CN115820889A

CN115820889A - CrRNA and CRISPR Cas12a system for detecting helicobacter pylori and application thereof

Info

Publication number: CN115820889A
Application number: CN202211689813.7A
Authority: CN
Inventors: 李志远; 黄荣奇; 杨帆; 巫林平
Original assignee: Guangzhou Qiyuan Biopharmaceutical Co ltd
Current assignee: Li Zhiyuan
Priority date: 2022-12-27
Filing date: 2022-12-27
Publication date: 2023-03-21

Abstract

The invention provides a crRNA, a CRISPR Cas12a system and an application thereof for detecting helicobacter pylori, wherein the crRNA respectively targets a CagA gene and a VacA gene, the nucleotide sequence of the crRNA targeting the CagA gene is shown as SEQ ID NO:5, and the nucleotide sequence of the crRNA targeting the VacA gene is shown as SEQ ID NO: 6. The invention provides a novel method for detecting helicobacter pylori according to pathogenicity and genetic heterogeneity of strains based on LbCas12, which is different from the traditional serum antibody detection method and urea breath test method, and can accurately, conveniently and quickly obtain the detection result of the helicobacter pylori. The invention uses a new reaction matrix to avoid using various chemical reagents to treat DNA, is a simple, convenient and efficient detection method, and has wide application prospect.

Description

CrRNA and CRISPR Cas12a system for detecting helicobacter pylori and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a crRNA and CRISPR Cas12a system for detecting helicobacter pylori and application thereof.

Background

CRISPR/Cas systems have become powerful tools for genetic engineering and molecular diagnostics. CRISPR/Cas are currently divided into two broad categories based on their structure and genetic characteristics, and these categories can be further divided into six subclasses (I to VI) and 33 subtypes based on the function, mode of action and structure of effector proteins. The first major class of CRISPR/Cas systems (i.e., subclasses I, III, and IV) uses a multi-protein cascade (e.g., cas 3) to accomplish interference, while the second major class of systems (i.e., subclasses II, V, and VI) uses a single multi-domain effector protein (e.g., cas9, cas12, cas13, and Cas 14) to accomplish interference.

More specifically, the Cas12 protein is a class 2V-type RNA-guided ribonucleoprotein. Class 2V ribonucleoproteins are highly diverse and can be further divided into subtypes V-A, -B, -C, -D, -E, -F, -G, -H and-I. Subtypes V-A (i.e., cas12 Sup>A was previously referred to as Cpf 1) and V-B (Cas 12B or C2C 1) are commonly used for CRISPR/Cas-based diagnostics (CRISPR-Dx). Compared to Cas9, cas12 proteins from the Lachnospiraceae bacteria ND2006 (LbCas 12 a), amcina sp.bv3l6 (AsCas 12 a), francisella novicida U112 (FnCas 12 a), and geobacillus acidocaldarius (AacCas 12 b) have many intrinsic characteristics that make them attractive for diagnostic use.

Various CRISPR/LbCas 12-based diagnostic methods use single-stranded DNA (ssDNA) oligonucleotides (TTATT) as a conventional reporter (ConR) for signal readout upon recognition cleavage in the presence of the intended nucleic acid target. At present, few progress is made in the research aspect of a CRISPR/LbCas 12-based diagnostic method, but a significant gap is still left in the aspect of identifying LbCas12a substrate preference as a main signal amplification component of a CRISPR/LbCas12a system, so that the universal applicability of the method is limited. CRISPR/LbCas12a is still in the infancy stage, and more progress needs to be made in the trans-cleavage activity to improve its level of diagnostic utility.

Helicobacter pylori (h. Pylori) is a pathogenic bacterium that colonizes the human gastric mucosa and is currently known to be associated with the pathogenesis of gastritis, duodenal ulcer, gastric cancer and rare mucosa-associated lymphoid tissue (MALT) lymphoma. Helicobacter pylori has been classified as a human class I carcinogen by the international agency for research on cancer (IARC). The helicobacter pylori strains are more and heterogeneous, and not all the individuals infected by the helicobacter pylori can develop the diseases, and the pathogenicity of the helicobacter pylori is mainly related to CagA and VacA genes. Therefore, detection of H.pylori carrying CagA and VacA genes is particularly critical for the prevention and treatment of the above-mentioned related diseases.

More than half of the population is infected with helicobacter pylori, which is associated with gastritis, duodenal ulcers, gastric cancer, and rare mucosa-associated lymphoid tissue (MALT) lymphomas. Timely detection and treatment of helicobacter pylori are important means for reducing the occurrence of the diseases, however, no research reports that the helicobacter pylori is detected by using CRISPR/LbCas12a according to pathogenicity and genetic heterogeneity of the strain at present. Different strains of helicobacter pylori and its expression factors can induce different changes in the gastric mucosa, and therefore, diagnosis based on the strongly pathogenic genotype of helicobacter pylori can provide information for identifying high-risk individuals, and help helicobacter pylori infected persons receive appropriate treatment.

Detection and diagnosis of helicobacter pylori infection are diverse, and include invasive methods such as histological examination, culture, rapid urease assay (RUT), and Polymerase Chain Reaction (PCR) assay; non-invasive detection methods, such as Urea Breath Test (UBT) and serological tests. The current methods have many disadvantages, such as invasive methods require endoscopy and require more than 3 days to obtain results, while PCR detection has major disadvantages of high cost, long turnaround time, and the need for thermocyclers unsuitable for on-site detection. Serological assays are often unable to distinguish between current and past infections and the heterogeneity of H.pylori strains due to their reliance on the presence of antibodies. Urea Breath Test (UBT) is currently considered the "gold standard" for clinical detection of helicobacter pylori, using the same principle as RUT, however, its reading of results requires expensive laboratory-centric instruments (spectrometers) and can be disturbed by other bacteria in the gastrointestinal tract. In addition, the above methods are desired to be improved in terms of sensitivity, specificity, speed, and ease of use.

Therefore, the novel helicobacter pylori detection method which is different from the traditional serum antibody detection method and the traditional urea breath test (carbon 13/14 detection) method, simple, convenient and efficient is provided, and the application prospect is wide.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a crRNA, a CRISPR Cas12a system for detecting helicobacter pylori and application thereof. The invention provides a novel method for detecting helicobacter pylori according to pathogenicity and genetic heterogeneity of strains based on LbCas12, which is different from the traditional serum antibody detection method and a urea breath test (carbon 13/14 detection) method, samples which can be detected by the method comprise gastric biopsy, excrement, saliva samples and the like, the method can only use saliva samples or excrement of a detected person, and the method can obtain the detection result of the helicobacter pylori more accurately, conveniently and quickly. The method uses a new reaction matrix, avoids using various chemical reagents to treat DNA, is a simple, convenient and efficient novel helicobacter pylori detection method, and has wide application prospect.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a crRNA for helicobacter pylori detection, the crRNA targeting the CagA gene and the VacA gene, respectively;

the nucleotide sequence of crRNA targeting the CagA gene is shown as SEQ ID NO. 5;

the nucleotide sequence of the crRNA targeting the VacA gene is shown as SEQ ID NO. 6.

In the invention, the crRNA is used for guiding the Cas12a protein to recognize and bind to the LAMP-amplified sequence to cut a target sequence and simultaneously cut any single-stranded DNA in a reaction system.

In a second aspect, the invention provides the use of the crRNA for detecting helicobacter pylori according to the first aspect in the preparation of a helicobacter pylori detection product.

In a third aspect, the present invention provides a CRISPR Cas12a system for detecting helicobacter pylori, the CRISPR Cas12a system comprising the crRNA for detecting helicobacter pylori according to the first aspect.

Preferably, the CRISPR Cas12a system further comprises a Cas12a protein, a LAMP amplification primer, a fluorescently-labeled ssDNA reporter gene, a LAMP amplification system and a Cas12a cleavage reaction system;

or the CRISPR Cas12a system further comprises a Cas12a protein, a LAMP amplification primer, a biotin-labeled ssDNA reporter gene, a capture probe, a LAMP amplification system and a Cas12a cleavage reaction system.

In the invention, when a real-time fluorescence detection method is adopted for detection, the used ssDNA reporter gene is a fluorescence-labeled ssDNA reporter gene; when the assay is performed by Lateral Flow Assay (LFA), the ssDNA reporter gene used is a biotin-labeled ssDNA reporter gene.

Preferably, the LAMP amplification primers comprise an outer primer, an inner primer and a loop primer.

Preferably, the outer primers comprise CagA F3, cagA B3, vacA F3 and VacA B3; the nucleotide sequence of CagA F3 is shown as SEQ ID NO. 7, the nucleotide sequence of CagA B3 is shown as SEQ ID NO. 8, the nucleotide sequence of VacA F3 is shown as SEQ ID NO. 13, and the nucleotide sequence of VacA B3 is shown as SEQ ID NO. 14.

Preferably, the inner primer comprises CagA FIP, cagA BIP, vacA FIP and VacA BIP; the nucleotide sequence of CagA FIP is shown as SEQ ID NO. 9, the nucleotide sequence of CagA BIP is shown as SEQ ID NO. 10, the nucleotide sequence of VacA FIP is shown as SEQ ID NO. 15, and the nucleotide sequence of VacA BIP is shown as SEQ ID NO. 16.

Preferably, the loop primer comprises CagA LoopF, cagA LoopB, vacA LoopF, vacA LoopB; the nucleotide sequence of CagA LoopF is shown as SEQ ID NO. 11, the nucleotide sequence of CagA LoopB is shown as SEQ ID NO. 12, the nucleotide sequence of VacA LoopF is shown as SEQ ID NO. 17, and the nucleotide sequence of VacA LoopB is shown as SEQ ID NO. 18.

Preferably, the fluorescently labeled ssDNA reporter comprises a fluorescein-quencher ditag reporter or a fluorescein-biotin ditag reporter.

Preferably, the fluorescein comprises carboxyfluorescein or 6-carboxy-2 ', 4',5', 7' -hexachlorofluorescein succinimidyl ester (HEX) and the quencher comprises tetramethylrhodamine or a dark quencher (BHQ 1).

Preferably, the sequence of the fluorescently labeled ssDNA reporter gene is selected from any one of SEQ ID NOS 19-33 or a combination of at least two of SEQ ID NOS.

Preferably, the sequence of the biotin-labeled ssDNA reporter gene is selected from any one of SEQ ID NO 19-33 or a combination of at least two thereof.

Preferably, the sequence of the capture probe is selected from any one of SEQ ID NO 34-58 or a combination of at least two thereof.

Preferably, the LAMP amplification system comprises, in final concentration: dNTPs 1-1.8mM (for example, 1mM, 1.2mM, 1.4mM, 1.6mM, or 1.8 mM), mgSO ₄ 4-8mM (e.g., 4mM, 5mM, 6mM, 7mM, or 8 mM), bst DNA polymerase 310-320U/mL (e.g., 310U/mL, 312U/mL, 314U/mL, 316U/mL, 318U/mL, or 320U/mL), primer F3.2-0.25 μ M (e.g., 0.2 μ M, 0.21 μ M, 0.22 μ M, 0.23 μ M, 0.24 μ M, or 0.25 μ M), primer B3.2-0.25 μ M (e.g., 0.2 μ M, 0.21 μ M, 0.22 μ M, 0.23 μ M, 0.24 μ M, or 0.25 μ M), primer FIB 1-1.6 μ M (e.g., 1 μ M, 1.2 μ M, 1.3 μ M, 1.4 μ M, 1.5 μ M, or 1.6 μ M), primer FIB 1.6 μ M (e.g., 1.42 μ M, 0.45 μ M, or 0.45 μ M), primer FIB 4 μ M, or 0.45 μ M (e.42 μ M), or 0.45 μ M).

Preferably, the LAMP amplification conditions are: incubating at 55-65 deg.C (such as 55 deg.C, 58 deg.C, 60 deg.C, 62 deg.C or 65 deg.C) for 10-30min (such as 10min, 15min, 20min, 25min or 30 min).

Preferably, the Cas12a cleavage reaction system comprises, in final concentration: cas12a 40-80nM (e.g., can be 40nM, 50nM, 6)0nM, 70nM or 80nM, etc.), crRNA 40-60nM (e.g., 40nM, 45nM, 50nM, 55nM or 60nM, etc.), and MgSO ₄ 5-10mM (for example, 5mM, 6mM, 8mM, or 10 mM).

Preferably, the Cas12a cleavage reaction system further comprises CEXTRAR buffer, wherein the CEXTRAR buffer comprises the following components by mass: 40-80mM potassium acetate, 10-30mM Tris acetic acid, 10-25mM magnesium acetate, 0.5-1mM tricarboxyethyl phosphine (TCEP) and 10-20mM Dithiothreitol (DTT), pH is 7.9-8.5, and solvent is water.

The mass concentration of potassium acetate in the CEXTRAR buffer solution is 40-80mM, for example, 40mM, 45mM, 50mM, 55mM, 60mM, 65mM, 70mM, 75mM or 80 mM; the mass concentration of Tris acetate is 10-30mM, for example, 10mM, 15mM, 20mM, 25mM or 30 mM; the mass concentration of magnesium acetate is 10-25mM, and may be, for example, 10mM, 12mM, 15mM, 17mM, 20mM, 22mM or 25 mM; the concentration by mass of Tricarboxyethylphosphine (TCEP) is 0.5-1mM, and may be, for example, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, or 1 mM; dithiothreitol (DTT) is contained in a mass concentration of 10 to 20mM, for example, 10mM, 12mM, 14mM, 16mM, 18mM, or 20 mM; the pH is 7.9 to 8.5, and may be, for example, 7.9, 8.0, 8.2, 8.4 or 8.5.

In the invention, when the real-time fluorescence detection method is adopted for detection, the used ssDNA reporter gene is a fluorescence-labeled ssDNA reporter gene, and the concentration of the fluorescence-labeled ssDNA reporter gene is 100-1600nM (for example, 100nM, 400nM, 800nM, 1200nM or 1600 nM); the ssDNA reporter used is a biotinylated ssDNA reporter at a concentration of 100-1600nM (e.g., 100nM, 400nM, 800nM, 1200nM, 1600nM, etc.) as measured by Lateral Flow Assay (LFA).

Preferably, the conditions of the Cas12a cleavage reaction are: incubating at 36-42 deg.C (such as 36 deg.C, 37 deg.C, 38 deg.C, 40 deg.C or 42 deg.C) for 30-60min (such as 30min, 40min, 50min or 60 min).

In a fourth aspect, the invention provides a detection kit for rapidly detecting helicobacter pylori based on CRISPR Cas12a, and the detection kit contains the CRISPR Cas12a system for detecting helicobacter pylori in the third aspect.

In a fifth aspect, the present invention provides a method for rapid detection of helicobacter pylori based on CRISPR Cas12a, the method comprising: and (3) detecting a sample to be detected by using the CRISPR Cas12a system for detecting the helicobacter pylori, which is described in the third aspect.

Preferably, when the CRISPR Cas12a system employs a Cas12a protein, crRNA, a fluorescein-quencher double-labeled reporter gene and a LAMP amplification product, the detection result is read by observing the fluorescence value of a cleavage product after Cas12a cleavage reaction.

Preferably, when the CRISPR Cas12a system adopts Cas12a protein, crRNA, fluorescein-biotin double-labeled probe, capture probe and LAMP amplification product, the detection result is read by coupling reaction of cleavage product after Cas12a cleavage reaction and lateral flow assay.

Preferably, the method for rapidly detecting helicobacter pylori based on CRISPR Cas12a further comprises a pretreatment method of a sample to be detected, wherein the pretreatment method comprises the following steps: the helicobacter pylori is resuspended in a Triton X-100 solution at a concentration of 0.2 to 2% (e.g., 0.3%, 0.4%, or 0.5%), centrifuged at 8000 to 14000rpm (e.g., 8000rpm, 12000rpm, 13000rpm, or 14000 rpm) for 1 to 2min (e.g., 1min, 1.5min, or 2 min), the supernatant is removed, and the resulting precipitate is resuspended in the Triton X-100 solution and then detected.

In a sixth aspect, the invention provides an application of the CRISPR Cas12a system for detecting helicobacter pylori according to the third aspect in preparing a helicobacter pylori detection product.

The numerical ranges set forth herein include not only the points recited above, but also any points between the numerical ranges not recited above, and are not exhaustive of the particular points included in the ranges for reasons of brevity and clarity.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention establishes a novel method for diagnosing helicobacter pylori. The nonspecific endonuclease activity of the extended reporter gene using LbCas12a is higher than that of the traditional reporter gene. The reporter gene of the invention has 4 times high fluorescence, high sensitivity, rapid turnaround time and good signal-to-background ratio. By using the customized reporter gene and the reducing agent of the invention to improve the detection effect, the overall sensitivity of the invention is improved by 16 times compared with the traditional reporter (ConR). These data indicate that length selection of the reporter gene and appropriate fine-tuning of the buffer formulation can result in significant LbCas12a anti-cleavage activity, while increasing sensitivity and fast response time. Because the labeling cost is the same, the novel reporter gene can be used for real-time fluorometer or in-tube fluorescence detection, the application range of CRISPR/LbCas12a is expanded, and a new way is provided for researching more novel reporter genes.

(2) The LFS in the present invention is cheaper (us $ 0.1, excluding CRISPR reagents), can be used for field testing, has high sensitivity and specificity, the accuracy of the LFS is high, and the detection process is simple and fast.

(3) The sample processing process is simplified, and the labor cost is reduced. The invention develops a simple Triton X-100 extraction method, which does not need to use various chemicals and purification steps and reduces the loss of samples. Essentially, the present invention is an ultrasensitive and cost-effective method that does not require any sample enrichment steps. The present invention uses minimal sample processing, reduces manual sample handling, and ensures that high throughput analysis of several samples taken is not required in a clinical setting. The compatibility of the invention with stool and saliva as the diagnostic sample source simplifies the sampling and diagnosis of helicobacter pylori, and avoids the need for invasive detection methods of gastric biopsy samples. The sample processing methods of the invention can also be extended to other CRISPR/Cas-based diagnostics.

Drawings

Figure 1 shows that CEXTRAR buffer works better in LbCas12 a-mediated cleavage;

FIG. 2 shows the extraction results of different DNA extraction strategies;

FIG. 3 shows the results of Triton X-100 lysis compared to the Tiangen biotechnological genomic DNA extraction kit CEXTRAR;

FIG. 4 shows the results of CEXTRAR detection of H.pylori in artificially contaminated milk;

figure 5 shows that the reporter gene increases the rate, signal to background ratio and turnaround time of LbCas12a trans-cleavage activity;

figure 6 shows that the reporter gene enhances LbCas12a trans-cleavage activity, signal to background ratio, turn-around time, and sensitivity;

FIG. 7 shows the results of comparison and concentration optimization of fluorescent ssDNA reporter genes (2T and 10T);

figure 8A shows the corresponding trans-cleavage activity in LbCas12 a-mediated cleavage reaction using reporter (2T) and NEB buffer 2.1 buffer;

figure 8B shows the corresponding trans-cleavage activity in LbCas12 a-mediated cleavage reaction using reporter (10T) and CEXTRAR buffer;

figure 8C shows the results of studies and optimization of LbCas12 a-mediated cleavage reaction enhancing buffer components;

FIG. 9 shows the Lateral Flow Strip (LFS) design and operating principle for helicobacter pylori detection;

fig. 10 shows the test line signal customization and optimization experimental results.

Detailed Description

The invention develops a novel helicobacter pylori detection method based on a CRISPR/LbCas12a system, wherein a special DNA extraction technology is not needed for a novel customized reporter gene, a capture probe, an enhanced buffer solution and a clinical sample, and compared with the traditional detection method, the detection result of the helicobacter pylori can be obtained more accurately, conveniently and rapidly. The helicobacter pylori detection method comprises the following steps: CRISPR/LbCas12 a-based Lateral Flow Assay (LFA), CRISPR/LbCas12 a-based real-time fluorescence detection.

(1) The cleavage activity of LbCas12a nuclease was increased by extending ConR.

The invention uses ConR (5 ' -TTATT-3', hereinafter referred to as 2T) to generate customized reporter genes (4T, 6T, 8T and 10T) with different lengths by extending thymine base to the 5' end of the ConR and then labeling with fluorophore, tetramethylrhodamine (TAMRA) at both ends. This method can help to examine samples of clinical patients in real time without delay due to the need for ancillary equipment to read the results. The invention improves the fluorescence signal by prolonging the reporter, accelerates the turnover reaction, for example, the fluorescence intensity of the 10T reporter is 3.2 times of that of the 2T reporter, and the reaction signal of 10T can be observed in the first 5 minutes by real-time fluorescence detection. The invention also finds that the optimal concentration of the reporter genes mixed in different proportions with the highest signal-to-noise ratio is 400nM.

(2) LbCas12a reaction buffer component capable of remarkably improving trans-cleavage activity

In the case of trans-cleavage, the formulation and composition of the buffer system largely determines the spontaneous formation of higher order structures that are critical to protein function. The invention discovers that one LbCas12a reaction buffer component can obviously improve the trans-cleavage activity, thereby improving the sensitivity and the reaction speed. In several studies, trans-cleavage activity of LbCas12a was performed by a commercial partner buffer NEB buffer 2.1 of LbCas12 a. The results of the present invention indicate that NEB buffer 2.1 is a suboptimal buffer for LbCas12a mediated cleavage. Studies have shown that multiple interactions stabilize the intrinsic structure of several proteins, determining their conformation, folding and flexibility. Disulfide bonds are formed between the sulfur atoms of two cysteine residues in a protein and are one of the covalent bonds common in nature. During the unfolding process, the loss of disulfide bridges of native proteins is usually assessed by subjecting the proteins to highly reducing conditions. Cas12a has 9 cysteine residues in total as shown by the study. This may be a large number sufficient to control the folding pattern and catalytic cleavage of ssDNA substrates completely into the Cas12a protein, thereby reducing the trans-cleavage activity. Thus, the present invention predicts that structural interference of the reducing agent with cysteine residues can promote the trans-cleavage activity by disrupting the disulfide bridge pattern. The research result shows that Dithiothreitol (DTT) or tris (2-chloroethyl) phosphate (TCEP) buffer has obviously better enhancement effect on the trans-cleavage activity of LbCas12a than other reducing agents. Thus, the present invention evaluated the sensitivity of 10T in combination with DTT buffer to 2T and NEB2.1 buffers. The results of the present invention show that the sensitivity of 10T &DTT buffer (CEXTRAR buffer) is improved by 16 times compared with 2.1 of 2T &NEB buffer.

(3) Increasing sensitivity of LbCas12 a-mediated trans cleavage with LAMP

In some clinical samples, there may be cases where the bacterial load is not significant, and a low concentration of nucleic acid is insufficient for diagnosing helicobacter pylori, and therefore, the effect of detection can be increased by increasing the concentration of nucleic acid through amplification. Polymerase Chain Reaction (PCR) has become the gold standard method for nucleic acid amplification. However, PCR requires a long turnaround time of about 3 hours, and depending on the skill of the operator, expensive thermocyclers also increase the implementation complexity of the point-of-care (POC) framework. In addition, several other isothermal Amplification techniques have been reported, such as Recombinant Polymerase Amplification (RPA) and loop-mediated isothermal Amplification (LAMP), which are widely used due to their simplicity and good sensitivity. Due to the incompatibility of enzymes, RPA is not conducive to increasing the sensitivity of CRISPR/Cas3/Cas12/Cas 13-based one-pot reactions. Thus, the present invention selects LAMP to improve sensitivity. The invention finds that LAMP improves the sensitivity of LbCas12a mediated trans-cleavage.

(4) CRISPR/Cas12 a-based Lateral Flow Assay (LFA)

In the present invention, a new alternative helicobacter pylori diagnostic method is proposed, which does not need to use FAM-TAMRA fluorescent reporter gene, but designs other novel biotinylated reporter genes and simultaneously designs complementary capture probes thereof for LFA. In the present invention, LFAs are also based on CRISPR/Cas12a trans-cleavage mechanisms. Based on the traditional fluorescent reporter gene ConR (FAM-TTATT-TAMRA), the present invention customizes a biotinylated reporter gene that can hybridize to complementary capture probes on the test line of LFS. The reporter gene (Bio-TTTTTTATT) can be strongly hybridized with a 32 base ssDNA capture probe on an LFS test line; however, once cleaved by Cas12a, the reporter gene cannot be detected. Thus, upon DNA extraction and Cas12a reaction, when the CRISPR/Cas12a mixture is placed on the sample pad, it migrates to the conjugate pad containing the gold nanoparticle-conjugated streptavidin (AuNP-SA) complex and flows through the NC membrane towards the test and control lines. biotin-ssDNA reporter gene aggregation was shown to be negative on the test line, whereas visual disappearance of the red test line indicated positive detection by efficient reverse lysis of the reporter gene. That is, in the present invention, LFS shows two bands of a helicobacter pylori negative sample and one band of a helicobacter pylori positive sample.

(5) CRISPR/Cas12 a-based real-time fluorescence detection method

Since the custom reporter of the present invention produces a significant fluorescent signal using a real-time fluorometer, the excitation and emission wavelengths of the fluorophore-labeled reporter can be used to design an in-tube fluorescent reading using a simple single wavelength Light Emitting Diode (LED). Therefore, the invention can realize the reading of the fluorescence in the tube, and is convenient and quick. The LAMP and CRISPR reagents are respectively placed at the bottom and inside the tube cover, 10 minutes of LAMP reaction is firstly carried out, and then the subsequent CRISPR reaction is carried out. After the reaction is finished, the positive and negative results can be distinguished by the color change of the patient sample at the wavelength of about 254 nm. The color changed to orange in the absence of H.pylori and to green in the presence of H.pylori. Therefore, the method of the present invention can not only prevent aerosol pollution, but also reduce separate reaction processes, reduce manual sampling, and ensure large-scale expandability. The LED fluorescent reading in the tube can realize bidirectional data control, and the mobile phone can check the result in real time, so that the applicability is wide.

In addition, in order to reduce the analysis time, the manual handling of samples and the complexity of DNA extraction, the extraction effect in the case of different lysis buffers, chemical treatments, heat treatments and the like was investigated using cultured H.pylori cells. In these cases, heating (95 ℃ C., 5 min) or chemical treatment alone may result in a decrease in DNA yield. The use of the non-ionic detergent Triton X-100 treated medium, together with an initial centrifugation step of 12000rpm for 1min, improved DNA yield compared to several other heat and chemical treatment combinations, and showed a 2-fold greater DNA yield than the TIANGEN kit, which can be attributed to several purification steps using many buffers.

To validate the effectiveness of the present invention for total DNA extraction and detection of helicobacter pylori in clinical specimens, including gastric biopsies, stool and saliva specimens, were examined and initially validated using the 13C urea breath test. Extraction of Triton X-100 was found to be suitable only for saliva and feces, and not for gastric biopsy. In the analysis of saliva and feces, a centrifugation step, which is a prerequisite for the extraction of the culture medium of H.pylori cells, is not necessary.

The present invention also finds that saliva and feces can be analyzed without an initial scale-up step. This is also associated with high tolerance of LbCas12a to matrix effects. I.e., CRISPR/LbCas12a mediated trans cleavage directly using saliva without any treatment and pre-amplification. Stool samples were diluted with Triton X-100, shaken or vortexed, and the supernatant was used directly for CRISPR/LbCas12a mediated trans cleavage without further treatment and pre-amplification. However, gastric biopsy requires extraction, amplification and analytical validation using commercial extraction kits, since the concentration of bacterial load in the biopsy is not high.

The detection method of the present invention has great potential in non-invasive helicobacter pylori diagnosis, utilizes a rapid detection method, does not require the use of a genomic DNA extraction procedure, and can be applied to diagnosis of other infections.

The noun explains: CEXTRAR: lbCas12a trans-cleavage activity with extended reporters and reductants, the inverse cleavage activity of LbCas12a with an extended reporter and a reducing agent.

The technical solution of the present invention is further explained by the following embodiments. It should be understood by those skilled in the art that the examples are only for the understanding of the present invention and should not be construed as the specific limitations of the present invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1crRNA design, primer selection and LAMP detection

The present embodiment provides a crRNA and LAMP primer for helicobacter pylori detection, and the core of the CRISPR Cas12a detection method lies in the crRNA, so the selection of the crRNA is directly related to the effectiveness of the final detection method.

The targeted genes for helicobacter pylori (CagA and VacA) were cloned into pUC57 vectors, respectively, as shown below.

Cloning a target gene #, wherein the CagA gene SEQ ID NO is 1:

tggtgtaaacagaaccctagtcggtaatgggttatctaaagcagaagccacaactctttctaaaaacttttcggacatcaagaaagagttgaatgcaaaacttggaaatttcaataacaataacaataatggactcaaaaacgaacccatttatgctaaagttaataaaaagaaaacaggacaagtagctagccctgaagaacccatttatgctcaagttgctaaaaaggtaaatgcaaaaattgaccgactcaatcaaatagcaagtggtttgggtggtgtagggcaagcagcgggcttccctttgaaaaagcatggtaaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctcaagttgctaaaaaggtaaatgcaaaaattgaccgactcaatcaaatagcaagtggtttgggtggtgtaggg caagcagcgggcttccctttgaaaaagcatggtaaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctacaattgatgatcttggcggacctttccctttgaaaaggcatgataaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctacaattgatgatcttggcggacctttccctttgaaaaggcatgataaagttgatgatctcagtaaggtagggctttcaaggaatcaagaat。

cloning target gene #, vacA gene SEQ ID NO:2:

aagttggtggtattgccaccattctcagtaggcgtagaattgcctaaataatacaccgagattttagagccgttagccgttttactgatgcctatatttctccatgccttaccgataagatacttgtaattgtcagggttgttcaccatgctttgattgccgatagccataccgcatgctttaatgtcatcagtatttcgcaccacacaagtatccatgcggttattgttgttataaagggctaggcgctctttgaattgctcttctagattaacattactaatgccattggtacctgtagaaacattaccataaccaatgattttcgctttcaataaaacatgctctgtatttttaatgagatcttgagcgctgttaatcttgatgagcggtttgtaaaatccggtcgcgctgtctatatcattattaaacatcatagctgctgcattgcctacatttaaggttgccactttcccacctcggaccagatagttgatagtgccttgattgttgataaaatccccctgaatggttaaatttgaaaattgactatagtccatgaccgcattttgacccagggttagattattaaacatgagctttgatgtgccccaagggttttctggggttgaagaagcgaattttttggtgatttcaacatttttaatattcctagcgtcaaaataattccaagggctatagtaaaactcatctataaccaatttttcgccg。

expected LAMP amplicon, cagA gene amplicon 471bp, SEQ ID NO:

aaatagcaagtggtttgggtggtgtagggcaagcagcgggcttccctttgaaaaagcatggtaaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctcaagttgctaaaaaggtaaatgcaaaaattgaccgactcaatcaaatagcaagtggtttgggtggtgtagggcaagcagcgggcttccctttgaaaaagcatggtaaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctacaattgatgatcttggcggacctttccctttgaaaaggcatgataaagttgatgatctcagtaaggtagggcgatcagttagccctgaacccatttatgctacaattgatgatcttggcggacctttccctttgaaaaggcatgataaagttgatgatctcagtaaggtagggctttcaaggaatcaag。

expected LAMP amplicon, vacA gene amplicon 293bp, SEQ ID NO:

gtattgccaccattctcagtaggcgtagaattgcctaaataatacaccgagattttagagccgttagccgttttactgatgcctatatttctccatgccttaccgataa gatacttgtaattgtcagggttgttcaccatgctttgattgccgatagccataccgcatgctttaatgtcatcagtatttcgcaccacacaagtatccatgcggttattgttgtt ataaagggctaggcgctctttgaattgctcttctagattaacattactaatgccattggtacctgtaga。

specific crRNAs and LAMP primers for the CagA and VacA genes were designed using Benchling and Premier Biosoft online databases, respectively. All crrnas (table 1) and LAMP primers (table 2) were verified for specificity and mismatch using NCBI-BLAST and MEGA X, respectively.

The target sequence of the guide RNA is underlined in the sequences.

TABLE 1

TABLE 2

Serial number	Primer and method for producing the same	Sequence (5 '-3')
			SEQ ID NO:7	CagA F3	AAATAGCAAGTGGTTTGGGT
SEQ ID NO:8	CagA B3	CTTGATTCCTTGAAAGCCCTA
			SEQ ID NO:9	CagA FIP	AAGGTCCGCCAAGATCATCAATAAGGTAGGGCGATCAGTT
SEQ ID NO:10	CagA BIP	TCAGTAAGGTAGGGCGATCAGTGTCCGCCAAGATCATCAAT
			SEQ ID NO:11	CagA LoopF	TGTAGCATAAATGGGTTCAGGG
SEQ ID NO:12	CagA LoopB	CCCTGAACCCATTTATGCTACA
			SEQ ID NO:13	VacA F3	GTATTGCCACCATTCTCAGT
SEQ ID NO:14	VacA B3	TCTACAGGTACCAATGGCA
			SEQ ID NO:15	VacA FIP	AAAGCATGGTGAACAACCCTGATAGCCGTTTTACTGATGCC
SEQ ID NO:16	VacA BIP	GCCGATAGCCATACCGCATTAACCGCATGGATACTTGTG
			SEQ ID NO:17	VacA LoopF	CTTATCGGTAAGGCATGGAGAA
SEQ ID NO:18	VacA LoopB	TGTCATCAGTATTTCGCACCA

Example 2 CRISPR Cas12a System for detection of helicobacter pylori

The embodiment provides a CRISPR Cas12a system for detecting helicobacter pylori, wherein the CRISPR Cas12a system comprises the crRNA and LAMP amplification primer, the Cas12a protein, the LAMP amplification system and a Cas12a cleavage reaction system which are described in the embodiment 1.

The LAMP reaction was carried out according to the NEB protocol, and each 25. Mu.L reaction system was composed as shown in Table 3 below:

TABLE 3

Components	Amount/concentration
		Target sample	2μL
Isothermal amplification buffer 10 times	2.5μL
		dNTPs	1.4mM
MgSO ₄	6mM
		Bst DNA polymerase	8U/L
F3/B3	0.2μM
		FIB/FIP	1.6μM
LoopF/LoopB	0.4μM
		Water (W)	Make up 25 μ L

The LAMP reaction condition is incubation at 65 ℃ for 10min.

When real-time fluorescence LAMP detection is carried out, the ssDNA reporter gene used is a fluorescence-labeled ssDNA reporter gene, SYTO-9 is added into the reaction system, and then incubation is carried out in a portable Dhelix-Q5 device (the excitation wavelength and the emission wavelength are 470nm and 520nm respectively). Amplicons were run on a 2% agarose gel at 100V for 45min. All dilutions were performed using nuclease-free water, and each reaction contained a negative control (no target template), unless otherwise indicated.

The preliminary CRISPR reaction of cis-and trans-cleavage was performed as follows. Each 20. Mu.L reaction is shown in Table 4:

TABLE 4

The CEXTRAR buffer (CEXTRAR buffer) in table 4 includes the following components at mass concentrations: 50mM potassium acetate, 20mM Tris acetic acid, 20mM magnesium acetate, 1mM Tricarboxyethylphosphine (TCEP) and 10mM Dithiothreitol (DTT), pH 8.5, and water (ddH) as solvent ₂ O)。

And (3) completely mixing the reaction system, putting the mixture into a portable Dhelix-Q5 isothermal fluorescence PCR instrument, incubating for 30min at 37 ℃, and monitoring the trans-cutting condition in real time.

Example 3 comparison of CEXTRAR buffer and NEB buffer 2.1

This example compares the trans-cleavage activity of CEXTRAR buffer and NEB buffer 2.1 by performing experiments using CEXTRAR buffer and NEB buffer 2.1, respectively, the experimental procedure being referred to example 1.

The reaction system for the experiment using NEB buffer 2.1 was formulated with reference to table 4, except that the 2x-4x CEXTRAR buffer was replaced with NEB buffer 2.1.

The results of the experiment are shown in fig. 1, which shows that CEXTRAR buffer works better in LbCas12 a-mediated trans cleavage. The formulation and composition of the buffer system largely determines the spontaneous formation of higher order structures that are critical to protein function. CEXTRAR buffer works better in LbCas12a mediated trans cleavage.

Example 4 pretreatment method of sample to be tested

In order to reduce the analysis time, the complexity of manual sample and DNA extraction, various lysis buffers, chemical treatments and heat treatments were explored with cultured H.pylori cells. This example provides a series of methods for pretreating a test sample, which is a helicobacter pylori cell. After pretreatment, CRISPR Cas12a system for detecting helicobacter pylori in example 2 was used for detection. This example uses various DNA extraction strategies with various chemistries and heat treatments:

ctrl: for the non-centrifuged sample, the medium containing H.pylori was directly detected, while for the centrifuged sample, the pellet was mixed with ddH ₂ Detecting after O mixing;

a: for the non-centrifuged sample, carrying out heat treatment on a culture medium containing helicobacter pylori, and detecting after the heat treatment; subjecting the centrifuged sample to heat treatment of a culture medium containing helicobacter pylori, removing the supernatant, and mixing the precipitate with ddH ₂ Detecting after O mixing;

b: adding proteinase K into a helicobacter pylori-containing culture medium of an un-centrifuged sample, wherein the final concentration of the proteinase K is 2mg/mL, and directly detecting the proteinase K after heat treatment; adding proteinase K into culture medium containing helicobacter pylori to obtain a final concentration of 2mg/mL, heat treating, removing supernatant, and mixing precipitate with ddH ₂ And detecting after mixing the O.

C: for a sample which is not centrifuged, adding proteinase K and SDS into a culture medium containing helicobacter pylori, wherein the final concentration of the proteinase K is 2mg/mL, the addition amount of the SDS is 1%, and directly detecting the sample after heat treatment; adding protease K and SDS into culture medium containing helicobacter pylori, heat treating, removing supernatant, and mixing precipitate with ddH ₂ And mixing O and detecting.

D: for a sample which is not centrifuged, protease K, SDS and Triton X-100 are added into a culture medium containing helicobacter pylori, the final concentration of the protease K is 2mg/mL, the addition amount of the SDS is 1 percent, the addition amount of the Triton X-100 is 0.4 percent, and the detection is directly carried out after heat treatment; after centrifugation, the culture medium containing helicobacter pylori was supplemented with proteinase K, SDS and Triton X-100 in an amount of 0.4% by weight, and the same amount as that of the non-centrifuged sample was added, heat-treated, and the supernatant was removed, and the precipitate was mixed with Triton X-100 in an amount of 0.4% by weight and then examined.

E: adding 0.4% of Triton X-100 to the culture medium containing helicobacter pylori, and directly detecting the resultant sample after heat treatment; after centrifugation, 0.4% Triton X-100 was added to the culture medium containing helicobacter pylori, and after heat treatment, the amount added was the same as that of the non-centrifuged sample, and the supernatant was removed, and the precipitate was mixed with 0.4% Triton X-100 and then examined.

F: for the non-centrifuged sample, 0.4% Triton X-100 was added to the culture medium containing helicobacter pylori, and the sample was directly examined without heat treatment; after centrifugation, the culture medium containing helicobacter pylori was added with 0.4% Triton X-100, and the supernatant was removed without heat treatment, and the precipitate was mixed with Triton X-100 and then examined.

All heat treatments were carried out at 95 ℃ for 5min. All the centrifugations were carried out at 12000rpm for 1 min. FIG. 2 shows the extraction results of different DNA extraction strategies, where Ctrl, A, B, C, D, E and F in FIG. 2 correspond to different processing modes, respectively. In these cases, heating (95 ℃ C., 5 min) or chemical treatment alone may result in a decrease in DNA yield. The use of the non-ionic detergent Triton X-100 treated medium, and centrifugation at 12000rpm for 1min, improved DNA yield compared to several other heat and chemical treatment combinations.

Example 5 pretreatment method for clinical sample validation

In this embodiment, a clinical sample verification pretreatment method is adopted, and the sample to be detected is a clinical sample. After pretreatment, CRISPR Cas12a system for detecting helicobacter pylori in example 2 was used for detection.

To verify the effectiveness of total DNA extraction and detection of H.pylori in clinical specimens, this example examined clinical specimens, including milk samples containing H.pylori, stomach biopsies, stool and saliva specimens, which were initially verified using the 13C urea breath test.

Culturing helicobacter pylori: the method comprises culturing helicobacter pylori in LB culture medium containing aseptic defibrinated sheep blood and bacteriostatic agent at 37 deg.C, placing the culture plate, oxygen indicator and anaerobic gas generator (Qingdao Haibo biological Co.) in anaerobic culture bag, and culturing for 72h. The helicobacter pylori bacteriostatic agent contains 1mg of acridinium acid, 0.5mg of Trimethoprim (TMP), 0.3mg of vancomycin and 0.2mg of amphotericin B. This example used 54 clinical isolates (saliva, stool and stomach biopsy mucosa samples, which were validated by the 13C urea test) collected from 16 subjects (5 positive, 11 negative).

Preparing a milk sample added with a helicobacter pylori culture medium: the culture medium for helicobacter pylori was added to the milk sample in an amount of 100. Mu.L per 900. Mu.L of the milk sample.

(1) The method comprises the following steps of:

to compare the efficiency of Triton X-100DNA extraction, this example used a commercial TIANGEN Biotechnology extraction kit (Beijing Tiangen) and Triton X-100DNA extraction method, respectively, to extract 1mL of a milk sample containing helicobacter pylori. The extraction method of the TIANGEN kit is carried out according to the instruction of the kit. The Triton X-100DNA extraction method comprises the following steps: a1 mL sample of milk was centrifuged at 12000rpm for 1min, the supernatant discarded, and the pellet was mixed with 0.4% Triton X-100 and tested directly without any additional treatment.

FIG. 3 shows that Triton X-100 lysis was more effective compared to CEXTRAR of Tiangen biotechnological genomic DNA extraction kit. The use of Triton X-100 is 2 times greater than the TIANGEN kit in DNA yield, which can be attributed to the use of buffer in multiple purification steps.

FIG. 4 shows the results of CEXTRAR detection of H.pylori in artificially contaminated milk, and FIG. 4 shows that CEXTRAR has the ability to detect H.pylori in artificially contaminated milk, with lysis using Triton X-100 without the LAMP pre-amplification step.In FIG. 4, 1-8 from left to right indicate HP media + TIANGEN, HP media + Triton, whole mil k + HP media, whole mil k, 10% milk + HP media + Triton, 10% milk + HP media, 10% milk + HP media. HP media + TIANGEN (HP media + TIANGEN) indicates extraction of DNA in h.pyri media with TIANGEN Kit; HP media + Triton (HP media + Triton) indicates extraction of DNA in h.pyri medium with Triton X-100; whole milk + HP media + Triton (milk sample + HP medium + Triton) indicates the extraction of DNA from a milk sample supplemented with H.pylori medium using Triton X-100; whole milk + HP media indicates the use of ddH ₂ O replaces Triton X-100 to extract DNA in the milk sample added with the culture medium of the helicobacter pylori; white milk (milk sample) indicates that milk was used as a food sample for testing; 10% Milk + HP media + Triton (10% milk sample + HP medium + Triton) indicates that a sample of H.pyloi medium containing 10% milk was extracted using Triton X-100; 10% milk (10% milk sample) means that 10% milk sample was used as a food sample for the assay.

The present example also examined stool samples, saliva samples, and stomach biopsy specimens. The detection method is as follows:

stool sample: similar treatments were also performed on fecal samples using a commercial TIANGEN Biotechnology extraction kit (Beijing Tiangen) and Triton X-100DNA extraction method, respectively;

saliva sample: saliva samples were similarly processed using a commercial TIANGEN Biotechnology extraction kit (Beijing Tiangen) and Triton X-100DNA extraction method, respectively, without centrifugation. Saliva was treated with Triton X-100 and directly tested.

Stomach biopsy specimens: the gastric biopsy specimens were collected in physiological saline, extracted using the TIANGEN kit, and detected after amplification due to low bacterial load.

Example 6 CRISPR Cas12 a-based real-time fluorescence detection method

In this example, lbCas12a mediated in-tube fluorescence cleavage is used to detect the sample to be detected. The samples to be tested are gastric mucosa, feces and saliva samples. The detection method is as follows:

(1) The LAMP reaction is carried out according to the NEB protocol, and a reaction system is prepared according to the components shown in the table 3; the LAMP reaction condition is incubation at 65 ℃ for 10min.

(2) The preliminary CRISPR reaction of cis-form cracking and trans-form cracking is carried out according to the components shown in the table 4 to prepare a reaction system; after the reaction system is completely mixed, the mixture is put into a portable Dhelix-Q5 isothermal fluorescence PCR instrument, the trans-cutting condition is monitored in real time, and the reaction conditions are as follows: incubating at 37 deg.C for 0min, 10min, 20min, 30min, 40min, 50min or 60min.

The ssDNA reporter is labeled at both ends with the fluorophore Fluorescein (FAM) and the quencher Tetramethylrhodamine (TAMRA) for fluorescence-based assays. ssDNA reporter genes are shown in Table 5, and the underlined section is the optimized variable base for poly-thymine, which is used for customization and optimization of the reporter gene.

TABLE 5

Table 5 indicates that this sequence is the best reporter sequence.

Results as shown in fig. 5 and 6 below, fig. 5 shows that the reporter gene increases the rate, signal-to-background ratio, and turn-around time of LbCas12a trans-cleavage activity, and the fluorescence of the trans-cleavage signal increases in a manner that extends the reporter gene length dependence. As can be seen from fig. 5, extending the conventional reporter gene (TTATT, abbreviated as 2T in the present invention) at the 5' end, resulting in different lengths of reporter genes (2T, 4T, 6T, 8T, 10T), labeled with FAM and TAMRA, respectively, and subjected to LbCas12a detection, the fluorescence signal increases in an extended reporter length-dependent manner. Fig. 6 shows that the reporter gene enhances LbCas12a trans-cleavage activity, signal-to-background ratio, turnover time and sensitivity, and it can be seen from fig. 6 that the trans-cleavage activity and the signal-to-background ratio increase with the increase of the length and time of the report.

Example 7 comparison and concentration optimization of fluorescent ssDNA reporters (2T and 10T).

To verify the optimal use concentrations of the 2T and 10T reporter genes, this example compares the detection effect of different concentrations of the 2T and 10T reporter genes. Experimental methods refer to example 6, where the concentrations of the 2T and 10T reporter genes were 0nM, 25nM, 50nM, 100nM, 200nM, 400nM, 800nM and 1600nM, respectively.

The validation results are shown in fig. 7, where fig. 7 shows the comparison and concentration optimization results for fluorescent ssDNA reporters (2T and 10T), with the optimal concentration for the highest signal-to-noise ratio being 400nM.

Example 8 sensitivity detection experiment for CRISPR Cas12a based real-time fluorescence detection method

In this embodiment, a sensitivity experiment is performed on LbCas12 a-mediated in-tube fluorescence lysis detection, samples to be detected include gastric mucosa, stool and saliva samples, and the experimental steps are as follows:

the Cas12a cleavage reaction system is: cas12a concentration 60nM, ssDNA reporter concentration 400nM, crRNA concentration 50nM, mgSO ₄ Is 5mM.

After the reaction system is completely mixed, the mixture is put into a portable Dhelix-Q5 isothermal fluorescence PCR instrument, and the conditions of Cas12a cleavage reaction are as follows: incubate at 37 ℃ for 30min. And monitoring the trans-cutting condition in real time.

Figure 8A shows the corresponding trans-cleavage activity in LbCas12 a-mediated cleavage reaction using reporter (2T) and NEB buffer 2.1 buffer. The concentration of the CagA gene was 0nM, 0.043nM, 0.171nM, 0.6875nM, 1.375nM and 2.75nM, respectively.

Figure 8B shows the corresponding trans-cleavage activity in LbCas12 a-mediated cleavage reaction using reporter (10T) and CEXTRAR buffer. The concentration of the CagA gene was 0nM, 0.043nM, 0.171nM, 0.6875nM, 1.375nM and 2.75nM, respectively.

Figure 8C shows the results of studies and optimization of LbCas12 a-mediated cleavage reaction enhancing buffer components. In FIG. 8C i and ii are real-time fluorescence analysis histograms (histograms) of cleavage reaction activity using (2T &NEBbuffer 2.1) and (10T &CEXTRARbuffer) in the presence of different concentrations of CagA gene (0 nM, 0.043nM, 0.171nM, 0.6875nM, 1.375nM and 2.75 nM), respectively, during the first 10min.

As can be seen from FIGS. 8A-8C, the sensitivity was evaluated between 10T and CEXTRAR-containing buffer (present invention) and 2T and NEB buffer 2.1 (conventional method), and the real-time fluorescence detection sensitivity of the present invention was increased by 16-fold.

Example 9 CRISPR/Cas12 a-based Lateral Flow Assay (LFA)

In this embodiment, the sample to be tested is tested by Lbcas12a mediated lateral flow assay. The samples to be tested include gastric mucosa, stool and saliva samples.

Fig. 9 shows the Lateral Flow Strip (LFS) design and working principle for helicobacter pylori detection, including step a, step b, step c and step d in fig. 9. After sample collection and preparation (step a), the Cas12a reaction is performed with or without a pre-amplification step (step b). The resulting mixture was applied to LFS. When no helicobacter pylori is present in the mixture, a test line will appear as a result of the hybridisation of the biotinylated ssDNA reporter gene to the capture probe at the test line (step c); in the presence of H.pylori, no test line appeared, as the biotinylated ssDNA reporter gene failed to hybridize to the capture probe after trans-cleavage (step d). Thus, two bands symbolize a negative test and one band symbolizes a positive test, where T: test lines/strips; c: control the wires/strips.

The LFS consists of five major components (sample and conjugate pad, NC film, absorbent and backing pad). When the CRISPR cocktail is contacted with the sample pad, it can migrate by capillary force to the conjugate pad (conjugated to the AuNP-SA complex) and expand (immobilized with ssDNA probe and biotinylated IgG antibody, respectively) towards the NC membrane with immobilized test and control lines. The results of the test line of ssDNA probes complementary to the ssDNA biotinylated reporter gene can be visualized visually. The presence of a wireless strip indicates the presence of the target (positive test), indicating that the reporter gene is cleaved, resulting in a lack of hybridization to the ssDNA probe, and vice versa (negative test). Excess free reaction mixture AuNP-SA continued to reside at the control line, and the remainder moved to the absorbent pad. The back pad acts as a protective support for the entire design.

The steps of the preparation of the conjugated gold nanoparticles, the design and the assembly of the transverse flow strip are as follows:

gold nanoparticles (AuNPs) and streptavidin-conjugated gold nanoparticles (AuNP-SA) were first prepared. Second, this example designed a lateral flow band (LFS) using conventional components consisting of LFS including a pad, sample pad, conjugate pad, nitrocellulose membrane (NC) and absorbent pad. Samples prepared from glass fibers and conjugate pads were treated with appropriate buffer (1% Triton,50mM boric acid, 2% glucose, 1% BSA, pH 8) and AuNP-SA solutions, respectively. Next, both mats are thoroughly dried and stored in a desiccant container until further use. In order to design a read-out part, a solution of a biotinylated rabbit anti-IgG polyclonal antibody and a DNA capture probe is sprayed on an NC membrane by a dispenser to form a test line and a control line, and the two lines are spaced by 7mm. NC films (25 mm wide) were exposed to UV light for 10min, then dried overnight at 37 ℃, and stored at room temperature in a low humidity environment until use. Finally, all LFS sections were connected together, each section overlapping 2mm, using an LFS cutter to generate a 4mm LFS.

The detection method for rapidly detecting helicobacter pylori based on CRISPR Cas12a is as follows:

(1) The Cas12a cleavage reaction system is: cas12a concentration 60nM, ssDNA reporter (biotin-labeled ssDNA reporter) concentration 50nM, crRNA concentration 50nM, mgSO ₄ Is 5mM.

(2) After the reaction system is completely mixed, the conditions of Cas12a cleavage reaction are as follows: incubate at 37 ℃ for 30min, then load in LFS to obtain the detection result.

Table 6 is a list of capture probe sequences used in the present invention, the underlined sections represent optimized variable bases for capture probe optimized poly-adenine. (. X.) represents the best capture probe. (x 2) denotes a double capture probe.

TABLE 6

Results of the experiment are shown in FIG. 10, where a represents the evaluation of different length reporter genes with thymine and adenine base extensions, b represents the evaluation of different length capture probes with adenine base extensions, purple oligonucleotides represent reporter genes, and blue oligonucleotides represent capture probes, and FIG. 10 shows the results of the test line signal customization and optimization experiments. Green represents the variable part of the thymine or adenine base extension. (x 2) double capture probes, see tables 5 and 6 for details.

Example 10 specific assay

This example uses the Lbcas12 a-mediated lateral flow assay to detect different bacterial strains for specific detection.

The sample to be detected comprises helicobacter pylori, salmonella, escherichia coli O157: H7, listeria monocytogenes, staphylococcus aureus, yersinia, pseudomonas aeruginosa, bacillus cereus and aeromonas.

(1) Total genomic DNA extraction from bacterial and clinical samples

Aerobic bacteria were cultured at 37 ℃ using Luria-Bertani medium and supplemented with ampicillin as needed. Culturing for 72h in a helicobacter pylori culture medium containing sterile defibrinated sheep blood and a bacteriostatic agent under an anaerobic culture bag, an oxygen indicator and an anaerobic gas generator (Hongdao Hope Bio, china) at 36 +/-1 ℃. The helicobacter pylori bacteriostatic agent comprises 1mg of acridine acid, 0.5mg of Trimethoprim (TMP), 0.3mg of vancomycin and 0.2mg of amphotericin B.

To verify clinical specimens, this example was conducted using stomach biopsy, stool and saliva samples from patients diagnosed with helicobacter pylori using the 13C Urea briya Test (Urea break Test). Total genome was extracted (saliva samples were analyzed directly without processing). Feces were mixed with 0.4% Triton X-100 and smeared directly with the supernatant without any additional treatment. Biopsy samples were extracted using a commercial TIANGEN biotech extraction kit (beijing, china).

(2) The detection method for rapidly detecting helicobacter pylori based on CRISPR Cas12a is as follows:

Preferably, after the reaction system is completely mixed, the mixture is put into a portable dheix-Q5 isothermal fluorescence PCR instrument, and the conditions of the Cas12a cleavage reaction are as follows: incubate at 37 ℃ for 30min. And monitoring the trans-cutting condition in real time.

The detection result shows that the Lbcas12 a-mediated transverse flow experiment can realize the detection of helicobacter pylori, and has no false positive result on the control strains such as salmonella, escherichia coli O157: H7, listeria monocytogenes, staphylococcus aureus, yersinia, pseudomonas aeruginosa, bacillus cereus or aeromonas. The crRNA and CRISPR Cas12a system for detecting helicobacter pylori provided by the invention has good specificity.

In conclusion, the novel customized reporter gene, the capture probe, the enhanced buffer solution and the clinical sample based on the CRISPR/LbCas12a system do not need special DNA extraction technology, and compared with the traditional detection method, the detection result of the helicobacter pylori can be obtained more accurately, conveniently and rapidly. The method can be used as a reliable helicobacter pylori early diagnosis method, can also be used as an effective monitoring method of cases, can effectively avoid false negative detection results, and makes important contributions to prevention and treatment of helicobacter pylori infection-related diseases and reduction of related mortality and economic loss.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

Claims

1. A crRNA for helicobacter pylori detection, wherein the crRNA targets a CagA gene and a VacA gene, respectively;

2. Use of the crRNA for helicobacter pylori detection according to claim 1 in the preparation of a helicobacter pylori detection product.

3. A CRISPR Cas12a system for detecting helicobacter pylori, wherein the CRISPR Cas12a system comprises the crRNA for detecting helicobacter pylori of claim 1.

4. The CRISPR Cas12a system for detecting helicobacter pylori according to claim 3, characterized in that the CRISPR Cas12a system further comprises a Cas12a protein, a LAMP amplification primer, a fluorescence-labeled ssDNA reporter gene, a LAMP amplification system and a Cas12a cleavage reaction system;

or the CRISPR Cas12a system further comprises a Cas12a protein, LAMP amplification primers, biotin-labeled ssDNA reporter genes, capture probes, LAMP amplification systems and Cas12a cleavage reaction systems.

5. The CRISPR Cas12a system for detecting helicobacter pylori according to claim 4, wherein the LAMP amplification primer comprises an outer primer, an inner primer and a loop primer;

preferably, the outer primers comprise CagA F3, cagAB3, vacA F3, and VacAB3; the nucleotide sequence of CagA F3 is shown as SEQ ID NO. 7, the nucleotide sequence of CagA B3 is shown as SEQ ID NO. 8, the nucleotide sequence of VacA F3 is shown as SEQ ID NO. 13, and the nucleotide sequence of VacA B3 is shown as SEQ ID NO. 14;

preferably, the inner primer comprises CagA FIP, cagA BIP, vacA FIP and VacA BIP; the nucleotide sequence of CagA FIP is shown as SEQ ID NO. 9, the nucleotide sequence of CagA BIP is shown as SEQ ID NO. 10, the nucleotide sequence of VacA FIP is shown as SEQ ID NO. 15, and the nucleotide sequence of VacA BIP is shown as SEQ ID NO. 16;

preferably, the loop primer comprises CagA LoopF, cagA LoopB, vacA LoopF, vacA LoopB; the nucleotide sequence of CagA LoopF is shown as SEQ ID NO. 11, the nucleotide sequence of CagA LoopB is shown as SEQ ID NO. 12, the nucleotide sequence of VacA LoopF is shown as SEQ ID NO. 17, and the nucleotide sequence of VacA LoopB is shown as SEQ ID NO. 18;

preferably, the fluorescently labeled ssDNA reporter comprises a fluorescein-quencher ditag reporter or a fluorescein-biotin ditag reporter;

preferably, the fluorescein comprises carboxyfluorescein or 6-carboxy-2 ', 4',5', 7' -hexachlorofluorescein succinimidyl ester and the quencher comprises tetramethylrhodamine or a dark quencher;

preferably, the sequence of the fluorescently labeled ssDNA reporter gene is selected from any one of SEQ ID NOS 19-33 or a combination of at least two of SEQ ID NOS;

preferably, the sequence of the biotin-labeled ssDNA reporter gene is selected from any one or a combination of at least two of SEQ ID NOS 19-33;

6. The CRISPR Cas12a system for detecting helicobacter pylori according to claim 5, wherein the LAMP amplification system comprises in final concentration: dNTPs 1-1.8mM, mgSO ₄ 4-8mM, bst DNA polymerase 310-320U/mL, primer F3.2-0.25. Mu.M, primer B3.2-0.25. Mu.M, primer FIB 1-1.6. Mu.M, primer FIP 1-1.6. Mu.M, primer Loop F0.4-0.45. Mu.M and primer LoopB 0.4-0.45. Mu.M;

preferably, the LAMP amplification conditions are: incubating at 55-65 deg.C for 10-30min;

preferably, the Cas12a cleavage reaction system comprises, in final concentration: cas12a 40-80nM, crRNA 40-60nM, and MgSO ₄ 5-10mM；

Preferably, the Cas12a cleavage reaction system further comprises CEXTRAR buffer, and the CEXTRAR buffer comprises the following components by mass: 40-80mM potassium acetate, 10-30mM Tris acetic acid, 10-25mM magnesium acetate, 0.5-1mM tricarboxyethyl phosphine and 10-20mM dithiothreitol, wherein the pH value is 7.9-8.5, and the solvent is water;

preferably, the conditions of the Cas12a cleavage reaction are: incubating at 36-42 deg.C for 30-60min.

7. A detection kit for rapidly detecting helicobacter pylori based on CRISPR Cas12a, which is characterized in that the detection kit contains the CRISPR Cas12a system for detecting helicobacter pylori according to any one of claims 3 to 6.

8. A method for rapid detection of helicobacter pylori based on CRISPR Cas12a, comprising: the CRISPR Cas12a system for detecting helicobacter pylori, which is defined in any one of claims 3-6, is used for detecting a sample to be detected.

9. The method for rapidly detecting helicobacter pylori based on CRISPR Cas12a according to claim 8, wherein when the CRISPR Cas12a system adopts a Cas12a protein, crRNA, a fluorescein-quencher double-labeled reporter gene and a LAMP amplification product, the detection result is read by observing the fluorescence value of a cleavage product after Cas12a cleavage reaction;

preferably, when the CRISPR Cas12a system adopts Cas12a protein, crRNA, fluorescein-biotin double-labeled probe, capture probe and LAMP amplification product, the detection result is read through coupling reaction of cleavage product after Cas12a cleavage reaction and lateral flow analysis;

preferably, the method for rapidly detecting helicobacter pylori based on CRISPR Cas12a further comprises a pretreatment method of a sample to be detected, wherein the pretreatment method comprises the following steps: resuspending helicobacter pylori with 0.2-2% Triton X-100 solution, centrifuging at 8000-14000rpm for 1-2min, removing supernatant, resuspending the obtained precipitate with Triton X-100 solution, and detecting.

10. Use of the CRISPR Cas12a system for detecting helicobacter pylori according to any one of claims 3 to 6 in the preparation of a helicobacter pylori detection product.