CN112544516A - Artificial reversing method for scylla paramamosain - Google Patents
Artificial reversing method for scylla paramamosain Download PDFInfo
- Publication number
- CN112544516A CN112544516A CN202011421812.5A CN202011421812A CN112544516A CN 112544516 A CN112544516 A CN 112544516A CN 202011421812 A CN202011421812 A CN 202011421812A CN 112544516 A CN112544516 A CN 112544516A
- Authority
- CN
- China
- Prior art keywords
- scylla paramamosain
- sex
- artificial
- scylla
- paramamosain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001672730 Scylla paramamosain Species 0.000 title claims abstract description 78
- 238000000034 method Methods 0.000 title claims abstract description 21
- 210000004907 gland Anatomy 0.000 claims abstract description 55
- 230000001548 androgenic effect Effects 0.000 claims abstract description 52
- 241000238557 Decapoda Species 0.000 claims abstract description 17
- 238000002347 injection Methods 0.000 claims description 22
- 239000007924 injection Substances 0.000 claims description 22
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 22
- 230000000366 juvenile effect Effects 0.000 claims description 15
- 230000008771 sex reversal Effects 0.000 claims description 15
- 230000002068 genetic effect Effects 0.000 claims description 13
- 210000001015 abdomen Anatomy 0.000 claims description 8
- 230000003187 abdominal effect Effects 0.000 claims description 8
- 239000004568 cement Substances 0.000 claims description 8
- 238000000227 grinding Methods 0.000 claims description 8
- 230000009182 swimming Effects 0.000 claims description 8
- 239000006228 supernatant Substances 0.000 claims description 7
- 235000013372 meat Nutrition 0.000 claims description 6
- 238000011161 development Methods 0.000 claims description 5
- 230000003203 everyday effect Effects 0.000 claims description 5
- 239000013535 sea water Substances 0.000 claims description 5
- 235000015170 shellfish Nutrition 0.000 claims description 5
- 238000005119 centrifugation Methods 0.000 claims description 4
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 claims description 2
- 238000012258 culturing Methods 0.000 claims description 2
- 229910052760 oxygen Inorganic materials 0.000 claims description 2
- 239000001301 oxygen Substances 0.000 claims description 2
- 238000011160 research Methods 0.000 abstract description 6
- 230000020509 sex determination Effects 0.000 abstract description 6
- 238000004519 manufacturing process Methods 0.000 abstract description 3
- 238000009360 aquaculture Methods 0.000 abstract description 2
- 244000144974 aquaculture Species 0.000 abstract description 2
- 238000001727 in vivo Methods 0.000 abstract 1
- 230000003321 amplification Effects 0.000 description 12
- 238000003199 nucleic acid amplification method Methods 0.000 description 12
- 238000009395 breeding Methods 0.000 description 10
- 230000001488 breeding effect Effects 0.000 description 7
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 6
- 239000000047 product Substances 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 3
- 239000011543 agarose gel Substances 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 239000004576 sand Substances 0.000 description 3
- 241000238421 Arthropoda Species 0.000 description 2
- 241001327110 Macrobrachium rosenbergii Species 0.000 description 2
- 241000238102 Scylla Species 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 241000208340 Araliaceae Species 0.000 description 1
- 241000238097 Callinectes sapidus Species 0.000 description 1
- 241000238424 Crustacea Species 0.000 description 1
- 230000004544 DNA amplification Effects 0.000 description 1
- 241000238555 Malacostraca Species 0.000 description 1
- 235000005035 Panax pseudoginseng ssp. pseudoginseng Nutrition 0.000 description 1
- 235000003140 Panax quinquefolius Nutrition 0.000 description 1
- 241000238030 Procambarus clarkii Species 0.000 description 1
- 206010047486 Virilism Diseases 0.000 description 1
- 230000001133 acceleration Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000002224 dissection Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000006408 female gonad development Effects 0.000 description 1
- 235000008434 ginseng Nutrition 0.000 description 1
- 210000002149 gonad Anatomy 0.000 description 1
- 230000005484 gravity Effects 0.000 description 1
- 230000012447 hatching Effects 0.000 description 1
- 231100000794 masculinization Toxicity 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 230000002611 ovarian Effects 0.000 description 1
- 210000001672 ovary Anatomy 0.000 description 1
- 210000003101 oviduct Anatomy 0.000 description 1
- 230000017448 oviposition Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 210000001177 vas deferen Anatomy 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K61/00—Culture of aquatic animals
- A01K61/50—Culture of aquatic animals of shellfish
- A01K61/59—Culture of aquatic animals of shellfish of crustaceans, e.g. lobsters or shrimps
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Marine Sciences & Fisheries (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention belongs to the technical field of aquaculture, and discloses an artificial reversing method for scylla paramamosain, which comprises the following steps: (1) acquiring the androgenic gland of the scylla paramamosain; (2) preparing an androgenic gland extract; (3) injecting the androgenic gland extract in vivo; (4) feeding the injected young crabs; (5) identification of sexually reversed individuals. The method has the characteristics of easy implementation, strong operability, easy mastering, capability of inverting the sex of the hereditary female crab into the physiological male crab and the like. The technology is suitable for developing basic theory research of the sex determination mechanism of the scylla paramamosain and is also suitable for industrial application fields such as parthenocarpic production and the like.
Description
Technical Field
The invention belongs to the technical field of aquaculture, and particularly relates to an artificial reversing method for scylla paramamosain.
Background
Scylla paramamosain (Scylla paramamosain) is commonly called blue crab, and belongs to Arthropoda (Arthropoda), Arctosca (Malacostraca), Decapoda (Decapoda), Paralithodaceae (Portuguidae), and Scylla (Scylla). The Scylla paramamosain has delicious meat and rich nutrition, is a high-grade marine product and is vegetatively reputed as 'ginseng in sea'. China is a main production area of Scylla paramamosain, the whole southeast coast from Jiangsu coast to south is a natural distribution area, and is also a main area for artificial culture. In recent years, the artificial breeding yield of the Scylla paramamosain in China is kept above 14 million tons all the time, the breeding scale is about 50 ten thousand mu, and the annual output value reaches 220 billion Yuan-ren Min-Ci. Therefore, the scylla paramamosain breeding industry occupies an important place in the marine economy of China.
In crustaceans such as shrimps and crabs, male vas deferens have androgenic glands, which have the effects of promoting the development of spermary and maintaining male sexual characteristics. Research shows that the removal of the androgenic gonad of the macrobrachium rosenbergii can induce the gynogenesis of the macrobrachium rosenbergii to generate an ovary, an oviduct and an oviposition hole; while the transfer of ovarian tissue into a desandrogenic male shrimp individual can induce ovarian development and the formation of a hatching chamber. In addition, the method of transplanting the androgenic gland can induce the masculinization of the immature female individual of the procambarus clarkii.
The research on the crab sex reversal technology has few reports, which severely limits the development of economic crab sex control and parthenocarpic breeding research.
Disclosure of Invention
The invention aims to provide an artificial reversing method for Scylla paramamosain, which solves the technical problem that the sex of the Scylla paramamosain cannot be controlled in the prior art. The preliminary research in the laboratory shows that the chromosome sex determination mechanism of the scylla paramamosain is ZZ/ZW type, and a PCR technology for rapidly identifying genetic sex is developed. On the basis, the invention further develops a sex control technology for reversing the female of the scylla paramamosain into the male, and provides important theory and material support for deeply developing sex control of the scylla paramamosain.
In order to solve the above-mentioned purpose, the invention adopts the following technical scheme:
an artificial sex reversal method for Scylla paramamosain is characterized in that an androgenic gland extract is obtained from male Scylla paramamosain and is injected into the body of Scylla paramamosain.
Preferably, the method comprises the following steps:
(1) selecting the male scylla paramamosain, dissecting and picking up the androgenic gland;
(2) artificially grinding the androgenic gland, centrifuging at low temperature, collecting supernatant to obtain the extract of the androgenic gland, and storing for later use;
(3) injecting the androgenic gland extract into the juvenile crab by using a micro-injector;
(4) feeding the injected young scylla paramamosain in an indoor cement pond to ensure that the water body contains sufficient dissolved oxygen and baits and maintain excellent water quality;
(5) and judging the physiological sex of the scylla paramamosain according to the abdominal morphology, and judging the genetic sex of the scylla paramamosain by utilizing a molecular technology so as to judge which individuals have sex reversal.
Preferably, the male scylla paramamosain is an individual with mature spermary development.
Preferably, the young scylla paramamosain is in the young crab III stage, and has complete body and limbs and good vitality.
Preferably, the injection part is the gap between the swimming foot and the fourth step foot of the scylla paramamosain.
Preferably, the injection amount is 0.2-0.3 equivalent of the androgenic gland extract per young Scylla paramamosain.
Calculating by obtaining 1 equivalent of the androgenic gland extract from each androgenic gland, and injecting 0.2-0.3 equivalent of the androgenic gland extract into each scylla paramamosain.
Preferably, in the step (2), the manual grinding is performed on ice all the time by using an electric grinder; the low-temperature centrifugation is performed by using a refrigerated centrifuge, the temperature is set to be 2-6 ℃, the rotating speed is 15000-.
And (3) acquiring the androgenic gland after dissection, placing the androgenic gland in a centrifuge tube containing a PBS solution, placing the centrifuge tube on ice, placing 20 androgenic glands in every 500ul of PBS, and grinding the androgenic gland to homogenate by using a grinder. And (4) performing low-temperature centrifugation by using a refrigerated centrifuge, wherein the rotating speed is calculated as 15000-17000g according to the gravity acceleration, and then collecting the supernatant, and refrigerating the supernatant at the same low temperature for later use.
Preferably, in the step (4), the feeding specifically comprises: at least culturing the scylla paramamosain to the VI stage of the scylla paramamosain, wherein the salinity of seawater is 15-25 per mill, the baits comprise crushed shellfish meat, the young crabs are fed once in the morning and at the evening every day, and water is changed once respectively, and the water change amount is 2/3 of the total water body.
Preferably, in the step (5), the physiological sex determination specifically includes: if the third and fourth abdominal sections on the two sides of the abdomen of the scylla paramamosain are narrow and concave, the individual is a physiological male; a physiological female if wider and smooth.
Preferably, in the step (5), the determination of the genetic sex specifically comprises: if the DNA molecular identification result of the scylla paramamosain shows a target strip, the scylla paramamosain is a hereditary female; if no band, it is a hereditary male. If an individual exhibits both a physiological male and a genetic female, the individual is a sex-reversed individual.
The implementation of the invention has the following beneficial effects:
the invention realizes the sex reversal of the marine economic crab Scylla paramamosain, and the sex reversal of the genetic type female is reversed to the physiological type male. The method has the characteristics of easy implementation, strong operability, easy mastering, capability of inverting the sex of the hereditary female crab into the physiological male crab and the like. The technology is suitable for developing basic theory research of the sex determination mechanism of the scylla paramamosain and is also suitable for industrial application fields such as parthenocarpic production and the like.
Drawings
FIG. 1 shows the results of sex determination of physiological type and sex determination of genetic type of scylla paramamosain individuals, wherein the left image shows male abdominal characteristics and the right image shows that a female specific DNA amplification band is amplified in the individuals.
Detailed Description
For better understanding of the present invention, the following embodiments and the accompanying drawings are used to describe the present invention in further detail, but those skilled in the art will appreciate that the following embodiments are not intended to limit the scope of the present invention, and any changes and modifications based on the present invention are within the scope of the present invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
(1) Acquisition of androgenic gland of scylla paramamosain and preparation of extract
Selecting male scylla paramamosain with the body mass of more than 200g, dissecting to obtain the androgenic gland, placing the androgenic gland in a centrifuge tube containing a PBS solution, placing the centrifuge tube on ice, placing 20 androgenic glands in every 500ul of PBS, and grinding the androgenic gland to homogenate by using a grinder. Centrifuging the ground mixture in a 4 deg.C refrigerated centrifuge at 16000g for 20min, transferring the supernatant to a new centrifuge tube, and storing in a 4 deg.C refrigerator.
(2) Injection of androgenic gland extract
The injection object is the scylla paramamosain which develops to the juvenile crab III stage, the right side abdomen of the juvenile crab is lightly wiped by 70% alcohol, then the androgenic gland extract is sucked by a micro-injector and injected into the juvenile crab from the gap between the swimming feet and the fourth step foot, the injection amount is 5ul, the injection amount is 0.2 equivalent of the androgenic gland, the male sex gland is sterilized by 70% alcohol again after injection, and the male sex gland is placed into a cement pond for breeding.
(3) Young crab breeding method after injection of androgenic gland extract
The young crabs are raised in the bottom area of 25-30 m2In the cement pond, sand with the thickness of 5cm is paved at the bottom of the pond, the salinity of seawater is 15-25 per thousand, the height of a water level is 60cm, bait mainly comprises crushed shellfish meat, the bait is fed once in the morning and at night every day, and water is changed once respectively, and the water change amount is 2/3 of the total water body. The young crabs can grow to the VI stage of the young crabs after being raised for about 35 days.
(4) Sex reversal individual identification of scylla paramamosain
And (4) carrying out sex identification on the individual sample which has been developed to the VI stage of the juvenile crab. The two sides of the abdomen (third and fourth abdominal segments) are narrower and concave, giving rise to a physiologically male sex, and the wider and smooth, giving rise to a physiologically female sex. DNA is extracted from swimming feet, a pair of female specific primers (forward primer: GTTCTGCTTATCATAGTTATTGCCTTG; reverse primer: CTGCCAGTGATTCAGTGACTTAGC) developed in the laboratory are utilized to carry out PCR amplification, an amplification product is electrophoresed in 0.1% agarose gel, if a female specific amplification band appears, the amplification band is a hereditary female, and otherwise, the amplification band is a hereditary male. As a result of the study, individuals who are both physiological males and genetic females, i.e., individuals who reverse from females to males, were found.
Example 2
(1) Acquisition of androgenic gland of scylla paramamosain and preparation of extract
Selecting male scylla paramamosain with the body mass of more than 200g, dissecting to obtain the androgenic gland, placing the androgenic gland in a centrifuge tube containing a PBS solution, placing the centrifuge tube on ice, placing 20 androgenic glands in every 500ul of PBS, and grinding the androgenic gland to homogenate by using a grinder. And (3) placing the ground mixture in a 2 ℃ refrigerated centrifuge for centrifugation at the rotation speed of 17000g for 25min, transferring the supernatant into a new centrifuge tube, and placing the centrifuge tube in a 2 ℃ refrigerator for storage for later use.
(2) Injection of androgenic gland extract
The injection object is the scylla paramamosain which develops to the juvenile crab III stage, the right side abdomen of the juvenile crab is lightly wiped by 70% alcohol, then the androgenic gland extract is sucked by a micro-injector and injected into the juvenile crab from the gap between the swimming feet and the fourth step foot, the injection amount is 5ul, the injection amount is 0.2 equivalent of the androgenic gland, the male sex gland is sterilized by 70% alcohol again after injection, and the male sex gland is placed into a cement pond for breeding.
(3) Young crab breeding method after injection of androgenic gland extract
The young crabs are raised in the bottom area of 25-30 m2In the cement pond, sand with the thickness of 5cm is paved at the bottom of the pond, the salinity of seawater is 15-25 per thousand, the height of a water level is 60cm, bait mainly comprises crushed shellfish meat, the bait is fed once in the morning and at night every day, and water is changed once respectively, and the water change amount is 2/3 of the total water body. The young crabs can grow to the VI stage of the young crabs after being raised for about 35 days.
(4) Sex reversal individual identification of scylla paramamosain
And (4) carrying out sex identification on the individual sample which has been developed to the VI stage of the juvenile crab. The two sides of the abdomen (third and fourth abdominal segments) are narrower and concave, giving rise to a physiologically male sex, and the wider and smooth, giving rise to a physiologically female sex. DNA is extracted from swimming feet, a pair of female specific primers (forward primer: GTTCTGCTTATCATAGTTATTGCCTTG; reverse primer: CTGCCAGTGATTCAGTGACTTAGC) developed in the laboratory are utilized to carry out PCR amplification, an amplification product is electrophoresed in 0.1% agarose gel, if a female specific amplification band appears, the amplification band is a hereditary female, and otherwise, the amplification band is a hereditary male. As a result of the study, individuals who are both physiological males and genetic females, i.e., individuals who reverse from females to males, were found.
Example 3
(1) Acquisition of androgenic gland of scylla paramamosain and preparation of extract
Selecting male scylla paramamosain with the body mass of more than 200g, dissecting to obtain the androgenic gland, placing the androgenic gland in a centrifuge tube containing a PBS solution, placing the centrifuge tube on ice, placing 20 androgenic glands in every 500ul of PBS, and grinding the androgenic gland to homogenate by using a grinder. Centrifuging the ground mixture in 6 deg.C refrigerated centrifuge at 15000g for 30min, transferring the supernatant to new centrifuge tube, and storing in 6 deg.C refrigerator.
(2) Injection of androgenic gland extract
The injection object is the scylla paramamosain which develops to the juvenile crab III stage, the right side abdomen of the juvenile crab is lightly wiped by 70% alcohol, then the androgenic gland extract is sucked by a micro-injector and injected into the juvenile crab from the gap between the swimming feet and the fourth step foot, the injection amount is 7.5ul, the injection amount is 0.3 equivalent of the androgenic gland, the male crab is disinfected by 70% alcohol again after injection, and the male crab is placed into a cement pond for breeding.
(3) Young crab breeding method after injection of androgenic gland extract
The young crabs are raised in the bottom area of 25-30 m2In the cement pond, sand with the thickness of 5cm is paved at the bottom of the pond, the salinity of seawater is 15-25 per thousand, the height of a water level is 60cm, bait mainly comprises crushed shellfish meat, the bait is fed once in the morning and at night every day, and water is changed once respectively, and the water change amount is 2/3 of the total water body. The young crabs can grow to the VI stage of the young crabs after being raised for about 35 days.
(4) Sex reversal individual identification of scylla paramamosain
And (4) carrying out sex identification on the individual sample which has been developed to the VI stage of the juvenile crab. The two sides of the abdomen (third and fourth abdominal segments) are narrower and concave, giving rise to a physiologically male sex, and the wider and smooth, giving rise to a physiologically female sex. DNA is extracted from swimming feet, a pair of female specific primers (forward primer: GTTCTGCTTATCATAGTTATTGCCTTG; reverse primer: CTGCCAGTGATTCAGTGACTTAGC) developed in the laboratory are utilized to carry out PCR amplification, an amplification product is electrophoresed in 0.1% agarose gel, if a female specific amplification band appears, the amplification band is a hereditary female, and otherwise, the amplification band is a hereditary male. As a result of the study, individuals who are both physiological males and genetic females, i.e., individuals who reverse from females to males, were found.
Effect example 1
The sex identification of the Scylla paramamosain in the embodiments 1-3 is recorded, and by taking the sex identification result of one individual as an example, the visual observation result is shown in the left graph of the graph in FIG. 1, and the molecular technology identification result is shown in the right graph in FIG. 1, so that the Scylla paramamosain is found to be a physiological male and a genetic female individual, and the sex reversal of the Scylla paramamosain is realized.
The above disclosure is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the scope of the present invention, therefore, the present invention is not limited by the appended claims.
Claims (10)
1. An artificial sex reversal method for Scylla paramamosain is characterized in that an androgenic gland extract is obtained from male Scylla paramamosain and is injected into the body of Scylla paramamosain.
2. The artificial reversing method of Scylla paramamosain as claimed in claim 1, comprising the steps of:
(1) selecting the male scylla paramamosain, dissecting and picking up the androgenic gland;
(2) artificially grinding the androgenic gland, centrifuging at low temperature, collecting supernatant to obtain the extract of the androgenic gland, and storing for later use;
(3) injecting the androgenic gland extract into the juvenile scylla paramamosain by using a micro-injector;
(4) feeding the injected young scylla paramamosain in an indoor cement pond to ensure that the water body contains sufficient dissolved oxygen and baits and maintain excellent water quality;
(5) and judging the physiological sex of the scylla paramamosain according to the abdominal morphology, and judging the genetic sex of the scylla paramamosain by utilizing a molecular technology so as to judge which individuals have sex reversal.
3. The artificial sex reversal method of Scylla paramamosain according to claim 1 or 2, wherein the male Scylla paramamosain is an individual mature in spermary development.
4. The artificial reversal method of Scylla paramamosain as claimed in claim 1 or 2, wherein the development stage of Scylla paramamosain is juvenile crab III stage.
5. The artificial reversing method of Scylla paramamosain as claimed in claim 1 or 2, wherein the injection site is the gap between the swimming foot and the fourth step foot of Scylla paramamosain.
6. The artificial sex reversal method of Scylla paramamosain as claimed in claim 1 or 2, wherein the amount of said injection is 0.2-0.3 equivalent of said androgenic gland extract per Scylla paramamosain.
7. The artificial reversing method of scylla paramamosain as claimed in claim 2, wherein in the step (2), the artificial grinding is performed on ice all the way by using an electric grinder; the low-temperature centrifugation is performed by using a refrigerated centrifuge, the temperature is set to be 2-6 ℃, the rotating speed is 15000-.
8. The artificial reversal method of Scylla paramamosain as claimed in claim 2, wherein in the step (4), the raising is specifically: at least culturing the scylla paramamosain to the VI stage of the scylla paramamosain, wherein the salinity of seawater is 15-25 per mill, the baits comprise crushed shellfish meat, the young crabs are fed once in the morning and at the evening every day, and water is changed once respectively, and the water change amount is 2/3 of the total water body.
9. The artificial sex reversal method for scylla paramamosain as claimed in claim 2, wherein in the step (5), the judgment of the physiological sex specifically comprises: if the third and fourth abdominal sections on the two sides of the abdomen of the scylla paramamosain are narrow and concave, the individual is a physiological male; a physiological female if wider and smooth.
10. The artificial sex reversal method for scylla paramamosain as claimed in claim 2, wherein in the step (5), the determination of the genetic sex specifically comprises: if the DNA molecular identification result of the scylla paramamosain shows a target strip, the scylla paramamosain is a hereditary female; if no band, it is a hereditary male. If an individual exhibits both a physiological male and a genetic female, the individual is a sex-reversed individual.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011421812.5A CN112544516A (en) | 2020-12-08 | 2020-12-08 | Artificial reversing method for scylla paramamosain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011421812.5A CN112544516A (en) | 2020-12-08 | 2020-12-08 | Artificial reversing method for scylla paramamosain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112544516A true CN112544516A (en) | 2021-03-26 |
Family
ID=75059411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011421812.5A Pending CN112544516A (en) | 2020-12-08 | 2020-12-08 | Artificial reversing method for scylla paramamosain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112544516A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102283149A (en) * | 2011-07-05 | 2011-12-21 | 中国科学院水生生物研究所 | Culturing method for sex reversal of female carp to male carp |
| CN108570494A (en) * | 2018-04-10 | 2018-09-25 | 汕头大学 | A kind of Scylla paramamosain genetic sex rapid identification method of based on PCR technology |
| US20180317459A1 (en) * | 2017-05-08 | 2018-11-08 | Institute Of Hydrobiology, Chinese Academy Of Sciences | Method for producing yy super-male and xy physiological female common carps |
| CN109988763A (en) * | 2019-03-27 | 2019-07-09 | 潍坊科技学院 | Eriocheir sinensis sex reversal siRNA and its application |
-
2020
- 2020-12-08 CN CN202011421812.5A patent/CN112544516A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102283149A (en) * | 2011-07-05 | 2011-12-21 | 中国科学院水生生物研究所 | Culturing method for sex reversal of female carp to male carp |
| US20180317459A1 (en) * | 2017-05-08 | 2018-11-08 | Institute Of Hydrobiology, Chinese Academy Of Sciences | Method for producing yy super-male and xy physiological female common carps |
| CN108570494A (en) * | 2018-04-10 | 2018-09-25 | 汕头大学 | A kind of Scylla paramamosain genetic sex rapid identification method of based on PCR technology |
| CN109988763A (en) * | 2019-03-27 | 2019-07-09 | 潍坊科技学院 | Eriocheir sinensis sex reversal siRNA and its application |
Non-Patent Citations (2)
| Title |
|---|
| 刘红等: "Masculinization of female Eriocheir sinensis by injecting the extract of androgenic gland of E.sinensis and Scylla paramamosain", 《水产学报》 * |
| 羊茜等: "《河蟹这样养殖就赚钱》", 31 October 2013, 科学技术文献出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103891662B (en) | Moire lithosporic raun and seven is with lithosporic milter cross breeding method | |
| CN108531408B (en) | Rhodotorula mucilaginosa new strain and microecological preparation | |
| CN102007879A (en) | Method for cultivating gynogenetic carps | |
| CN102757934B (en) | Construction method of fin cell line of anabarilius grahami | |
| CN104304099B (en) | A kind of cultural method of trunk freshwater mussel Lutraria sieboldii Reeve juvenile mollusk outdoor tank-culture intermediate rearings | |
| Qin et al. | A bacterial infection by Vibrio harveyi causing heavy reduction of cultured lined seahorse Hippocampus erectus. | |
| CN106614125A (en) | Breeding method of hybrid bream | |
| CN104431506A (en) | Method for preparing frozen sea horse feed | |
| CN109479779A (en) | A kind of japonicus high yield environment-protecting cultivation method | |
| CN110521641A (en) | A kind of artificial hybridization breeding method growing fast grouper | |
| CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
| CN108218974B (en) | Sepiella maindroni neuropeptide and application thereof | |
| CN111165401B (en) | Quick and efficient breeding method for tilapia mossambica | |
| CN112544516A (en) | Artificial reversing method for scylla paramamosain | |
| CN112568159A (en) | Disease prevention and control method for organic shrimp culture | |
| CN109006605B (en) | Freshwater ecological breeding method for penaeus vannamei boone | |
| CN105671084A (en) | Genome-editing-based seawater flounder germplasm building method and application | |
| CN111357693A (en) | Ecological breeding method suitable for breeding red swamp crayfish in brackish water | |
| CN110999836B (en) | Nutrition strengthening method for promoting growth of penaeus orientalis larvae | |
| CN104996777A (en) | Turtle blood attractant leech culture liquid feed and preparation method thereof | |
| CN108990853B (en) | Parent-mussel ripening cultivation method for common mussels | |
| Solar et al. | Effect of salmon gonadotropin and a gonadotropin releasing hormone analogue on ovarian hydration and ovulation in captive sablefish (Anoplopoma fimbria) | |
| WO2015172573A1 (en) | Initial feed for early-stage larvas of eels and culturing method therefor | |
| CN111011273A (en) | Artificial propagation method of Lutjanus argentimaculatus | |
| CN115486397B (en) | Method for improving growth speed and stress resistance of young litopenaeus vannamei |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |