CN112522385A

CN112522385A - Kit for detecting DNM2 gene copy number variation

Info

Publication number: CN112522385A
Application number: CN202011453522.9A
Authority: CN
Inventors: 余艳; 李慧源; 周梅华; 代冰; 李淼; 唐春燕
Original assignee: Changsha Jinyu Medical Laboratory Co Ltd
Current assignee: Changsha Jinyu Medical Laboratory Co Ltd
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2021-03-19

Abstract

The invention discloses a kit for detecting DNM2 gene copy number variation. The kit comprises the following primer pairs: Q-DNM 2-LF: GGAGCAACGGCTACAGACCGC, respectively; Q-DNM 2-LR: CTCTTCCATCCCGCGGTTGGGC, respectively; Q-DNM 2-MF: GGACGCCTTCAGCTCCATGCGC, respectively; Q-DNM 2-MR: CGGCCCACGAAGTTCTCCAGCTGC, respectively; Q-DNM 2-RF: CCAAGGTCTTCTTGGGCACGG, respectively; Q-DNM 2-RR: CCACTGGGCCAGGCTTGCCGCACG are provided. The method is simple and quick, low in pre-experiment cost and suitable for small-batch detection and verification.

Description

Kit for detecting DNM2 gene copy number variation

Technical Field

The invention belongs to the technical field of biomedical detection, and particularly relates to a kit for detecting DNM2 gene copy number variation.

Background

The DNM2(dynamin 2) gene is a transcription factor involved in various cellular functions such as endocytosis, phagocyte formation, intracellular trafficking, interaction with actin and microtubule network, and promotion of apoptosis. The DNM2 gene can cause Central Nuclear Myopathy (CNM) type 1 and peroneal muscular atrophy, and fatal congenital contracture syndrome when pathogenic variation occurs. Researches find that the CNM and DNM2 gene mutation are not obviously related, but are closely related to the mRNA expression level of the CNM, and the reduction of the mRNA expression level can obviously improve pathological changes, and the phenomenon indicates that a unique molecular mechanism exists in the onset of the CNM. Earlier studies found that DNM2 contains a plurality of intragenic miRNAs, intragenic miR-199a-1 is often synchronously increased with DNM2 expression when muscles are injured, and the level of intervention miR-199a-1 can change the muscle repair process and the proportion of central nuclear muscle fibers. It is proposed that CNM may be caused by overexpression of intragenic miRNA of DNM2, which delays muscle differentiation by regulating target gene expression, resulting in increased proportion of central nuclear muscle fibers.

Copy Number Variation (CNV) generally refers to an increase or decrease in Copy number of large genomic fragments of 1kb or more in length, mainly expressed as deletions, duplications, and inversions at the sub-microscopic level. Compared to SNPs, CNVs are not abundant but involve more genomic sequences with higher mutation rates. CNV is an important cause of human genetic diversity and genetic variation among individuals, and can be one of genetic polymorphisms in addition to a part of diseases. In 2004, two milestone studies found that this submicron variation in DNA copy number (<500kb) was widely present in the normal human genome.

CNV is an important component of genome variation (SV), and in the past years, with the continuous mining of genome information and the progress of detection technology, the CNV plays an increasingly important role in the pathogenesis of genetic diseases, and its pathogenic mechanism may be related to gene dose effect, gene disruption, gene fusion, location effect, etc. The deep research on the CNV can be helpful for better understanding the pathogenesis of genetic diseases and is beneficial to the research and development of molecular diagnosis and therapeutic means.

The most widely used method based on PCR technology is qPCR, which utilizes a relative quantitative real-time PCR system to analyze the copy number of a target gene (with copy number polymorphism) and a reference gene (without copy number polymorphism) of a detection sample by using a 2^ -delta Ct relative quantitative analysis method (Livak and Schmittgen, 2001). The method is simple and easy to operate, high in sensitivity, good in repeatability, high in speed and less in pollution, but is not suitable for high-throughput detection of large samples.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a kit for detecting DNM2 gene copy number variation.

In order to achieve the purpose, the technical scheme provided by the invention is as follows:

the kit for detecting DNM2 gene copy number variation contains the following primer pairs:

Q-DNM2-LF：GGAGCAACGGCTACAGACCGC(SEQ ID NO.1)

Q-DNM2-LR：CTCTTCCATCCCGCGGTTGGGC(SEQ ID NO.2)

Q-DNM2-MF：GGACGCCTTCAGCTCCATGCGC(SEQ ID NO.3)

Q-DNM2-MR：CGGCCCACGAAGTTCTCCAGCTGC(SEQ ID NO.4)

Q-DNM2-RF：CCAAGGTCTTCTTGGGCACGG(SEQ ID NO.5)

Q-DNM2-RR：CCACTGGGCCAGGCTTGCCGCACG(SEQ ID NO.6)。

preferably, the kit further comprises an internal reference primer pair:

Q-RP-F：GCAGATTTGGACCTGCGACGGG(SEQ ID NO.7)

Q-RP-R：GTGAGCGGCTGTCTCCACAACACC(SEQ ID NO.8)。

the procedure for amplification using the primer pairs in the above kit was as follows:

①：95℃，5min；

②：95℃，10s；60℃，30s；40Cycles；

③：95℃，15s；60℃，60s；95℃，15s。

the fluorescent chemistry used for qPCR can be divided into TaqMan fluorescent probes and SYBR Green fluorescent dyes. In the invention, the specific principle of copy number detection by using the SYBR Green fluorescent dye method is as follows: when the target sequence is a normal (copy number 2) sequence, the expression levels of the target sequence and the reference sequence are consistent, and the amplification efficiencies of the target sequence and the reference sequence are consistent by primer optimization in a preliminary experiment, C t values of the target sequence and C t values of the reference sequence are equal, and the target sequence amplification curve and the reference sequence amplification curve are matched together as shown on the amplification curve. The Normalized Ratio (NR) calculated according to the formula 2-delta Ct is about 1. When the target sequence has single copy deletion (copy number is 1), the expression level is equal to 1/2 of the internal reference gene RP, the C t value is increased by about 1, and the NR value calculated by a 2^ delta Ct formula after the amplification curve of the internal reference gene RP of the target gene amplification curve is about 0.5. When the double copy is deleted (the copy number is 0), the target gene does not exist, the amplification curve is similar to that of the negative control, and the NR value calculated according to the formula of 2-delta Ct is about 0. When the copy number of the target gene is increased (copy number >2), the expression level of the target gene relative to the reference gene RP is increased, the C t value is decreased, and the amplification curve of the target gene is further apart from the amplification curve of the reference gene RP as the amplification curve of the target gene is ahead of the amplification curve of the reference gene RP and the copy number of the target gene is increased. When the single copy is increased (the copy number is 3), the NR value calculated by the formula of 2^ -delta Ct is about 1.5; when the double copy increases (copy number is 4), the NR value calculated by the formula 2^ - Δ Δ Ct is around 2.0, the copy numbers of other cases are repeated, and so on.

The amplification length of the primer is generally about 100bp, and the primer is not suitable to be too long or too short; the designed primer should avoid hairpin structure and Single Nucleotide Polymorphism (SNP) site at the annealing position; the formation of dimer between primers is avoided, and the amplification efficiency of the primers is preferably close to 100%. In the invention, a nucleotide sequence of the No.1 exon (chr19: 10828909-10829089; hg19) of the DNM2 gene and the front and rear ends are obtained through a UCSC database, a homologous sequence or a pseudogene region existing in a region to be detected is confirmed by using Blat in tools in the UCSC, a selected primer sequence avoids the homologous region, the annealing temperature is confirmed, whether a secondary structure exists or not is confirmed, and the secondary structure is reduced by changing one to two bases at the 5' end position of the primer, such as a Q-DNM2-RR primer, from CACTGGGCCAGGCTTGCCGCTGG to CCACTGGGCCAGGCTTGCCGCACG (SEQ ID NO. 6). Finally, 3 groups of short fragment primer pairs (L/M/R) are designed, and a pair of internal reference primers RP (RPP30) is added, so that the specificity is strong, and the detection is accurate.

The invention detects copy number variation (chromosome absolute position: chr19: 10828909-10829089; hg19) on the exon 1 of DNM2 gene by a QPCR method and a Syber Green fluorescent dye method. Compared with the problems of high cost, insufficient accuracy of copy number change detection results and the like of second-generation sequencing, the method is simple and quick, low in pre-experiment cost and suitable for small-batch detection and verification.

Drawings

FIG. 1: Q-DNM2-LF + Q-DNM2-LR optimized pre-amplification efficiency;

FIG. 2: Q-DNM2-MF + Q-DNM2-MR optimizes the pre-amplification efficiency;

FIG. 3: Q-DNM2-RF + Q-DNM2-RR pre-optimization amplification efficiency;

FIG. 4: the amplification efficiency before optimization of Q-RP-F + Q-RP-R;

FIG. 5: the amplification efficiency of the optimized Q-DNM2-LF + Q-DNM2-LR is improved;

FIG. 6: Q-DNM2-MF + Q-DNM2-MR optimized amplification efficiency;

FIG. 7: Q-DNM2-RF + Q-DNM2-RR optimized amplification efficiency;

FIG. 8: the amplification efficiency of the optimized Q-RP-F + Q-RP-R is improved;

FIG. 9: the pre-optimization dissolution profile of Q-DNM2-LF + Q-DNM 2-LR;

FIG. 10: Q-DNM2-MF + Q-DNM2-MR pre-optimization dissolution profile;

FIG. 11: the pre-optimized dissolution profile of Q-DNM2-RF + Q-DNM 2-RR;

FIG. 12: the dissolution curve before optimization of Q-RP-F + Q-RP-R;

FIG. 13: the optimized dissolution curve of DNM2-LF + Q-DNM 2-LR;

FIG. 14: the dissolution curve of the optimized Q-DNM2-MF + Q-DNM 2-MR;

FIG. 15: the optimized dissolution curve of Q-DNM2-RF + Q-DNM 2-RR;

FIG. 16: the dissolution curve of the optimized Q-RP-F + Q-RP-R.

Detailed Description

1. Primer testing

1) Linear DNA preparation (table 1): the standard Human genetic DNA (253ng/ul) was diluted in a gradient manner, and 13ul was added37ul ddH₂O, vortex, and micro-separate to a concentration of 66 ng/uL.

Then diluted by 10 times gradient, 20ul was added to 180ul ddH₂In O, the next gradient dilution can be carried out after full vortex mixing is needed each time.

TABLE 1

2) Experiment system (Table 2)

TABLE 2

3) Amplification procedure (Table 3)

TABLE 3

4) Analysis of results

ABI7500 settings:

the expert Prop selects quantification-Relative Standard Curve and SYBR Green Reagents.

The results are as follows:

primer DNM 2-L: the amplification efficiency of the primer is 92.86 percent, and the peak of the dissolution curve is single;

primer DNM 2-M: the amplification efficiency of the primer is 95.1 percent, and the peak of a dissolution curve is single;

primer DNM 2-R: the amplification efficiency of the primer is 93.34%, and the peak of the dissolution curve is single;

primer RP: the amplification efficiency of the primer is 94.55 percent, and the peak of the dissolution curve is single;

the amplification efficiency of the primers is as follows: the PCR manual stipulates that similar relative quantitative calculation can be carried out under the condition that the difference of PCR amplification efficiency of two pairs of primers of the target gene and the reference gene RP is not more than 10%. For this reason we stipulate that primers with E values between 90 and 110% pass. As shown in FIGS. 1 to 8, the amplification efficiencies before and after the optimization of the primers are out of the range of 90% to 110%, and the amplification efficiency is poor, while the amplification efficiency after the optimization is close to 100%, and the amplification efficiency is high.

Primers before optimization were as follows:

Q-DNM2-LF：GAGCAACGGCTACAGACGCC(SEQ ID NO.9)

Q-DNM2-LR：CTTCCATCCCGCGGTTGCC(SEQ ID NO.10)

Q-DNM2-MF：GACGCCTTCAGCTCCATCGG(SEQ ID NO.11)

Q-DNM2-MR：GCCCACGAAGTTCTCCAGCA(SEQ ID NO.12)

Q-DNM2-RF：CAAGGTCTTCTTGGGCTGG(SEQ ID NO.13)

Q-DNM2-RR：CACTGGGCCAGGCTTGCCGCTGG(SEQ ID NO.14)。

the internal reference primers before optimization are as follows:

Q-RP-F：AGATTTGGACCTGCGAGCG(SEQ ID NO.15)

Q-RP-R：GAGCGGCTGTCTCCACAAGT(SEQ ID NO.16)。

the optimized primers and the internal reference primers are the primers shown in SEQ ID NO.1 to SEQ ID NO. 8.

Dissolution curve: because SYBR Green dye can not only be specifically combined with a target gene, specific amplification of a primer is required to be ensured, melting curve analysis can be carried out, and a uniform melting peak is qualified. Non-specific amplification, as rejected dnm2.w2r, resulted in large errors in copy number calculations (non-single dissolution curve peaks). As shown in FIGS. 9-16, the dissolution curve before and after primer optimization shows that the dissolution curve has a single peak and poor effect due to non-specific amplification of primers, while the dissolution curve has a single peak and good effect due to specific amplification of primers.

2. Clinical sample testing

The clinical test sample is a second-generation sequencing Nextseq 550 platform test sample, and the result indicates that the sequencing depth of the clinical test sample in the chr19:10828909-10829089 area is lower than half of the adjacent two exon areas, and the IGV result is as follows considering the possibility of heterozygous deletion: the sequencing depth of the region chr19:10828890-10829162 is less than 56, the sequencing depth of the region chr19:10822038-10839535 is about 114, and the sequencing depth of the region chr19:10861715-10879212 is about 93.

Result verification

1) A reagent such as 2 × AceQ SYBR qPCR Master Mix is diluted to 5 μ M and thawed at normal temperature, and an EP tube, a tip, and a sample application gun are prepared.

2) The reagents and primers were shaken slightly and then centrifuged instantaneously. The EP tube was labeled according to the kind of primer.

3) The system was prepared according to the test items (table 4):

TABLE 4

4) Reagent and sample set-up

The prepared reagents were added to a 96-well optical PCR plate and ready for loading (FIG. 1). Adding the same sample into a group of 12 holes; wherein, one part is a target gene primer system, the other part is an internal reference gene RP primer system, and the three parts are all provided with three compound holes. A normal human sample STD and an NTC must be included in each primer test. Sample1, Sample 2, and Sample 3 in this experiment correspond to the second generation sequencing Sample and its parents, respectively.

5) The sample DNA concentration was determined and diluted to 5ng/ul and 2ul of the diluted sample was pipetted into the corresponding wells. After covering and sealing the membrane, the membrane is centrifuged for a short time and prepared for ABI7500 amplification.

6) And (4) operating the computer ABI7500 and setting software.

(1)Experiment properties：

The type of experiment: quantitation-comparative CT (Delta CT)

Reagent type: SYBR @ Green Regents

Other parameters are defaulted.

(2)Plate setup：

Define target, namely naming a target gene and an internal reference gene RP respectively;

a Define sample is named;

selecting the position of the named gene and sample;

selecting Reference sample as STD;

selecting RP by endogenesis control;

select the ROX for passive reconfiguration.

Other parameters are defaulted.

(3) Run method with an experimental system of 20ul (Table 5);

TABLE 5

7) Analysis of results

By deriving raw CT data (table 6):

TABLE 6

	Sample1	Sample2	Sample3	STD
					DNM2-L	27.15	26.89	27.22	26.07
DNM2-R	25.80	25.66	25.89	24.88
					DNM2-M	26.23	26.09	26.31	25.33
RP	25.90	26.48	25.96	25.67

Δ Ct ═ Ct (target gene) -Ct (reference gene)

Δ Δ Ct ═ Δ Ct (sample to be measured) - Δ Ct (std)

Copy number 2^ (2^ -Delta Ct)

The value of 2X (2^ -delta. Ct) of each data was calculated according to the calculation formula (Table 7)

TABLE 7

	Sample1	Sample2	Sample3
				DNM2-L	1.11	1.97	1.10
DNM2-R	1.24	2.04	1.21
				DNM2-M	1.26	2.07	1.24

Copy number of each sample data (Table 8)

TABLE 8

	Sample1	Sample2	Sample3
				DNM2-L	Single copy	Dual copy	Single copy
DNM2-R	Single copy	Dual copy	Single copy
				DNM2-M	Single copy	Dual copy	Single copy

The results show that the calculated results of the 3 groups of primers are similar to those of the same sample, and are in line with expectation, and the obtained copy number result is consistent with the second-generation sequencing and shows that the deletion is from the mother. The primer can be used for detecting the copy number variation of the region of the exon 1 (chr19: 10828909-10829089; hg19) of the DNM2 gene.

Sequence listing

<110> Changsha gold Domain medical laboratory Co., Ltd

<120> kit for detecting DNM2 gene copy number variation

<141> 2020-12-11

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> null

<400> 1

ggagcaacgg ctacagaccg c 21

<210> 2

<211> 22

<212> DNA

<213> null

<400> 2

ctcttccatc ccgcggttgg gc 22

<210> 3

<211> 22

<212> DNA

<213> null

<400> 3

ggacgccttc agctccatgc gc 22

<210> 4

<211> 24

<212> DNA

<213> null

<400> 4

cggcccacga agttctccag ctgc 24

<210> 5

<211> 21

<212> DNA

<213> null

<400> 5

ccaaggtctt cttgggcacg g 21

<210> 6

<211> 24

<212> DNA

<213> null

<400> 6

ccactgggcc aggcttgccg cacg 24

<210> 7

<211> 22

<212> DNA

<213> null

<400> 7

gcagatttgg acctgcgacg gg 22

<210> 8

<211> 24

<212> DNA

<213> null

<400> 8

gtgagcggct gtctccacaa cacc 24

<210> 9

<211> 20

<212> DNA

<213> null

<400> 9

gagcaacggc tacagacgcc 20

<210> 10

<211> 19

<212> DNA

<213> null

<400> 10

cttccatccc gcggttgcc 19

<210> 11

<211> 20

<212> DNA

<213> null

<400> 11

gacgccttca gctccatcgg 20

<210> 12

<211> 20

<212> DNA

<213> null

<400> 12

gcccacgaag ttctccagca 20

<210> 13

<211> 19

<212> DNA

<213> null

<400> 13

caaggtcttc ttgggctgg 19

<210> 14

<211> 23

<212> DNA

<213> null

<400> 14

cactgggcca ggcttgccgc tgg 23

<210> 15

<211> 19

<212> DNA

<213> null

<400> 15

agatttggac ctgcgagcg 19

<210> 16

<211> 20

<212> DNA

<213> null

<400> 16

gagcggctgt ctccacaagt 20

Claims

1. A kit for detecting DNM2 gene copy number variation is characterized in that the kit contains the following primer pairs:

Q-DNM2-LF：GGAGCAACGGCTACAGACCGC

Q-DNM2-LR：CTCTTCCATCCCGCGGTTGGGC

Q-DNM2-MF：GGACGCCTTCAGCTCCATGCGC

Q-DNM2-MR：CGGCCCACGAAGTTCTCCAGCTGC

Q-DNM2-RF：CCAAGGTCTTCTTGGGCACGG

Q-DNM2-RR：CCACTGGGCCAGGCTTGCCGCACG。

2. the kit of claim 1, further comprising an internal reference primer pair:

Q-RP-F：GCAGATTTGGACCTGCGACGGG

Q-RP-R：GTGAGCGGCTGTCTCCACAACACC。

3. the kit of claim 2, wherein the procedure for amplification using the primer pairs in the kit is as follows:

①：95℃，5min；

②：95℃，10s；60℃，30s；40Cycles；

③：95℃，15s；60℃，60s；95℃，15s。