CN111647498B - Integrated self-service nucleic acid detection device and use method thereof - Google Patents
Integrated self-service nucleic acid detection device and use method thereof Download PDFInfo
- Publication number
- CN111647498B CN111647498B CN202010447201.1A CN202010447201A CN111647498B CN 111647498 B CN111647498 B CN 111647498B CN 202010447201 A CN202010447201 A CN 202010447201A CN 111647498 B CN111647498 B CN 111647498B
- Authority
- CN
- China
- Prior art keywords
- chamber
- reaction
- reagent
- nucleic acid
- piston
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
- B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
- B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
- B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
Abstract
The invention relates to an integrated self-service nucleic acid detection device and a use method thereof, wherein the device comprises: a cartridge having a piston chamber, a sample receiving chamber, a reagent chamber, and a recovery chamber formed thereon; the reaction chip is provided with two reaction tanks on the upper surface; the elastic membrane bonds the reaction chip on the bottom of the card box; the sample receiving chamber and the reagent chamber are communicated with one reaction tank through a first one-way valve structure, and the reagent chamber and the recovery chamber are communicated with the other reaction tank through a second one-way valve structure. The invention can complete the whole process of nucleic acid detection by only 4 simple push-and-pull actions without professional training and special laboratory conditions and equipment such as a pipette gun, a temperature circulating instrument and the like, greatly simplifies the operation steps of nucleic acid detection, reduces the requirements on operators and operation places, can be popularized and applied in families and community clinics, and realizes real-time screening detection during epidemic situation prevention and control and personal daily health condition monitoring.
Description
Technical Field
The invention relates to a nucleic acid detection device and a using method thereof, in particular to an integrated self-service nucleic acid detection device which can simply and conveniently realize nucleic acid amplification detection at home or any other places and a using method thereof.
Background
The nucleic acid detection is the most direct, reliable and sensitive method in pathogen detection, and has important application in the fields of disease diagnosis, epidemic prevention and control, health monitoring and the like. The nucleic acid detection can determine the information such as the type, concentration and the like of the pathogen within 1 hour by detecting the genetic material (DNA or RNA) of the pathogen, and avoid the interference of factors such as the infection window period of diseases and the like.
The nucleic acid detection process generally includes the following steps: sample pretreatment, nucleic acid extraction, nucleic acid amplification and amplification result detection. The traditional detection method needs to be completed by professionals in laboratories with professional conditions, not only needs to use a pipette gun and a centrifuge tube to complete a large amount of complicated operations such as liquid transfer, uniform mixing, centrifugation and the like, but also needs to use special instruments and equipment such as a temperature cycler and a capillary electrophoresis apparatus, and has high requirements on operators and operation environments. When the emergency biological safety events such as epidemic situation prevention and control and the like are faced, because laboratory resources and professionals are limited, or false positive and false negative problems caused by misoperation are prone to frequent occurrence, the traditional laboratory nucleic acid detection method is difficult to rapidly give accurate results of a large quantity of samples.
At present, for detecting nucleic acid samples with low copy number (such as SARS-CoV-2 samples below 1000 copy/mL), the detection rate of one-step nucleic acid amplification reaction is low, and the sensitivity is not enough; particularly, when the input sample is a sample without nucleic acid purification, the one-step nucleic acid amplification reaction is inhibited by foreign proteins, small molecules, and the like in the sample, and the amplification efficiency is affected. Therefore, only one-step amplification techniques, such as one-step PCR (polymerase chain reaction), RPA (recombinase polymerase amplification), LAMP (loop-mediated isothermal amplification), and the like, are usually required to purify nucleic acids from a test sample. Therefore, the high threshold of the conventional nucleic acid detection technology limits the great application prospect of the technology.
Disclosure of Invention
In view of the above problems, an object of the present invention is to provide an integrated self-service nucleic acid detecting device, which integrates a reaction reagent and a control system into a microfluidic chip, so as to realize complete integration of a pathogen nucleic acid detecting process, thereby simply and conveniently realizing nucleic acid amplification detection at home or any other place; the invention also aims to provide a using method of the integrated self-service nucleic acid detection device.
In order to achieve the purpose, the invention adopts the following technical scheme: an integrated self-service nucleic acid detection device, comprising a microfluidic chip, the microfluidic chip comprising: the kit comprises a card box, a sample receiving chamber, a reagent chamber and a recovery chamber, wherein a plurality of hole-shaped cavities are formed in the card box, each hole-shaped cavity is respectively provided with a piston chamber, a sample receiving chamber, a reagent chamber and a recovery chamber, a piston push rod is arranged in each hole-shaped cavity, the sample receiving chamber is used for accommodating a sample to be detected, the reagent chamber is used for accommodating a liquid reagent, the recovery chamber is used for recovering an amplification product, an outlet is formed in the bottom of each piston chamber and the bottom of each sample receiving chamber, an inlet and an outlet are formed in the bottom of each reagent chamber, and an inlet is formed in the bottom of each recovery chamber; the reaction chip is provided with at least one reaction tank on the upper surface, and a reaction reagent is pre-stored in the reaction tank; the elastic membrane is arranged between the card box and the reaction chip and used for bonding the reaction chip at the bottom of the card box, and the elastic membrane is provided with through holes with the same number as that of inlets and outlets at the bottom of the card box; the outlet of the piston chamber is superposed with the corresponding through hole on the elastic membrane so as to communicate the piston chamber with the reaction tank; the outlet of the sample receiving chamber, the inlet and the outlet of the reagent chamber and the inlet of the recovery chamber are not overlapped with the through holes on the elastic membrane, so that the outlets of the sample receiving chamber and the reagent chamber and the adjacent through holes on the elastic membrane form a first one-way valve structure which can only go out and cannot go in, and the inlets of the reagent chamber and the recovery chamber and the adjacent through holes on the elastic membrane form a second one-way valve structure which can only go in and cannot go out; therefore, the outlet of the sample receiving chamber and the outlet of the reagent chamber are respectively communicated with the reaction tank through the first one-way valve structure, and the inlet of the reagent chamber and the inlet of the recovery chamber are respectively communicated with the reaction tank through the second one-way valve structure, so that the fluid or air is ensured to complete directional transfer under specific operation.
The integrated self-service nucleic acid detection device is preferably provided with a hydrophobic membrane at the through hole of the elastic membrane between the piston chamber and the reaction tank, wherein the hydrophobic membrane can allow air to pass through but block liquid from passing through.
The integrated self-service nucleic acid detection device preferably comprises a first piston chamber and a second piston chamber, wherein a first piston push rod and a second piston push rod are respectively arranged in the first piston chamber and the second piston chamber; the upper surface of the reaction chip is provided with a first reaction tank and a second reaction tank, the first piston chamber is communicated with the first reaction tank, the second piston chamber is communicated with the second piston chamber, the sample receiving chamber and the reagent chamber are respectively communicated with the first reaction tank through a first one-way valve structure, and the reagent chamber and the recovery chamber are respectively communicated with the second reaction tank through a second one-way valve structure.
Integration self-service nucleic acid detection device, preferably, still be formed with the mixing cavity that is used for holding liquid reagent on the card box, the bottom of mixing cavity also is formed with an export and an import, the export and the import of mixing cavity respectively with adjacent through-hole on the elastic membrane forms first check valve structure and second check valve structure, the import of mixing cavity pass through the second check valve structure with the second reaction tank is linked together, the export of mixing cavity passes through behind the first check valve structure the last connecting flow way of reaction chip with the import of retrieving the cavity is linked together.
Preferably, the elastic membrane is made of double-sided adhesive base materials and is subjected to local viscosity removal treatment; the hydrophobic membrane is a PTFE membrane.
Preferably, the reaction reagent is a solid or liquid RPA reagent, a LAMP reagent, a PCR reagent, a NASBA reagent, a cas 12-mediated specific sequence signal amplification reaction reagent or a cas 13-mediated specific sequence signal amplification reaction reagent.
Preferably, the microfluidic chip is in a totally enclosed form, namely a groove is processed on one side of the card box, then single-sided adhesive is attached to a frame of the card box, and the frame is sealed by a heat sealing process; meanwhile, outlets at the top ends of the chambers of the card box are sealed through sealing covers or rubber plugs, wherein the sealing covers or the rubber plugs of the first piston chamber and the second piston chamber are provided with through holes for the first piston push rod and the second piston push rod to pass through; in addition, air vents are arranged on the side walls of the first piston chamber, the second piston chamber, the sample receiving chamber, the reagent chamber and the recovery chamber.
In the integrated self-service nucleic acid detection device, preferably, the microfluidic chip is arranged in a shell matched with the microfluidic chip in shape, the microfluidic chip is sealed in the shell through a cover plate, and a heating unit mainly composed of a PI film, a resistance wire and a Peltier is arranged at the bottom of the microfluidic chip; two push rod limiting grooves are formed in the front face of the shell and used for limiting the pulling-up distance of the first piston push rod and the second piston push rod respectively; a reaction result observation area is arranged on the side surface of the shell and used for displaying the test strip result; the front surface of the shell is also provided with a buzzer and a state indicator light for prompting a user to operate; and a circuit control unit connected with the heating unit, the buzzer and the status indicator lamp is arranged in the shell and used for controlling heating, alarming and status indication.
A use method of the integrated self-service nucleic acid detection device comprises the following steps:
step 1: adding or forming a solution containing the nucleic acid to be detected in the sample receiving chamber;
step 2: pulling up the first piston push rod, enabling the solution in the sample receiving cavity to enter the first reaction tank through the first one-way valve below the sample receiving cavity under the action of negative pressure, and mixing the solution with a reaction reagent prestored in the first reaction tank;
and step 3: heating the reaction chip to a set temperature to start a first-step amplification reaction, pushing down a first piston push rod after reacting for a certain time, and allowing an amplification solution after the reaction to enter a reagent chamber through a second one-way valve under the action of positive pressure and uniformly mix with a liquid reagent in the reagent chamber;
and 4, step 4: pulling up the second piston push rod, leading the amplification solution in the reagent chamber to enter a second reaction tank through a first one-way valve below the amplification solution under the action of negative pressure, and mixing the amplification solution with a reaction reagent pre-stored in the second reaction tank;
and 5: heating the reaction chip to a set temperature again to start the second-step amplification reaction, pushing down a second piston push rod after reacting for a certain time, and allowing the amplification solution after reaction to enter the mixing chamber through a second one-way valve under the action of positive pressure and to be mixed with the liquid reagent in the mixing chamber;
step 6: continuing to push down the second piston push rod, and when the pressure in the closed space above the mixing chamber reaches a critical value, allowing the mixed amplification solution to break through the first one-way valve and flow out, and then enter the recovery chamber through the second one-way valve;
and 7: the amplification solution entering the recovery cavity and the test strip placed in the recovery cavity are subjected to color reaction, and a nucleic acid detection result is obtained according to the color result of the test strip.
The use method is preferably that the solution containing the nucleic acid to be detected is added or formed in the sample receiving chamber, and the two conditions are as follows: 1) adding the nucleic acid to be detected into a sample receiving chamber in a single-stranded or double-stranded form dissociated in a lysis solution, and then directly performing subsequent reaction through operation; 2) the part or all of the nucleic acid to be detected exists in the cells, tissues, virus particles and bacteria added in the liquid, and at this time, the nucleic acid to be detected needs to be added into the sample receiving chamber after being cracked by heating or cracking by a cracking solution.
Due to the adoption of the technical scheme, the invention has the following advantages: 1. the reaction reagent and the control system are integrated in the microfluidic chip, the whole process of nucleic acid detection can be completed by 4 simple push-and-pull actions without depending on the control and operation of any external instrument, professional training and special laboratory conditions are not needed, devices such as a liquid-transferring gun and a temperature circulating instrument are not needed, the operation steps of nucleic acid detection are greatly simplified, the requirements on operators and operation places are reduced, the kit has the advantages of simplicity, rapidness, safety and reliability, the kit can be popularized and applied in families and community clinics, and real-time screening detection during epidemic situation prevention and control and personal daily health condition monitoring are realized. 2. The invention uses the hydrophobic membrane to realize the fluid limit in the push-pull process of the piston push rod, and realizes the accurate quantification of microliter-level liquid through the hydrophobic membrane and the reaction tank on the microfluidic chip, thereby solving the problem of difficult quantification on the microfluidic chip. 3. According to the invention, when the second piston push rod is pressed down, liquid and gas can be sequentially introduced into the closed mixing cavity, the mixing of different reagents is realized when the liquid is introduced, the gas compression and the liquid pumping are realized when the gas is introduced, two steps of reagent mixing and transferring can be realized through one-step push rod pressing, and the operation of fluid control of the microfluidic chip is simplified. 4. The nucleic acid detection device provided by the invention realizes the communication and the sealing of the reaction chamber through the air vent and the sealing film, and can realize the seamless connection of the first-step amplification reaction and the second-step amplification reaction and the detection of the lateral chromatography test paper, thereby effectively avoiding the false positive detection result caused by aerosol pollution. 5. According to the invention, through the second-step amplification reaction, a target nucleic acid signal can be further amplified on the basis of the first-step amplification reaction, so that a sample which is not subjected to a nucleic acid purification step is used, and high sensitivity detection can be realized, wherein the sensitivity can reach 300copies/mL, and is equivalent to QPCR (Real-time Quantitative PCR detection System).
Drawings
FIG. 1 is a schematic structural diagram of an integrated self-service nucleic acid detecting device according to an embodiment of the present invention;
FIGS. 2(a) and 2(b) are schematic structural diagrams of an integrated self-service nucleic acid detection device according to another embodiment of the present invention;
FIGS. 3(a) - (e) are flowcharts of the operation of the apparatus of the present invention in use;
FIG. 4 is a graph showing the experimental results of an example of the present invention, wherein the numbers are the number of false viruses detected by the device, i.e., copies/rxn; NC is negative control, i.e. sample without pseudovirus.
Detailed Description
The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings so that the objects, features and advantages of the invention can be more clearly understood. It should be understood that the embodiments shown in the drawings are not intended to limit the scope of the present invention, but are merely intended to illustrate the spirit of the technical solution of the present invention.
As shown in fig. 1, the integrated self-service nucleic acid detecting device provided by the present invention includes a microfluidic chip 100, where the microfluidic chip 100 includes: the cartridge 1 is provided with 5 hole-shaped cavities (only 5 are taken as examples, but not limited to 5 cavities), two cavities form a first piston chamber 11 and a second piston chamber 12 respectively, a first piston push rod 13 and a second piston push rod 14 are arranged inside the first piston chamber and the second piston chamber respectively, the other three cavities form a sample receiving chamber 15 for containing a sample to be tested, a reagent chamber 16 for containing a liquid reagent and a recovery chamber 17 for recovering an amplification product respectively, the bottoms of the first piston chamber 11, the second piston chamber 12 and the sample receiving chamber 15 are provided with an outlet respectively, the bottom of the reagent chamber 16 is provided with an inlet and an outlet, and the bottom of the recovery chamber 17 is provided with an inlet; the reaction chip 3 is provided with a first reaction tank 21 and a second reaction tank 22 on the upper surface, and reaction reagents are prestored in the first reaction tank 21 and the second reaction tank 22; the elastic membrane 2 is arranged between the card box 1 and the reaction chip 3 and used for bonding the reaction chip 3 at the bottom of the card box 1, and the elastic membrane 2 is provided with through holes with the same number as the inlet and the outlet at the bottom of the card box 1.
Outlets of the first piston chamber 11 and the second piston chamber 12 are respectively superposed with two through holes on the elastic membrane 2, so that the first piston chamber 11 and the second piston chamber 12 are respectively communicated with the first reaction tank 21 and the second reaction tank 22; the outlet of the sample receiving chamber 15, the inlet and outlet of the reagent chamber 16 and the inlet of the recovery chamber 17 are not coincident with the through holes in the elastic membrane 2, so that the outlets of the sample receiving chamber 15 and the reagent chamber 16 and the adjacent through holes in the elastic membrane 2 form a first one-way valve structure which can only go out and cannot go in, and the inlets of the reagent chamber 16 and the recovery chamber 17 and the adjacent through holes in the elastic membrane 2 form a second one-way valve structure which can only go in and cannot go out. Thus, the outlet of the sample receiving chamber 15 and the outlet of the reagent chamber 16 are respectively communicated with the first reaction cell 21 through a first one-way valve structure, and the inlet of the reagent chamber 16 and the inlet of the recovery chamber 17 are respectively communicated with the second reaction cell 22 through a second one-way valve structure, thereby ensuring that the fluid or air is directionally transferred under a specific operation.
In the above embodiment, it should be noted that the principle of the structure of the check valve is as follows: since the inlet at the bottom of the cartridge 1 (for example, the inlet of the reagent chamber 16) is not bonded to the non-coincident part of the through hole on the elastic membrane 2, the forward pressure can push the elastic membrane 2 at the position to make the fluid in the first reaction tank 21 flow into the reagent chamber 16, and the reverse pressure can press the elastic membrane 2 at the bottom of the cartridge 1 to realize the sealing effect, so as to form a second one-way valve structure which can only enter and not exit, and ensure that the fluid enters the cartridge chamber from the reaction chip 3 in one way; on the contrary, the first one-way valve structure can ensure that the fluid enters the reaction chip 3 from the cavity of the card box in one way, and the structure of the first one-way valve structure is equivalent to the structure of the second one-way valve structure which is inverted up and down, and the principle is the same.
In the above embodiment, it is preferable that a hydrophobic membrane 4 is disposed at the through hole of the elastic membrane 2 between the first piston chamber 11 and the first reaction cell 21 and at the through hole of the elastic membrane 2 between the second piston chamber 12 and the second reaction cell 22, and the hydrophobic membrane 4 is permeable to air but blocks liquid. In the present embodiment, the hydrophobic membrane 4 is preferably a PTFE membrane.
In the above embodiment, preferably, the cartridge 1 is further formed with a closed blending chamber 18, the bottom of the blending chamber 18 is also formed with an outlet and an inlet, the outlet and the inlet of the blending chamber 18 are respectively communicated with the adjacent through holes on the elastic membrane 2 to form a first one-way valve structure and a second one-way valve structure, the inlet of the blending chamber 18 is communicated with the second reaction tank 22 through the second one-way valve structure, and the outlet of the blending chamber 18 is communicated with the inlet of the recovery chamber 17 through the connection flow channel on the reaction chip 3 after passing through the first one-way valve structure.
In the above embodiment, preferably, the elastic membrane 2 can be a double-sided adhesive substrate, and can perform both the one-way valve function and the bonding of the cartridge 1 and the reaction chip 3 through a partial de-sticking process.
In the above-described embodiment, the reaction reagent is preferably an RPA reagent, a LAMP reagent, a PCR reagent, an NASBA (nucleic acid sequence-dependent amplification) reagent, a cas 12-mediated specific sequence signal amplification reaction reagent, or a cas 13-mediated specific sequence signal amplification reaction reagent in a solid or liquid state.
In the above embodiment, preferably, the microfluidic chip 100 may be fully enclosed, that is, a groove is formed on one side of the cartridge 1, and then the frame 19 of the cartridge 1 is attached with the single-sided adhesive 5 and sealed along the frame 19 by a heat sealing process; meanwhile, the top outlet of each chamber of the card box 1 is sealed by a sealing cover or a rubber plug 23, wherein the sealing covers or rubber plugs 23 of the first piston chamber 11 and the second piston chamber 12 are provided with through holes for the first piston push rod 13 and the second piston push rod 14 to pass through; in addition, the side walls of the first piston chamber 11, the second piston chamber 12, the sample receiving chamber 15, the reagent chamber 16 and the recovery chamber 17 are all provided with gas guide holes 20, so that gas does not leak from the upper outlet of the cartridge 1, but gas exchange can be performed between the gas guide holes 20 on the side walls of the chambers and the sealing area in the cartridge 1, so as to realize pressure communication, and thus, the full sealing of the microfluidic chip 100 is realized.
In the above embodiment, preferably, as shown in fig. 2, the microfluidic chip 100 may also be placed in a housing 24 adapted to the shape thereof, and the microfluidic chip 100 is enclosed in the housing 24 by a cover plate 25, while a heating unit (not shown in the figure) mainly composed of PI film, resistance wire and peltier element is disposed at the bottom of the microfluidic chip 100. Two push rod limiting grooves 26 are formed in the front face of the shell 24 and used for limiting the pulling-up distance of the first piston push rod 13 and the second piston push rod 14 respectively; a reaction result observation area 27 is arranged on the side surface of the shell 24 and is used for displaying the test strip result; a buzzer 28 and a status indicator lamp 29 are further arranged on the front surface of the shell 24 for prompting the user to operate; a circuit control unit 30 connected to the heating unit, the buzzer 28, and the status indicator lamp 29 is provided in the housing 24 for controlling heating, alarming, status indication, and the like.
It should be noted that in the above embodiments, the microfluidic chip 100 is shaped like a tape cartridge, but the microfluidic chip 100 may be modified for specific applications without departing from the essence of the present invention, for example, the following modifications may be made in the structure: the shape of the card box 1 can be adjusted according to the processing mode and the functional requirements, and can be combined into a cuboid, a cylinder, a circular truncated cone and the like; the arrangement sequence of the chambers on the card box 1 can be correspondingly adjusted according to the functional requirements; the arrangement sequence of the chambers on the card box 1, the arrangement of the reaction pool and the fluid channel on the reaction chip 3 can be adjusted correspondingly; the number of the piston chambers on the card box 1 can be adjusted according to the requirement, and the number of the reaction tanks on the reaction chip 3 can be adjusted according to the requirement.
Based on the integrated self-service nucleic acid detection device provided by the embodiment, the invention also provides a using method of the integrated self-service nucleic acid detection device, which comprises the following steps:
step 1: in the initial state of the apparatus, as shown in FIG. 43(a), a solution containing a nucleic acid to be detected is added to or formed in the sample-receiving chamber 15.
Step 2: the first piston push rod 13 is pulled up, the solution in the sample receiving chamber 15 enters the first reaction tank 21 through the first one-way valve A below the first one-way valve under the action of negative pressure, and is mixed with the reaction reagent (such as RPA or LAMP dry powder) pre-stored in the first reaction tank 21; at the same time, the mixed solution does not enter the first piston chamber 11 due to the obstruction of the hydrophobic membrane 4 (as shown in fig. 3 (b)).
And step 3: heating the reaction chip 3 to 37-45 ℃, starting the first-step amplification reaction, after reacting for a certain time (such as 10min), pushing down the first piston push rod 13, and allowing the amplification solution after reaction to enter the reagent chamber 16 through the second one-way valve B under the action of positive pressure and to be uniformly mixed with the liquid reagent in the reagent chamber (such as shown in 3 (c)).
And 4, step 4: pulling up the second piston pusher 14, the amplification solution in the reagent chamber 16 enters the second reaction tank 22 through the first one-way valve C therebelow under the action of negative pressure, and is mixed with the reaction reagent (such as RPA or LAMP dry powder) pre-stored in the second reaction tank 22; while the amplification solution does not enter the second piston chamber 12 due to the barrier of the hydrophobic membrane 4 (as shown in fig. 3 (d)).
And 5: and heating the reaction chip 3 to 37-45 ℃ again, starting the second-step amplification reaction, pushing down the second piston push rod 14 after reacting for a certain time (such as 10min), and allowing the amplification solution after reaction to enter the uniform mixing chamber 18 through the second one-way valve D under the action of positive pressure and uniformly mix with the liquid reagent in the uniform mixing chamber (such as shown in 3 (e)).
Step 6: and continuously pushing down the second piston push rod 14, and after the pressure in the closed space above the blending chamber 18 reaches a critical value, the blended amplification solution breaks through the first one-way valve E and flows out, and then enters the recovery chamber 17 through the second one-way valve F.
And 7: the amplification solution entering the recovery chamber 17 and the test strip placed in the recovery chamber 17 are subjected to a color reaction, and a nucleic acid detection result is obtained according to a color result of the test strip.
In the above embodiment, preferably, the addition or formation of the solution containing the nucleic acid to be detected in the sample receiving chamber 15 can be divided into two cases: 1) the nucleic acid (RNA or DNA) to be detected is added into the sample receiving chamber 15 in a single-stranded or double-stranded form free in the lysis solution, and then the subsequent reaction can be directly carried out through operation; 2) the nucleic acid to be detected is partially or completely present in the cells, tissues, virus particles and bacteria to which the liquid is added, and at this time, the nucleic acid to be detected needs to be added into the sample receiving chamber 15 after being cracked by heating or cracking by a lysis solution.
In the above-described examples, preferably, the purpose of the second amplification reaction is to further improve the specificity of the detection sensitivity of nucleic acids, and the reaction can be selected from RPA reaction, LAMP reaction, cas 12-mediated specific sequence signal amplification reaction, or cas 13-mediated specific sequence signal amplification reaction. In this example, a nested RPA reaction with probes and a specific sequence signal amplification reaction mediated by Lbcas12a were used, wherein the nested RPA reaction containing probes was: second-step amplification primers are designed within the sequence amplified by the first-step amplification reaction (the first-step amplification primers do not contain the first-step primer sequence, or only contain 1-10 nt), and specific probes are designed in the sequence amplified by the second-step amplification primers (the second-step amplification primers do not contain the second-step primer sequence, or only contain 1-10 nt). The Cas 12-mediated specific sequence signal amplification reaction component is composed of a Cas12 protein, a Cas 12-combined small RNA and a Cas12 reaction buffer solution. The Cas12 protein can be but is not limited to LbCas12a, AsCas12a, FnCas12a, mutant Cas12 containing mutation, and the like. Cas12 binding small RNA contains two sequences, one of which corresponds toThe Cas12 protein binds (e.g., AAUUUCUACUAAGU (U/G) UAGA for LbCas12a protein) and the other segment has similarity to the sequence in the RPA amplicon interval (containing at least 15 identical base sequences), which is the targeting sequence. The 5' end of the targeting sequence is upstream by a PAM sequence corresponding to Cas12, e.g., a PAM corresponding to LbCas12a is TTTV. When the target sequence overlaps with the RPA amplification primer, the overlap is no more than 9 bases. crRNA can be obtained by RNA synthesis or in vitro transcription, such as in vitro transcription reactions based on T7 RNA polymerase. Cas12 reaction buffer composition should contain more than 2mM Mg2+Ions, not containing more than 200mM of monovalent ions, e.g. Na+,K+For example 50mM potassium acetate, 20mM Tris acetate, 10mM magnesium acetate, 100. mu.g per ml BSA, pH 7.9 at 25 ℃.
In the above embodiment, it is preferable that the pre-reaction reagent of the nested RPA reaction with the probe contains a primer with one chemical modification (e.g., biotin, FAM, FITC, DIG, etc.) and a probe with another different chemical modification (e.g., FAM, FITC, DIG, biotin, etc.); the positive reaction product contains a nucleic acid segment, one end of the nucleic acid segment carries double-stranded DNA of a chemical modification molecule (such as biotin, FAM, FITC, DIG and the like), and the other end of the nucleic acid segment carries a chemical modification molecule (such as FAM, FITC, DIG, biotin and the like), and the detection of the lateral chromatography test paper can be realized by a colloidal gold sandwich method. The signal strip of the colloidal gold is composed of a substance which can be combined with one of chemical modifications, for example, when the substance is biotin, the strip is composed of streptavidin; or when the substance is FAM or FITC, the band is composed of an antibody that binds to FAM or FITC.
In the above embodiment, it is preferable that the cas 12-mediated specific sequence signal amplification reaction reagent contains single-stranded DNA. The single-stranded DNA carries one chemical modification (e.g., biotin, FAM, FITC, DIG, etc.) at one end and another different chemical modification (e.g., FAM, FITC, DIG, biotin, etc.) at the other end. In the reaction process containing the positive detection substance, the DNA probes are cut by enzyme, the product contains single-stranded DNA with one chemical modification (such as biotin, FAM, FITC, DIG and the like) or another chemical modification (such as FAM, FITC, DIG, biotin and the like) at the tail end, and the detection of the lateral chromatography test paper is realized by a colloidal gold competition method. The signal strip of the colloidal gold is composed of a substance which can be combined with one of chemical modifications, for example, when the substance is biotin, the strip is composed of streptavidin; or when the substance is FAM or FITC, the band is composed of an antibody that binds to FAM or FITC. The signal band of colloidal gold consists of proteins, such as protein a or protein G, that bind to the antibody on the gold particle.
The technical effect of the present invention is verified by a specific application example.
Firstly, preparing a reagent:
firstly, a new coronavirus (SARS-CoV-2) pseudovirus is purchased from Bai' ao biotechnology limited company (the product number is FNV-2019-ncov-abeN);
② 1st RPA reaction kit is purchased from TwistDX of England with the product model of
BASIC RT KIT；
③ 2nd RPA reaction kit is purchased from TwistDX of England, and the product model is
NFO KIT；
Fourthly, the colloidal gold test paper is purchased from Beijing Kuel science and technology Limited;
fifth, brand of virus preservation solution: youkang, good number: MT0301, main component: based on Hanks liquid, gentamicin, fungal antibiotics, BSA, cryoprotectant, biological buffer, amino acid and other components are added;
sixthly, the main components of the virus release agent are as follows: Tris-His 400mM, sodium chloride 150mM, Tween-200.8%, Triton X-1001.2%, ethylphenyl polyethylene glycol 1.5%, potassium chloride 6mg/mL, and sodium hydroxide 15 mg/mL;
seventhly, the primer probe for the experiment is purchased from the company Limited in the biological engineering (Shanghai), and the specific name sequence is as follows:
1st RPA-F:ATGTACTCATTCGTTTCGGAAGAGACAGG；
1st RPA-R:AGACCAGAAGATCAGGAACTCTAGAAGAA；
2nd RPA-F:TTCTTTTTCTTGCTTTCGTGGTATTCTTGC；
2nd RPA-R:biotin-AAGAAGGTTTTACAAGACTCACGTTAACAAT；
Probe：
FAM-TTACACTAGCCATCCTTACTGCGCTTCGAT[thf]GTGTGCGTACTGCTG[C3spacer]。
II, an experiment step:
1) reagent lyophilization
The 1st RPA and 2nd RPA reaction systems were prepared according to the following tables, respectively.
(1 st RPA reaction System configuration)
Basic RT kit)
(2 nd) configuration of RPA reaction system
nfo kit)
Then, the 1st RPA and 2nd RPA reaction system solutions were added to the first reaction well 21 and the second reaction well 22 of the reaction chip 3, respectively, and were subjected to a freeze-drying process.
2) The reaction chip 3 containing the lyophilized reagent was assembled as a nucleic acid detecting device for test according to FIG. 1, and 250ul and 200 μ L of DEPC water were added to the reagent chamber 16 and the mixing chamber 18, respectively.
3) Diluting pseudovirus solution to appropriate concentration with friend's health preservation solution, adding 40copies, 20copies, 8copies, 4copies and 0copies virus particles into an EP tube, and supplementing the volume to 50ul with friend's health preservation solution; then 50ul of the virus release solution was added to the EP tube, pipetted and mixed well, and the entire 100ul of solution was immediately added to the sample receiving chamber 15.
4) Pulling up the first plunger rod 13 to make 50ul of the sample (containing 20, 10, 4, 2, 0copy pseudovirions, respectively) enter the first reaction chamber 21, and dissolving the lyophilized reaction reagent; then, the nucleic acid detecting apparatus was placed on a heating plate and heated at 37 ℃ for 10 min.
5) The first piston pusher 13 is pushed down to make the reaction product in the first reaction chamber 21 enter the reagent chamber 16 and mix with the DEPC water prestored therein until a small amount of bubbles are generated.
6) The second piston rod 14 is pulled upwards, so that the liquid in the reagent chamber 16 enters the second reaction tank 22, and the freeze-dried reaction reagent is dissolved; then, the nucleic acid detecting apparatus was again placed on the heating plate and heated at 37 ℃ for 10 min.
7) The second piston push rod 14 is pushed downwards to enable the liquid in the second reaction tank 22 to enter the blending chamber 18 and be mixed with DEPC water prestored in the blending chamber until a small amount of bubbles are generated.
8) The second piston push rod 14 is continuously pressed, gas enters the blending cavity 18 until the internal gas pressure reaches a critical value, so that the liquid blended in the blending cavity 18 enters the recovery cavity 17 and contacts with the test strip placed in the recovery cavity 17 to generate a color reaction.
9) After 2min, the color development result is read by eyes after the chromatography is finished.
Third, the experimental results are shown in fig. 4.
Fourthly, experimental conclusion:
the integrated self-service nucleic acid detection device provided by the invention is matched with a two-step RPA reagent, so that 4copies virus particles in a 50ul reaction system can be stably detected. Considering that the volume of the solution actually entering the 1st RPA reaction system is 25ul (the other 25ul volume is the virus release solution), the overall detection sensitivity of the integrated self-service nucleic acid detection device is 0.16 copies/ul.
Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Claims (9)
1. An integrated self-service nucleic acid detection device, comprising a microfluidic chip (100), wherein the microfluidic chip (100) comprises:
the kit comprises a card box (1), a plurality of hole-shaped cavities are formed in the card box, a piston chamber, a sample receiving chamber (15), a reagent chamber (16) and a recovery chamber (17) are formed in each hole-shaped cavity, the piston chamber is internally provided with a piston push rod, the sample receiving chamber is used for accommodating a sample to be detected, the reagent chamber is used for accommodating a liquid reagent, the recovery chamber is used for recovering an amplification product, an outlet is formed in the bottom of each piston chamber and the bottom of each sample receiving chamber (15), an inlet and an outlet are formed in the bottom of each reagent chamber (16), and an inlet is formed in the bottom of each recovery chamber (17);
the reaction chip (3) is provided with at least one reaction tank on the upper surface, and a reaction reagent is pre-stored in the reaction tank;
the elastic membrane (2) is arranged between the card box (1) and the reaction chip (3) and used for bonding the reaction chip (3) at the bottom of the card box (1), and through holes with the same number as that of inlets and outlets at the bottom of the card box (1) are formed in the elastic membrane (2);
the outlet of the piston chamber is superposed with the corresponding through hole on the elastic membrane (2) so as to communicate the piston chamber with the reaction tank; the outlet of the sample receiving chamber (15), the inlet and the outlet of the reagent chamber (16) and the inlet of the recovery chamber (17) are not overlapped with the through holes on the elastic membrane (2), so that the outlets of the sample receiving chamber (15) and the reagent chamber (16) and the adjacent through holes on the elastic membrane (2) form a first one-way valve structure which can only go out and cannot go in, and the inlets of the reagent chamber (16) and the recovery chamber (17) and the adjacent through holes on the elastic membrane (2) form a second one-way valve structure which can only go in and cannot go out;
a hydrophobic membrane (4) is arranged at the through hole of the elastic membrane (2) between the piston chamber and the reaction tank, and the hydrophobic membrane (4) can allow air to pass through but block liquid from passing through;
thereby, the outlet of the sample receiving chamber (15) and the outlet of the reagent chamber (16) are respectively communicated with the reaction cell through the first one-way valve structure, and the inlet of the reagent chamber (16) and the inlet of the recovery chamber (17) are respectively communicated with the reaction cell through the second one-way valve structure, so that the directional transfer of fluid or air under specific operation is ensured.
2. The integrated self-service nucleic acid detection device according to claim 1, wherein the piston chambers comprise a first piston chamber (11) and a second piston chamber (12), and a first piston push rod (13) and a second piston push rod (14) are respectively arranged in the first piston chamber (11) and the second piston chamber (12); the upper surface of the reaction chip (3) is provided with a first reaction tank (21) and a second reaction tank (22), the first piston chamber (11) is communicated with the first reaction tank (21), the second piston chamber (12) is communicated with the second piston chamber (12), the sample receiving chamber (15) and the reagent chamber (16) are respectively communicated with the first reaction tank (21) through a first one-way valve structure, and the reagent chamber (16) and the recovery chamber (17) are respectively communicated with the second reaction tank (22) through a second one-way valve structure.
3. The integrated self-service nucleic acid detection device of claim 2, wherein a mixing chamber (18) for containing a liquid reagent is further formed on the cartridge (1), an outlet and an inlet are also formed at the bottom of the mixing chamber (18), the outlet and the inlet of the mixing chamber (18) form a first one-way valve structure and a second one-way valve structure with adjacent through holes on the elastic membrane (2), the inlet of the mixing chamber (18) is communicated with the second reaction tank (22) through the second one-way valve structure, and the outlet of the mixing chamber (18) is communicated with the inlet of the recovery chamber (17) through a connecting flow channel on the reaction chip (3) after passing through the first one-way valve structure.
4. The integrated self-service nucleic acid detection device according to claim 3, wherein the elastic membrane (2) is made of double-sided adhesive tape base materials and is subjected to local de-bonding treatment; the hydrophobic membrane (4) is a PTFE membrane.
5. The integrated self-service nucleic acid detection device according to claim 4, wherein the reaction reagent is solid or liquid RPA reagent, LAMP reagent, PCR reagent, NASBA reagent, cas 12-mediated specific sequence signal amplification reaction reagent or cas 13-mediated specific sequence signal amplification reaction reagent.
6. The integrated self-service nucleic acid detection device according to claim 4, wherein the microfluidic chip (100) is in a fully-closed form, namely a groove is formed in one side of the cartridge (1), then a single-sided adhesive (5) is attached to a frame (19) of the cartridge (1), and the frame (19) is sealed through a heat sealing process;
meanwhile, outlets at the top ends of the chambers of the card box (1) are sealed through sealing covers or rubber plugs (23), wherein through holes are formed in the sealing covers or the rubber plugs (23) of the first piston chamber (11) and the second piston chamber (12) so that the first piston push rod (13) and the second piston push rod (14) can penetrate through the through holes;
in addition, air vents (20) are arranged on the side walls of the first piston chamber (11), the second piston chamber (12), the sample receiving chamber (15), the reagent chamber (16) and the recovery chamber (17).
7. The integrated self-service nucleic acid detection device according to claim 4, wherein the microfluidic chip (100) is placed in a housing (24) matched with the shape of the microfluidic chip (100), the microfluidic chip (100) is sealed in the housing (24) through a cover plate (25), and a heating unit mainly comprising a PI film, a resistance wire and a Peltier is arranged at the bottom of the microfluidic chip (100);
two push rod limiting grooves (26) are formed in the front face of the shell (24) and are used for respectively limiting the pulling-up distance of the first piston push rod (13) and the second piston push rod (14);
a reaction result observation area (27) is arranged on the side surface of the shell (24) and is used for displaying the test strip result;
the front surface of the shell (24) is also provided with a buzzer (28) and a status indicator lamp (29) for prompting the user to operate;
and a circuit control unit (30) connected with the heating unit, the buzzer (28) and the status indicator lamp (29) is arranged in the shell (24) and used for controlling heating, alarming and status indication.
8. Use of an integrated self-service nucleic acid testing device according to any one of claims 2 to 7 for non-therapeutic and diagnostic purposes, comprising the steps of:
step 1: adding or forming a solution containing the nucleic acid to be detected in the sample receiving chamber (15);
step 2: the first piston push rod (13) is pulled, the solution in the sample receiving chamber (15) enters the first reaction tank (21) through the first one-way valve A below the sample receiving chamber under the action of negative pressure, and is mixed with the reaction reagent pre-stored in the first reaction tank (21);
and step 3: heating the reaction chip (3) to a set temperature to start a first-step amplification reaction, pushing down a first piston push rod (13) after reacting for a certain time, and allowing an amplification solution after the reaction to enter a reagent chamber (16) through a second one-way valve B under the action of positive pressure and uniformly mix with a liquid reagent in the reagent chamber;
and 4, step 4: pulling up the second piston push rod (14), and leading the amplification solution in the reagent chamber (16) to enter the second reaction tank (22) through the first one-way valve C below the second piston push rod under the action of negative pressure and to be mixed with the reaction reagent pre-stored in the second reaction tank (22);
and 5: heating the reaction chip (3) to the set temperature again to start the second-step amplification reaction, pushing down a second piston push rod (14) after reacting for a certain time, and allowing the amplification solution after reaction to enter a mixing chamber (18) through a second one-way valve D under the action of positive pressure to be mixed with the liquid reagent in the mixing chamber uniformly;
step 6: continuously pushing down a second piston push rod (14), and when the pressure in the closed space above the blending chamber (18) reaches a critical value, enabling the blended amplification solution to break through a first one-way valve E and flow out, and then entering a recovery chamber (17) through a second one-way valve F;
and 7: the amplification solution entering the recovery chamber (17) and the test strip placed in the recovery chamber (17) are subjected to color reaction, and a nucleic acid detection result is obtained according to the color result of the test strip.
9. Use according to claim 8, wherein the addition or formation of a solution containing the nucleic acid to be tested in the sample receiving chamber (15) is divided into two cases:
1) the nucleic acid to be detected is added into a sample receiving chamber (15) in a single-stranded or double-stranded form free in a lysis solution, and then the subsequent reaction is directly carried out through operation;
2) the part or the whole of the nucleic acid to be detected exists in cells, tissues, virus particles and bacteria added in the liquid, and the nucleic acid to be detected needs to be added into the sample receiving chamber (15) after being cracked by heating or cracking by a cracking solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010447201.1A CN111647498B (en) | 2020-05-25 | 2020-05-25 | Integrated self-service nucleic acid detection device and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010447201.1A CN111647498B (en) | 2020-05-25 | 2020-05-25 | Integrated self-service nucleic acid detection device and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111647498A CN111647498A (en) | 2020-09-11 |
| CN111647498B true CN111647498B (en) | 2022-03-22 |
Family
ID=72350901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010447201.1A Active CN111647498B (en) | 2020-05-25 | 2020-05-25 | Integrated self-service nucleic acid detection device and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111647498B (en) |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107502544B (en) * | 2017-09-20 | 2023-12-15 | 杭州梓晶生物有限公司 | Micro-fluidic chip detection control system |
| WO2021254519A1 (en) * | 2020-06-19 | 2021-12-23 | 中国疾病预防控制中心病毒病预防控制所 | Sample processing and detection apparatus and application thereof |
| CN112322473B (en) * | 2020-11-11 | 2021-07-20 | 苏州雅睿生物技术有限公司 | One-step POCT (point of care testing) real-time nucleic acid detection device |
| CN112359100B (en) * | 2020-11-11 | 2021-08-06 | 苏州雅睿生物技术股份有限公司 | Large-batch nucleic acid detection method |
| CN112700604A (en) * | 2021-01-11 | 2021-04-23 | 深圳市罗湖区人民医院 | Self-service nucleic acid detection method and device |
| CN112899139A (en) * | 2021-01-14 | 2021-06-04 | 北京普若博升生物科技有限公司 | Nucleic acid test strip card box and use method and application thereof |
| CN112940922A (en) * | 2021-02-19 | 2021-06-11 | 清华大学 | Full-integrated pathogen nucleic acid detection micro-fluidic chip |
| CN112795474A (en) * | 2021-02-19 | 2021-05-14 | 清华大学 | Full-integrated multi-index nucleic acid detection micro-fluidic chip |
| CN113333042B (en) * | 2021-06-21 | 2022-04-22 | 太原理工大学 | Micro-fluidic chip for nucleic acid detection and manufacturing method thereof |
| CN115537317A (en) * | 2021-06-30 | 2022-12-30 | 恒泰医疗有限公司 | Chip device and instrument for detecting nucleic acid and application thereof |
| CN114308149B (en) * | 2021-11-29 | 2024-03-01 | 北京机械设备研究所 | Chip sealing device and self-sealing modularized chip equipment |
| CN114164088B (en) * | 2021-12-10 | 2024-03-29 | 西安交通大学 | Chip structure, card box and method for detecting household nucleic acid |
| CN114100722A (en) * | 2021-12-27 | 2022-03-01 | 北京梓晶生物科技有限公司 | Portable full-automatic nucleic acid constant temperature amplification device |
| CN116493063B (en) * | 2022-01-21 | 2024-04-16 | 广州国家实验室 | Liquid transfer device and multichannel liquid transfer device |
| CN114517151A (en) * | 2022-02-16 | 2022-05-20 | 东南大学 | Liquid control component and conversion combination use method thereof |
| CN116891801A (en) * | 2022-04-02 | 2023-10-17 | 恒泰医疗有限公司 | Chip device and instrument for rapidly detecting nucleic acid and application thereof |
| CN114931986B (en) * | 2022-04-08 | 2022-12-27 | 厦门宝太生物科技股份有限公司 | Nucleic acid detection micro-fluidic device and nucleic acid detection method thereof |
| CN114480102A (en) * | 2022-04-18 | 2022-05-13 | 杭州安旭生物科技股份有限公司 | Nucleic acid detection device and nucleic acid detection method |
| CN114570449B (en) * | 2022-04-26 | 2022-08-16 | 广州国家实验室 | Liquid transfer device and multi-path parallel liquid transfer device |
| WO2023206092A1 (en) * | 2022-04-26 | 2023-11-02 | 广州国家实验室 | Liquid transfer device, multi-channel liquid transfer device, and method |
| WO2023206096A1 (en) * | 2022-04-26 | 2023-11-02 | 广州国家实验室 | Liquid transfer device and multi-path parallel liquid transfer device |
| WO2023231158A1 (en) * | 2022-05-30 | 2023-12-07 | 广州达安基因股份有限公司 | Handheld nucleic acid testing device having micro-fluidic chip, and use method therefor |
| CN115637209B (en) * | 2022-11-16 | 2023-03-14 | 广州国家实验室 | Sample extraction cartridge, sample extraction method, and nucleic acid detection apparatus |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070099288A1 (en) * | 2005-11-02 | 2007-05-03 | Affymetrix, Inc. | Microfluidic Methods, Devices, and Systems for Fluid Handling |
| CN107894512A (en) * | 2005-12-22 | 2018-04-10 | 霍尼韦尔国际公司 | Portable sample analyzer cartridge |
| CN203060320U (en) * | 2012-08-13 | 2013-07-17 | 王素辉 | Medicine dispensing injection syringe capable of automatically exhausting air |
| CN204714811U (en) * | 2015-02-09 | 2015-10-21 | 张国豪 | A kind of portable detection of nucleic acids equipment |
| AU2016350506B2 (en) * | 2015-11-04 | 2022-05-26 | Nitto Denko Corporation | Apparatus and system for biofluid sample dispensing and/or assay |
| CN107541452B (en) * | 2017-09-20 | 2023-12-15 | 杭州梓晶生物有限公司 | Microfluidic chip and chip assembly |
| CN110038655A (en) * | 2019-05-20 | 2019-07-23 | 徐州昊洋生物科技有限公司 | A kind of microfluidic control chip and system |
| CN210752733U (en) * | 2019-06-03 | 2020-06-16 | 利多(香港)有限公司 | Micro-fluidic integrated chip that detects |
| CN110841730B (en) * | 2019-10-21 | 2021-04-27 | 清华大学 | Micro-fluidic chip and tumor DNA detection chip |
| CN111644213B (en) * | 2020-05-25 | 2021-08-17 | 清华大学 | Fluid control device and fluid control method |
-
2020
- 2020-05-25 CN CN202010447201.1A patent/CN111647498B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111647498A (en) | 2020-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111647498B (en) | Integrated self-service nucleic acid detection device and use method thereof | |
| WO2021237396A1 (en) | Integrated self-service nucleic acid detection device and use method thereor | |
| CN110331089B (en) | Full-automatic nucleic acid extraction amplification detection micro-fluidic chip box and application thereof | |
| CN111621598B (en) | Immunochromatography test paper by adopting wire-free method and application thereof in CRISPR nucleic acid detection | |
| JP3580801B2 (en) | Methods for separating and purifying nucleic acids | |
| EP4219743A1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN111704994A (en) | Nucleic acid detection chip and detection method | |
| US20080003564A1 (en) | Sample processing | |
| CN107723210B (en) | Novel micro-fluidic chip device for nucleic acid detection | |
| JPWO2020257356A5 (en) | ||
| JPH03502167A (en) | Nucleic acid test strips and their use for detecting specified nucleic acids | |
| Chen et al. | Development of a generic microfluidic device for simultaneous detection of antibodies and nucleic acids in oral fluids | |
| Lu et al. | Integrated nucleic acid testing system to enable TB diagnosis in peripheral settings | |
| CN112760210B (en) | Novel coronavirus integrated nucleic acid rapid detection card box | |
| CN110055354B (en) | Nucleic acid composition, detection unit, microfluidic chip and detection device | |
| EP1380642B1 (en) | A method for the separation and purification of nucleic acid | |
| CN115651807A (en) | Nucleic acid detection chip and nucleic acid detection method | |
| CN216274050U (en) | Multi-channel nucleic acid secondary amplification kit | |
| CN109988869B (en) | Nucleic acid composition, detection unit, microfluidic chip and detection device | |
| CN104313179A (en) | Isothermal amplification detection kit and detection method for Zaire type Ebola virus | |
| CN211620516U (en) | Nucleic acid micro-fluidic control detection system | |
| US20220010368A1 (en) | Enhanced detection of low-copy-number nucleic acids in an integrated workflow | |
| WO2009149115A1 (en) | Cartridge for conducting biochemical assays | |
| JP4102149B2 (en) | Nucleic acid separation and purification equipment | |
| CN219117434U (en) | Closed Crispr/Cas12a nucleic acid detection reaction tube |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210908 Address after: 310018 2a20, building 2, No. 339, Baiyang street, Qiantang new area, Hangzhou, Zhejiang Applicant after: Hangzhou Zijing biological Co.,Ltd. Address before: 100084, Haidian District, 100084 mailbox, 82 boxes, Tsinghua University patent office, Beijing Applicant before: TSINGHUA University |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |