be in the form of a miniaturized diagnostic chip, for example, a lab on a chip.

3' 엑소뉴클레아제(exonuclease)의 성격을 가지고 있어 DNA의 이중나선 구조를 열에 의한 변성을 거치지 않고 Tm 값에 가까운 접합 온도에서 접합 및 신장이 수행된다. 고리매개등온증폭법(Loop-mediated isothermal amplification, LAMP)은 먼저 내부 프라이머가 표적 핵산에 결합하여 신장되고, 이어 그 바깥쪽으로 외부 프라이머가 결합되어 신장되면서 가닥 변이(strand displacement)가 발생하며 먼저 형성된 가닥은 떨어져 나오게 된다. 떨어져 나온 단일 가닥의 5'말단에서부터 루프(loop) 구조가 형성되며 이는 3'말단에서도 같은 과정이 반복되고 루프 구조가 신장되게 된다. 상기 등온증폭을 수행하기 위해서는 증폭시킬 유전자의 위치를 인식하도록 특별히 고안된 4개 내지 6개의 프라이머를 사용하게 되는데 이는 일반 PCR이 2개의 위치를 인식하는 것과 비교했을 때, 표적 핵산에 대한 특이성이 매우 높아짐을 의미한다. 상기 프라이머는 내부 프라이머 세트, 외부 프라이머 세트 및/또는 루프 프라이머 세트인 것일 수 있다. As used herein, the term "isothermal amplification" refers to a method of amplifying a target nucleic acid under constant reaction temperature conditions. While the conventional PCR method has to change the temperature while going through the steps of denaturation, annealing, and extension, the isothermal amplification method has the advantage that conjugation and extension are possible at a constant temperature. This is the Taq used in conventional PCR . Bst instead of DNA polymerase . This was made possible by using a DNA polymerase. Bst . DNA polymerase is Taq in general PCR . Unlike DNA polymerase, 5'

Since it has the characteristic of 3'exonuclease, the double helix structure of DNA is not denatured by heat, and conjugation and extension are performed at a junction temperature close to the Tm value. In the loop-mediated isothermal amplification (LAMP) method, the inner primer is first bound to the target nucleic acid and elongated, and then the outer primer is bound and elongated to the outside, resulting in strand displacement. Comes off. A loop structure is formed from the 5'end of the single strand that has been separated, and the same process is repeated at the 3'end and the loop structure is elongated. In order to perform the isothermal amplification, 4 to 6 primers specially designed to recognize the position of the gene to be amplified are used, which has a very high specificity for the target nucleic acid compared to the normal PCR that recognizes the two positions. Means. The primer may be an inner primer set, an outer primer set, and/or a loop primer set.

Isothermal amplification methods include HAD (Helicase-Dependent Amplification), RPA (Recombinase Polymerase Amplification), RCA (Rolling Circle Amplification), LAMP (Loop mediated isothermal amplification), NASBA (Nucleic Acid-Sequence-Based Amplification), TMA (Transcription Mediated Amplification). ), SMART (Signal Mediated Amplification of RNA Technology), SDA (Strand Displacement Amplification), IMDA (Isothermal Multiple Displacement Amplification), SPIA (Single Primer Isothermal Amplification), HDA (Helicase-Dependent Amplification), or a combination thereof. .

A nucleic acid probe or antibody capable of specifically binding to the isothermal amplification product of the target nucleic acid may be three-dimensionally immobilized on the surface or inside of the hydrogel. Since the nucleic acid probe or antibody is immobilized on the surface or inside of the hydrogel, cross-reaction or interference reaction does not occur between the probe or antibody, and thus, there is an advantage in that it is easy for multiple diagnosis. The probe may be a set of forward inner primers (FIP) or a set of backward inner primers (BIP) of the target nucleic acid. The outer primer set may include a sequence complementary to a sequence closer to both ends of the target nucleic acid than the inner primer set, and the inner primer set may include a sequence closer to the center of the target nucleic acid than the outer primer set.

In one embodiment, the nucleic acid probe may be a linker capable of binding to the surface or the interior of the hydrogel is bonded to the 5'end. In addition, in another embodiment, a linker capable of binding to the surface or the interior of the hydrogel may be bonded to the 5'end of the forward inner primer and/or the reverse inner primer. The linker may be, for example, a compound including an acrylicdite, a thiol group, or a derivative thereof. The linker may be bonded to the surface or the interior of the hydrogel by covalent bonding with the hydrogel.

In one embodiment, the nucleic acid forward inner primer and/or the reverse inner primer may have a labeling material bound to the 5'end, and the labeling material may be a reporter or a quencher.

The reporter is, for example, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexa Fluor, FAM, JOE, ROX, HEX, Texas Red, TET, TRITC, TAMRA, Cyanine series dyes and siadicarbocyanin (thiadicarbocyanine) It may be one or more selected from the group consisting of dyes. In addition, the quencher is, for example, Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Black Hole Quencher, Qxl, Iowa black FQ, Iowa Black It may be one or more selected from the group RQ and IRDye QC-1. In another embodiment, when the labeling material is not bound to the 5'end of the probe, the kit may further include a double-stranded fluorescent dye, and the dye may be chelated to DNA. The fluorescent dye may be, for example, SYBR green. In addition, the fluorescent dye hardly shows a fluorescent signal before being chelated to the double-stranded DNA, but after chelating to the double-stranded DNA, the fluorescent signal is greatly increased, so that a target substance can be detected.

In addition, when the antibody is immobilized on the surface or inside of the hydrogel, the isothermal amplification product of the target nucleic acid to the antibody; And an antibody capable of specifically binding to the isothermal amplification product of the target nucleic acid may form a complex. One or more antibodies may be immobilized on the surface or inside of the hydrogel. The antibody may be, for example, streptavidin, anti-digoxigenin, anti-tamra, anti-texasred, anti-hapten, or the like. Specifically, it may be to form an antigen-antibody complex using an antigen capable of specifically binding to the antibody. In one embodiment, when the anti-hapten is fixed on the surface or inside of the hydrogel, the hapten capable of specifically binding to the anti-hapten is bound to the 5'end of the primer, and the anti-hapten and the hapten-primer It may be to form an antigen-antibody complex of. At this time, the 5'hapten-primer participates in the isothermal amplification reaction, and the isothermal amplification product including the 5'hapten-primer may specifically bind to the anti-hapten fixed on the surface or inside of the hydrogel (Fig. 2).

In another embodiment, when streptavidin is immobilized on the surface or inside of the hydrogel, the streptavidin and biotin capable of specifically binding thereto may form a streptavidin-biotin complex. Specifically, a forward inner primer or a reverse inner primer in which biotin is bound to the 5'end; And a product isothermal amplified by the external primer and streptavidin may form a complex.

In another embodiment, when a nucleic acid probe is immobilized on the surface or inside of a hydrogel, an isothermal amplification product of a target nucleic acid to the probe; And a probe capable of specifically binding to the isothermal amplification product of the target nucleic acid may form a complex. One or more nucleic acid probes may be immobilized on the surface or inside of the hydrogel. Specifically, an isothermal amplification product of a target nucleic acid may be complementarily bound to the nucleic acid probe. For example, when a primer or a nucleic acid probe to which acrylicdite is bound is bound to the surface or inside of the hydrogel, the isothermal amplification product of the target nucleic acid capable of complementary binding to the primer or probe is bound can do. Thereafter, an isothermal amplification reaction of the isothermal amplification product of the target nucleic acid bound to the primer or probe may be additionally performed (FIG. 3A). Figure 3b is a concrete embodiment of Figure 3a, a forward internal primer or probe fixed on the surface or inside of a hydrogel and a linker is bonded to the end, and a reverse internal primer included in the composition for isothermal amplification and a fluorescent material is bonded to the end. The detection method used is shown. 3A and 3B, in the kit according to an embodiment, a linker capable of binding to the surface or inside of the hydrogel is bonded to the end of the forward inner primer or probe, and the fluorescent labeling material is bonded to the reverse inner primer. Therefore, the isothermal amplification product of the target substance can be specifically detected by binding with the primer. At this time, the reverse internal primer is included in the composition for amplification of the lamp, and the isothermal amplification product participating in the isothermal amplification reaction is complementarily bound to the forward internal primer or probe fixed on the hydrogel, thereby specifically detecting the target material. have.

As described above, the isothermal amplification product is bound to one or more antibodies or nucleic acid probes immobilized on the surface or inside of the hydrogel, so that several target substances can be simultaneously detected. Specifically, a nucleic acid primer, probe, or antibody that specifically binds to at least one bacterial or viral nucleic acid is immobilized on the surface or inside of the hydrogel, so that the isothermal amplification product binds to the primer, probe or antibody, thereby positioning the hydrogel. By monitoring specific fluorescence expression for each, it is possible to detect multiple target substances simultaneously.

The hydrogel may be PEG (polyehthylene glycol), PEGDA (polyethylene glycol diacrylate), PEGDMA (polyethylene glycol dimetacrylate), photoinitiator, or a combination thereof. The photoinitiator is, for example, 2-hydroxy-2-methylpropiophenone (2-Hydroxy-2-methylpropiophenone) or lithium phenyl-2,4,6-trimethylbenzol phosphate (Lithium phenyl-2,4,6- trimethylbenzoylphosphate). In addition, the hydrogel may further contain one or more selected from the group consisting of streptavidin, anti-digoxigenin, anti-TAMRA, anti-texathread, and graphene. The streptavidin may be itself or may be coated on beads. When the hydrogel contains streptavidin-coated beads, the pore size of the gel may be increased. In general, the isothermal amplification method has a concentration of primers 10 to 1,000 times higher during reaction than the conventional PCR method. Fluorescent labeling materials for detecting amplification products exhibit fluorescence after chelating DNA double strands, but in general, fluorescence when the concentration of single strands is high. Therefore, the graphene may be added to reduce false positives in fluorescence detection of isothermal amplification products. The graphene may be added, for example, to a hydrogel or may be additionally added to a hydrogel to which streptavidin, anti-digoxigenin, anti-TAMRA or anti-texathread has been added. At this time, the graphene is difficult to chelate with a fluorescent labeling material by binding to a single strand, and fluorescence of the fluorescent labeling material bound to a single strand may be quenched by graphene. In addition, since the double strand does not bind to graphene, it can be chelated with a fluorescent dye, so that the fluorescent background by the primer can be removed.

In one embodiment, the target material is Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Metanumovirus, Metanumovirus, Coronavirus 229E (Coronavirus 229E), Coronavirus NL63 (Coronavirus NL63), and Coronavirus OC43 (Coronavirus OC43) may be one or more selected from the group consisting of.

As described above, in the kit according to an aspect, since the nucleic acid probe or antibody is immobilized on the surface or inside of the hydrogel, it is possible to detect several target substances simultaneously by specifically binding to the isothermal amplification product. At this time, a fluorescent signal can be generated by the forward internal primer or the reverse internal primer is bound to a fluorescent dye or a fluorescent dye capable of binding to double-stranded DNA is displaced, and the isothermal amplification product can be detected by monitoring the emitted fluorescence. have.

Another aspect comprises obtaining a nucleic acid sample from a biological sample of the subject; Contacting the sample with a substrate on which a nucleic acid probe or antibody capable of specifically binding to an isothermal amplification product of a target nucleic acid is immobilized on the surface or inside of the hydrogel; And it provides a method for multiple detection of a target substance comprising the step of performing an isothermal amplification reaction by adding a composition for isothermal amplification. By simultaneously detecting a target substance by the above method multiplexedly, it is possible to quickly diagnose whether an individual is infected with viruses and/or bacteria.

In one embodiment, the method comprises obtaining a nucleic acid sample from a biological sample of the subject. The individual is a target for detecting acute respiratory infectious diseases, for example, a target for predicting the likelihood of an acute respiratory infectious disease, a target for diagnosing the state of an acute respiratory infectious disease, and a target for determining the prognosis of an acute respiratory infectious disease , It means a target for determining the dose of a drug for preventing or treating acute respiratory infectious diseases, a target for determining a treatment method according to the progression of acute respiratory infectious diseases, etc. The individual may be a vertebrate animal, specifically mammals, amphibians, reptiles, birds, etc., more specifically, may be a mammal, for example, a human ( Homo sapiens ), a Korean I can. The sample may include a sample such as tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine isolated from an individual.

In one embodiment, the method includes contacting the sample with a substrate on which a probe or antibody capable of specifically binding to an isothermal amplification product of a target nucleic acid is immobilized on the surface or inside of the hydrogel. Details of the substrate are as described above.

In one embodiment, the method includes performing an isothermal amplification reaction by adding a composition for isothermal amplification. The composition for isothermal amplification includes an inner primer set and an outer primer set. Details of the inner primer set and the outer primer set are as described above. In addition, the composition may further include a DNA polymerase, dNTPs, and a buffer for performing an isothermal amplification reaction. The isothermal amplification reaction may be performed at 30 to 75°C for 20 to 120 minutes. The isothermal amplification reaction may be performed at, for example, 30 to 75°C, 30 to 70°C, 30 to 65°C, 50 to 75°C, or 55 to 70°C. In addition, the isothermal amplification reaction may be performed for, for example, 20 to 120 minutes, 20 to 100 minutes, 30 to 80 minutes, 30 to 60 minutes, 50 to 120 minutes, 50 to 100 minutes, or 50 to 80 minutes. At this time, if the reaction temperature is less than the above range, there is a problem that not only the Bst polymerase is not sufficiently activated, but also the probe and the primer are abnormally bound to the nucleic acid. If the reaction temperature exceeds the above range, the Bst polymerase is not sufficiently activated, as well as the probe and There is a problem in that the primer cannot bind to the nucleic acid. In addition, when the reaction time is less than the above range, there is a problem in that the amplification reaction does not sufficiently occur, resulting in a false negative result, and when the reaction time exceeds the above range, a non-specific amplification reaction may occur, resulting in a false positive result. The probe fixed to the hydrogel coupled with the isothermal amplification product amplified through the isothermal amplification reaction as described above can be complementarily combined with the inner primer set and the outer primer set to which the fluorescent labeling material in the composition for isothermal amplification is bound. At this time, the target material may be detected by measuring the fluorescence signal emitted from the fluorescent labeling material. In one embodiment, an isothermal amplification reaction was performed by combining a fluorescent dye with an inner primer to measure fluorescence, and after the reaction, it was possible to confirm whether or not fluorescence was detected through a fluorescence microscope under UV. Therefore, since several target substances can be simultaneously detected according to the above method, it is possible to quickly diagnose whether a virus and/or bacteria are infected in the field.

In the kit according to an embodiment, a probe or antibody capable of specifically binding to the isothermal amplification product of the target nucleic acid is immobilized on the substrate, on the surface or inside of the hydrogel, without cross-reaction or interference reaction between the probes or antibodies. Multiple target substances can be detected simultaneously. In addition, by using the isothermal amplification method, it is possible not only to quickly diagnose in the field, but also to construct a diagnostic test system having excellent sensitivity and specificity.

1 is a schematic diagram of a kit for detecting a target substance using a three-dimensional gel containing a nucleic acid specifically binding to an isothermal amplification product.
2 is a schematic diagram showing the operating principle of the target substance detection kit, and shows a detection method using a hydrogel immobilized with anti-heptene.
3A is a schematic diagram showing the operating principle of a target substance detection kit, and shows a detection method using a nucleic acid primer or a hydrogel to which a probe is bound.
Figure 3b is a concrete embodiment of Figure 3a, a forward internal primer or probe fixed on the surface or inside of a hydrogel and a linker is bonded to the end, and a reverse internal primer included in the composition for isothermal amplification and a fluorescent material is bonded to the end. The detection method used is shown.
4A is a diagram showing a substrate on which streptavidin, anti-digoxigenin, anti-texathread and anti-TAMRA are fixed, respectively.
4B is a diagram showing a substrate to which an acrylic dite forward inner primer is bonded to a hydrogel.
5 is a result of isothermal amplification and fluorescence analysis using a biotin-forward inner primer, a FAM-reverse inner primer, and an outer primer in a hydrogel fixed with streptavidin.
6 is a result of isothermal amplification and fluorescence analysis using a forward inner primer, a FAM-reverse inner primer, and an outer primer in a hydrogel fixed with an acrylicdite-nucleic acid primer.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

[Example]

Example 1. Preparation of target substance detection kit

1-1. Preparation of primer set

Primer sets for isothermal amplification reactions for each bacterial and viral genome were prepared using Primer Explore (http://primerexplorer.jp/e/index.html), and the base sequences of the primers are shown in Table 1 below.

Target substance/primer Forward outer primer (FO) Forward inner primer (FIP) Reverse outer primer (BO) Reverse inner primer (BIP) Streptococcus pneumoniae TCAGACAGAGTGGAAGCA CCTGTTACAACTCGGGCACCGATTTTGGACAATACAGAAGTGAA GCAACTACATTGTCACGTAA AAGGTGGATATGGTAGAGGACTTGAGTTGTATAGGAAATCGGCAA Haemophilus influenzae CTCATTTAGGAGAAATCTAATGAAC GCATCGTTGTTAGAGGAACTACAAGAAATCATTATTAGTTGCAGGTTCTG GTGATGTCGTATTTATCAAAACC AGGCAATGGTGCTGCTCAAAGTTGTAACGTTGTTGAAGATCAG Mycoplasma pneumoniae GCTAGAGTTTGACTGTACCATT CGGATAACGCTTGCGACCTATATAAGTGACGACTAACTATGTGC AAAACTCCCTACCACACTC CGCAGGCGGATTGAAAAGTCTTTCCAATGCATACAACTGT Chlamydophila pneumoniae AATGAACTACCAAACGTTTCT CATTCCCATAAAGCTCCACGAGATGGAGTTGTTGAACTCTACAC CTTGGGTTTGTTTACAGAGAA CGGTTGTGCAACTTTGGGAGGTTACAGATCACATTAAGTTCTTCA Metapneumovirus TTAAGAATGCCCTCAAAACG CTTTCAGCTCTCTCACTGCAGTAGCAGTATCTACATTGGGGA TCTGTTGAATTGACTGAAGC TGTGAGCAAGAATTTAACTCGTGCCGGCCATTTTTAGGTCATC Coronavirus 229E AGAAAATGTATTTGCTGTTGAGA CCTCACAACACCATCTACAACAGATTGGTGGTTATATACCCTCCG AAACATCTGAGGAAAAACCTT GTTGCTTAATTGCTTATGGTCTGTTATCACCTCTCCCAGTACC Coronavirus OC43 ACAATGTATGTTAGGCCGAT GCCAAAGAATAGCCAGTACCTAGTTAGGACTATCATACTCTGACGG ACATAAACAGCAAAACCACTA AGATTTGCCAGCTTATATGACTGTTATCGCTTATCCTGTCAAGAA Coronavirus NL63 TTCCACACTAGTGGACGG CCAGTTGAAGATTTAAGACCAGGTACTAGACTTTATCAACCACTCCG CCAAAGAATTAGCACTGAAGTT TAATGCCACTGGTTCTGATGTTAAGTAACGCATAACATCAACAAC

1-2. Preparation of target substance detection kit

In the buffer containing PBS, polyethylene glycol diacrylate (Poly(ethyleneglycol) diacrylate) and 2-hydroxy-2-methylpropiophenone (2-Hydroxy-2-methylpropiophenone) were respectively 0.6 g/ml and 0.01 g/ Distilled water was mixed so as to become ml and dissolved at 60° C. for about 30 minutes to prepare a transparent first gel composition solution.

Subsequently, a solution in which 10 μM of a nucleic acid probe that specifically binds an isothermal amplification product is dissolved in distilled water is mixed with the first gel composition in a ratio of 1:10, and then vortexed for about 5 seconds to prepare a second gel composition solution. I did. In this case, as the probe, an acrylate-forward inner primer for streptavidin or Chlamydophila pneumonia was used. At room temperature and in an uncontaminated space, 0.5 µl of the second gel composition solution was dispensed into each well of a 96-well plate at 1 µm intervals and gelled using UV. Through this, a target substance detection kit with a gel spot to which a nucleic acid that specifically binds to an isothermal amplification product for a target substance is fixed or bound was prepared.

Example 2. Detection of viruses and bacteria causing acute respiratory infections

Chlamydophila pneumonia Omp A gene DNA was synthesized by Bioneer Co., Ltd. and used as a template. An isothermal amplification composition for Chlamydophila pneumonia was added to the target substance detection kit prepared in Example 1 and reacted at 60° C. for 1 hour. Thereafter, fluorescence was analyzed by washing with a washing buffer. When using a kit with a hydrogel fixed with streptavidin, the forward outer primer, biotin-forward inner primer, reverse outer primer, FITC-reverse outer primer, reverse inner primer, dNTP, Bst polymerase and buffer are isothermal. It was used as an amplification composition. In addition, in the case of using the kit to which the hydrogel to which the acrylicdite-forward inner primer is fixed is used, the forward outer primer, the forward inner primer, the reverse outer primer, the FITC-reverse outer primer, the reverse inner primer, dNTP, Bst polymerase and The buffer was used as an isothermal amplification composition.

5 is a result of fluorescence analysis by isothermal amplification after fixing streptavidin on a gel, and FIG. 6 is a result of fluorescence analysis by isothermal amplification after binding an Acrydite-nucleic acid probe to the gel. Positive is a group containing a target substance, Negative is a group that does not contain a target substance, w/o dntp is a group that does not contain nucleoside triphosphate, and a non-target probe is a group in which a nucleic acid probe for a substance other than the target substance is immobilized on the hydrogel, Control Means untreated hydrogel.

As shown in FIGS. 5 and 6, when the target material was present, it was confirmed that fluorescence was detected only in the gel to which the nucleic acid probe for the target material was immobilized, indicating a differentiation effect.

<110> Samsung Life Public Welfare Foundation <120> Kit for detecting target materials and method for detecting target materials using the same <130> PN120198 <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Streptococcus pneumoniae <400> 1 tcagacagag tggaagca 18 <210> 2 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Streptococcus pneumoniae <400> 2 cctgttacaa ctcgggcacc gattttggac aatacagaag tgaa 44 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Streptococcus pneumoniae <400> 3 gcaactacat tgtcacgtaa 20 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Streptococcus pneumoniae <400> 4 aaggtggata tggtagagga cttgagttgt ataggaaatc ggcaa 45 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Haemophilus influenzae <400> 5 ctcatttagg agaaatctaa tgaac 25 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Haemophilus influenzae <400> 6 gcatcgttgt tagaggaact acaagaaatc attattagtt gcaggttctg 50 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Haemophilus influenzae <400> 7 gtgatgtcgt atttatcaaa acc 23 <210> 8 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Haemophilus influenzae <400> 8 aggcaatggt gctgctcaaa gttgtaacgt tgttgaagat cag 43 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Mycoplasma pneumoniae <400> 9 gctagagttt gactgtacca tt 22 <210> 10 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Mycoplasma pneumoniae <400> 10 cggataacgc ttgcgaccta tataagtgac gactaactat gtgc 44 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Mycoplasma pneumoniae <400> 11 aaaactccct accacactc 19 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Mycoplasma pneumoniae <400> 12 cgcaggcgga ttgaaaagtc tttccaatgc atacaactgt 40 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Chlamydophila pneumoniae <400> 13 aatgaactac caaacgtttc t 21 <210> 14 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Chlamydophila pneumoniae <400> 14 cattcccata aagctccacg agatggagtt gttgaactct acac 44 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Chlamydophila pneumoniae <400> 15 cttgggtttg tttacagaga a 21 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Chlamydophila pneumoniae <400> 16 cggttgtgca actttgggag gttacagatc acattaagtt cttca 45 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Metapneumovirus <400> 17 ttaagaatgc cctcaaaacg 20 <210> 18 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Metapneumovirus <400> 18 ctttcagctc tctcactgca gtagcagtat ctacattggg ga 42 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Metapneumovirus <400> 19 tctgttgaat tgactgaagc 20 <210> 20 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Metapneumovirus <400> 20 tgtgagcaag aatttaactc gtgccggcca tttttaggtc atc 43 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Coronavirus 229E <400> 21 agaaaatgta tttgctgttg aga 23 <210> 22 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Coronavirus 229E <400> 22 cctcacaaca ccatctacaa cagattggtg gttatatacc ctccg 45 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Coronavirus 229E <400> 23 aaacatctga ggaaaaacct t 21 <210> 24 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Coronavirus 229E <400> 24 gttgcttaat tgcttatggt ctgttatcac ctctcccagt acc 43 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Coronavirus OC43 <400> 25 acaatgtatg ttaggccgat 20 <210> 26 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Coronavirus OC43 <400> 26 gccaaagaat agccagtacc tagttaggac tatcatactc tgacgg 46 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Coronavirus OC43 <400> 27 acataaacag caaaaccact a 21 <210> 28 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Coronavirus OC43 <400> 28 agatttgcca gcttatatga ctgttatcgc ttatcctgtc aagaa 45 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward outer primer of Coronavirus NL63 <400> 29 ttccacacta gtggacgg 18 <210> 30 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Forward inner primer of Coronavirus NL63 <400> 30 ccagttgaag atttaagacc aggtactaga ctttatcaac cactccg 47 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Backward outer primer of Coronavirus NL63 <400> 31 ccaaagaatt agcactgaag tt 22 <210> 32 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Backward inner primer of Coronavirus NL63 <400> 32 taatgccact ggttctgatg ttaagtaacg cataacatca acaac 45

Claims (15)

A substrate on which a nucleic acid probe or antibody capable of specifically binding to an isothermal amplification product of a target nucleic acid is immobilized on or inside the hydrogel; And a set of primers capable of specifically binding to a target nucleic acid. The method according to claim 1, wherein the nucleic acid probe is a forward inner primer (FIP) of the target nucleic acid, a backward inner primer (BIP), a DNA having a base sequence complementary to the target nucleic acid, or a combination thereof. In kit. The kit of claim 2, wherein the nucleic acid probe has a linker capable of binding to a hydrogel at the 5'end. The kit of claim 2, wherein a linker capable of binding to a hydrogel is bonded to the 5'end of the forward inner primer or the reverse inner primer. The kit of claim 2, wherein a labeling material is bound to the 5'end of the forward inner primer or the reverse inner primer. The method of claim 5, wherein the labeling material is fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine ), FITC, Oregon green, Alexa Fluor, FAM, JOE, ROX, HEX, Texas Red, TET, TRITC, TAMRA, Cyanine series dyes and Ciadicarbo A kit that is one or more selected from the group consisting of cyanine (thiadicarbocyanine) dyes. The method according to claim 1, wherein the target nucleic acid is Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Metanumovirus, and Metanumovirus. Coronavirus 229E (Coronavirus 229E), Coronavirus NL63 (Coronavirus NL63), and Coronavirus OC43 (Coronavirus OC43) of one or more nucleic acids selected from the group consisting of a kit. The kit of claim 1, wherein the antibody is at least one selected from the group consisting of streptavidin, anti-digoxigenin, anti-tamra, and anti-texasred. The kit of claim 8, wherein graphene is further included in the hydrogel. The method according to claim 1, When the antibody is immobilized on the substrate, an external primer set capable of specifically binding to the target nucleic acid; And a forward inner primer or a reverse inner primer to form a complex. The kit according to claim 1, wherein a fluorescent signal is generated by displacement of the forward inner primer and the reverse inner primer during the isothermal amplification reaction. Obtaining a nucleic acid sample from the biological sample of the subject;
Contacting the sample with a substrate on which a probe or antibody capable of specifically binding to an isothermal amplification product of a target nucleic acid is immobilized on the surface or inside of the hydrogel; And
A method for multiple detection of a target material comprising the step of performing an isothermal amplification reaction by adding a composition for isothermal amplification. The method of claim 12, wherein the composition for isothermal amplification comprises an inner primer set and an outer primer set. The method of claim 12, wherein the isothermal amplification reaction is carried out at 30 to 75°C for 20 to 120 minutes. The method of claim 12, wherein the target substance is detected by measuring the emitted fluorescence signal.

Images