TWI674320B - Method and kit for making prognosis on gitelman's syndrome - Google Patents

Abstract

The present disclosure relates to a method for predicting whether an individual is suffering from Gitelman's syndrome or at risk of suffering from Gitelman's syndrome. The method includes: amplifying an SLC12A3 gene fragment; determining whether a mutation exists in the SLC12A3 gene fragment; and performing a pre-judgment based on the existence of the mutation. The present disclosure also provides a kit for predicting Gitman syndrome by the aforementioned method.

Description

Method and kit for predicting Gitman syndrome

This disclosure relates to the field of predictive disease. More specifically, the present disclosure relates to a method and kit for predicting whether an individual has Gitelman's syndrome (GS) or is at risk of developing Gitteman's syndrome.

Gitman syndrome is a somatic chromosomal recessive renal tubular disease that currently has a global incidence of approximately 1: 40,000. The physical manifestations of the disease include hypokalemia, metabolic alkalosis, hypomagnesemia, and hypocalciuria. Common clinical symptoms include salt craving, nocturia, tetanic episodes, paresthesias, and muscle atrophy due to paralysis.

Gitman syndrome is mainly caused by multiple mutation types of the SLC12A3 gene, and these mutation genotypes have a high degree of genetic heterogeneity in different ethnic groups. The mutation sites that have been reported in the Chinese ethnic group have been reported. More than 50 species. However, these types of mutations may include some uniallelic mutations or undetectable mutations. Furthermore, a single patient may have a combination of multiple mutation sites simultaneously, which makes the detection of Gitman syndrome Certain difficulties, not only increase the probability of misdiagnosis, but also lead to a substantial increase in the time and money of diagnosis.

Therefore, there is an urgent need in the field to which the present invention belongs to develop a detection method and kit for comprehensively and rapidly predicting patients suffering from Gitman syndrome or patients at risk for Gitman syndrome.

This summary is intended to provide a simplified summary of this disclosure so that readers may have a basic understanding of this disclosure. This summary is not a comprehensive overview of the disclosure, and it is not intended to indicate important / critical elements of the embodiments of the invention or to define the scope of the invention.

One aspect of the present invention relates to a method for detecting Gitman syndrome. The method uses at least one primer pair to amplify the SLC12A3 gene fragment, and then screens out the SLC12A3 gene fragment containing at least one mutation, so as to quickly and accurately obtain the prediction and detection results of Gitman syndrome.

Specifically, the method of using an in vitro sample to predict whether an individual has or is at risk of having Gitman syndrome includes the following steps: (a) extracting DNA from the isolated sample; ( b) using the DNA of step (a) as a template, using a first primer pair to amplify a first SLC12A3 gene fragment, wherein the first primer pair includes a first forward primer and a first reverse primer; c) determining whether the amplified first SLC12A3 gene fragment contains a first mutation of c.2881-2delAG; and (d) assessing whether the individual has Gitman syndrome or has Risk of suffering from Gitman syndrome, wherein if the amplified first SLC12A3 gene fragment contains the first mutation, the individual is at risk of developing Gitman syndrome or is at risk of developing Gitman syndrome.

According to a specific embodiment of the present disclosure, the first forward primer and the first reverse primer have nucleotide sequences of sequence numbers: 1 and 2, respectively.

According to a preferred embodiment of the present disclosure, step (c) is to use a first wild-type probe and a first mutant probe to determine whether the amplified first SLC12A3 gene fragment contains the first mutation. The first wild-type probe and the first mutant-type probe have nucleotide sequences of sequence numbers: 35 and 36, respectively.

According to some embodiments of the present disclosure, in step (b), it may further include using a second primer pair to amplify a second SLC12A3 gene fragment, so as to determine the amplified second in step (c). Does the SLC12A3 gene fragment contain a member selected from T60M, c.1670-191 C → T, S710X, T163M, c.2548 + 253 C → T, R871H, IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, W844X, R83Q, H90Y, R642H , R642C, T649M, N442K, N640S, and D486N. The second primer pair includes a second forward primer and a second reverse primer.

According to a specific embodiment of the present disclosure, when the second mutation is T60M, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 3 and 4, respectively; when the second mutation When c.1670-191 C → T, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 5 and 6, respectively; when the second mutation is S710X, the The second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 7 and 8, respectively; when the second mutation is T163M, the second forward primer and the second reverse primer are respectively Nucleotide sequences with sequence numbers: 9 and 10; when the second mutation is c.2548 + 253 C → T, the second forward primer and the second reverse primer have sequence numbers: 11 and Nucleotide sequence of 12; when the second mutation is R871H, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 13 and 14, respectively; when the second mutation is When IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, the second forward primer and the second reverse primer have sequence Column number: nucleotide sequences of 15 and 16; when the second mutation is W844X, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 17 and 18, respectively; when When the second mutation is R83Q, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 19 and 20, respectively; when the second mutation is H90Y, the second positive primer The forward primer and the second reverse primer each have a nucleotide sequence of sequence numbers: 21 and 22; when the second mutation is R642H, the second forward primer and the second reverse primer each have a sequence number : The nucleotide sequences of 23 and 24; when the second mutation is R642C, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 25 and 26, respectively; when the When the second mutation is T649M, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 27 and 28 respectively; when the second mutation is N442K, the second forward primer And the second reverse primer has nucleotide sequences of sequence numbers: 29 and 30, respectively; When it is N640S, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 31 and 32 respectively; or when the second mutation is D486N, the second forward primer And the second reverse primer has a nucleotide sequence of sequence numbers: 33 and 34, respectively.

According to a preferred embodiment of the present disclosure, step (c) is to use a second wild-type probe and a second mutant probe to determine whether the amplified second SLC12A3 gene fragment contains the second mutation.

In the preferred embodiments, when the second mutation is T60M, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 37 and 38, respectively; when the When the second mutation is c.1670-191 C → T, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 39 and 40, respectively; when the second mutation is In S710X, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence numbers: 41 and 42; when the second mutation is T163M, the second wild-type probe And the second mutant probe has nucleotide sequences of sequence numbers: 43 and 44 respectively; when the second mutation is c. 2548 + 253 C → T, the second wild-type probe and the second The mutant probes have nucleotide sequences of sequence numbers: 45 and 46; when the second mutation is R871H, the second wild-type probe and the second mutant probe have sequence numbers: 47 and Nucleotide sequence of 48; when the second mutation is IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, the second wild-type probe The second mutant probe has a nucleotide sequence of sequence numbers: 49 and 50; when the second mutation is W844X, the second wild-type probe and the second mutant probe each have a sequence number : The nucleotide sequences of 51 and 52; when the second mutation is R83Q, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence numbers: 53 and 54; when When the second mutation is H90Y, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 55 and 56, respectively; when the second mutation is R642H, the first mutation The two wild-type probes and the second mutant-type probe have nucleotide sequences of sequence numbers: 57 and 58, respectively; when the second mutation is R642C, the second wild-type probe and the second mutant-type probe The probe has a nucleotide sequence of sequence numbers: 59 and 60 respectively; when the second mutation is T649M, the second wild-type probe and the second mutant probe have sequence numbers of 61 and 62, respectively Nucleotide sequence; when the second mutation is N442K, the second wild-type probe and the second mutation Type probes have nucleotide sequences of sequence numbers: 63 and 64; when the second mutation is N640S, the second wild-type probe and the second mutant probe have sequence numbers: 65 and 66, respectively Nucleotide sequence; when the second mutation is D486N, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 67 and 68, respectively.

According to the embodiment of the present disclosure, the isolated sample of the present invention may be composed of free blood, plasma, interstitial fluid, saliva, tear fluid, intraocular fluid, urine, lymph fluid, spinal fluid, cervical fluid, vaginal fluid, and cell tissue Group.

Another aspect of the present invention relates to a detection kit for Gitman syndrome. The set includes at least one pair of primers that can be used to amplify the SLC12A3 gene fragment to obtain an SLC12A3 gene fragment containing at least one mutation, thereby improving the detection accuracy and detection efficiency of Gitman syndrome.

According to an embodiment of the present disclosure, the set includes a first primer pair for amplifying a first SLC12A3 gene fragment, which includes a first forward primer having a nucleotide sequence having a sequence number: 1, and A first reverse primer with a nucleotide sequence of sequence number: 2.

According to an embodiment of the present disclosure, the set further includes a first wild-type probe having a nucleotide sequence having a sequence number: 35, and a first mutant type having a nucleotide sequence having a sequence number: 36. Probe.

According to some embodiments of the present disclosure, the set further includes a second primer pair for amplifying a second SLC12A3 gene fragment, which includes: a second positive sequence having a nucleotide sequence of sequence number: 3 A forward primer, and a second reverse primer having a nucleotide sequence of sequence number: 4; a second forward primer having a nucleotide sequence of sequence number: 5; and a nucleoside having sequence number: 6 A second reverse primer with an acid sequence; a second forward primer with a nucleotide sequence of sequence number: 7 and a second reverse primer with a nucleotide sequence of sequence number: 8; a sequence number : A second forward primer with a nucleotide sequence of 9 and a second reverse primer with a nucleotide sequence of sequence number: 10; a second forward primer with a nucleotide sequence of sequence number: 11 , And a second reverse primer with a nucleotide sequence of sequence number: 12; a second forward primer with a nucleotide sequence of sequence number: 13; and a nucleotide sequence with sequence number: 14 The second reverse primer; A second forward primer with a nucleotide sequence of sequence number 15 and a second reverse primer with a nucleotide sequence of sequence number 16; a second positive primer with a nucleotide sequence of sequence number 17 A forward primer, and a second reverse primer with a nucleotide sequence of sequence number: 18; a second forward primer with a nucleotide sequence of sequence number: 19; and a nucleoside with sequence number: 20 A second reverse primer with an acid sequence; a second forward primer with a nucleotide sequence of sequence number: 21; and a second reverse primer with a nucleotide sequence of sequence number: 22; a sequence number : A second forward primer with a nucleotide sequence of 23 and a second reverse primer with a nucleotide sequence of sequence number: 24; a second forward primer with a nucleotide sequence of sequence number: 25 , And a second reverse primer with a nucleotide sequence of sequence number: 26; a second forward primer with a nucleotide sequence of sequence number: 27; and a nucleotide sequence with sequence number: 28 Second reverse primer A second forward primer with a nucleotide sequence of sequence number 29 and a second reverse primer with a nucleotide sequence of sequence number 30; a second positive primer with a nucleotide sequence of sequence number 31 A forward primer, and a second reverse primer with a nucleotide sequence of sequence number: 32; or a second forward primer with a nucleotide sequence of sequence number: 33, and a second primer with sequence number: 34 The second reverse primer of the nucleotide sequence.

In a preferred embodiment of the present disclosure, the set may further include a second wild-type probe and a second mutant-type probe, wherein when the second primer pair includes the nucleoside having the sequence number: 3 For the second forward primer of the acid sequence and the second reverse primer of the nucleotide sequence having the sequence number: 4, the second wild-type probe and the second mutant-type probe each have a sequence number: 37 And the nucleotide sequence of 38; when the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 5 and the second reverse primer having the nucleotide sequence of sequence number: 6 When the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence number: 39 and 40; when the second primer pair includes the nucleotide sequence of sequence number: 7 When the second forward primer and the second reverse primer having the nucleotide sequence of sequence number: 8 are present, the second wild-type probe and the second mutant probe have sequence numbers: 41 and 42 respectively Nucleotide sequence; when the second primer pair contains the sequence number: When the second forward primer of the nucleotide sequence of 9 and the second reverse primer of the nucleotide sequence having the sequence number: 10, the second wild-type probe and the second mutant-type probe have SEQ ID NOS: 43 and 44 nucleotide sequences; when the second primer pair includes the second forward primer with the nucleotide sequence having the sequence number: 11 and the first nucleotide having the nucleotide sequence with the sequence number: 12 In the case of two reverse primers, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence numbers: 45 and 46; when the second primer pair includes the sequence number: 13 When the second forward primer of the nucleotide sequence and the second reverse primer of the nucleotide sequence having the sequence number: 14 are obtained, the second wild-type probe and the second mutant-type probe each have a sequence number : The nucleotide sequences of 47 and 48; when the second primer pair includes the second forward primer having the nucleotide sequence having the sequence number: 15 and the second reverse primer having the nucleotide sequence having the sequence number: 16 When the primer is directed, the second wild-type probe and the second mutant-type probe are separated. A nucleotide sequence having a sequence number: 49 and 50; when the second primer pair includes the second forward primer having a nucleotide sequence having a sequence number: 17 and the nucleotide sequence having a nucleotide sequence having a sequence number: 18 When the second reverse primer is used, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence numbers: 51 and 52; when the second primer pair includes the sequence number: 19 When the second forward primer of the nucleotide sequence and the second reverse primer of the nucleotide sequence having the sequence number: 20, the second wild-type probe and the second mutant-type probe each have a sequence No .: 53 and 54 nucleotide sequences; when the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 21 and the second forward primer having the nucleotide sequence of sequence number: 22 In the case of a reverse primer, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence number: 55 and 56; when the second primer pair includes the core with sequence number: 23 Second forward primer of the nucleotide sequence and has the sequence number: 2 When the second reverse primer of the nucleotide sequence of 4, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 57 and 58, respectively; when the second primer pair When the second forward primer with the nucleotide sequence of sequence number: 25 and the second reverse primer with the nucleotide sequence of sequence number: 26 are included, the second wild-type probe and the second The mutant probe has a nucleotide sequence of sequence number: 59 and 60 respectively; when the second primer pair includes the second forward primer of the nucleotide sequence of sequence number: 27 and the second forward primer of sequence number: 28 When the second reverse primer of the nucleotide sequence, the second wild-type probe and the second mutant-type probe respectively have a nucleotide sequence of sequence numbers: 61 and 62; when the second primer pair contains the When the second forward primer having the nucleotide sequence of sequence number: 29 and the second reverse primer having the nucleotide sequence of sequence number: 30, the second wild-type probe and the second mutant type The probes each have a nucleotide sequence of sequence numbers: 63 and 64; when the second primer When the second forward primer comprising the nucleotide sequence having the sequence number: 31 and the second reverse primer having the nucleotide sequence of the sequence number: 32, the second wild-type probe and the first The two mutant probes each have a nucleotide sequence of sequence numbers: 65 and 66; or when the second primer pair includes the second forward primer of the nucleotide sequence of sequence number: 33 and the sequence number of When the second reverse primer of the nucleotide sequence of: 34, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 67 and 68, respectively.

Non-essentially, the first wild-type probe, the first mutant-type probe, the second wild-type probe, and the second mutant-type probe may be associated with a first, a second, and a third, respectively. And a fourth detection mark is connected, and the first, the second, the third and the fourth detection marks can emit light wavelengths different from each other.

After referring to the following embodiments, those with ordinary knowledge in the technical field to which the present invention pertains can easily understand the basic spirit and other inventive objectives of the present invention, as well as the technical means and implementation aspects adopted by the present invention.

In order to make the description of this disclosure more detailed and complete, the following provides an illustrative description of the implementation mode and specific embodiments of the present invention; but this is not the only form of implementing or using the specific embodiments of the present invention. The embodiments include the features of a plurality of specific embodiments, as well as the method steps and their order for constructing and operating these specific embodiments. However, other specific embodiments can also be used to achieve the same or equal functions and sequence of steps.

Definition

Unless otherwise defined in this specification, the meanings of scientific and technical terms used herein are the same as those understood and used by those having ordinary knowledge in the technical field to which the present invention pertains.

Without conflict with the context, the singular noun used in this specification covers the plural form of the noun; and the plural noun used also covers the singular form of the noun. In addition, in this specification and the scope of patent application, the expressions "at least one" and "one or more" have the same meaning, and both represent one, two, three, or more. What is more, in the scope of this specification and the patent application, "at least one of A, B, and C", "at least one of A, B, or C", and "at least one of A, B, and / or C" "Means covering only A, B, C, A, and B, B and C, and C, and A, B, and C.

Although the terms "first", "second," and "third" are used herein to describe various elements, parts, regions, and / or sections, these elements (and parts, regions, and / or sections) are not subject to the above Restrictions on modifiers. Furthermore, the use of these ordinal numbers does not imply a sequence or order, unless the context clearly indicates otherwise. Instead, these words are only used to distinguish the components. Therefore, the first element described below may also be named the second element without departing from what is disclosed in the exemplary embodiment.

Although the numerical ranges and parameters used to define the broader scope of the present invention are approximate values, the relevant values in the specific embodiments have been presented here as accurately as possible. However, any numerical value inherently contains standard deviations due to individual test methods. Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range. Alternatively, the word "about" means that the actual value falls within the acceptable standard error of the average value, depending on the consideration of those with ordinary knowledge in the technical field to which the present invention belongs. In addition to the experimental examples, or unless explicitly stated otherwise, all ranges, quantities, values, and percentages used herein can be understood (for example, to describe the amount of materials used, length of time, temperature, operating conditions, quantity ratios, and other similar Or) are modified by "about". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the scope of the accompanying patent application are approximate values and may be changed as required. At a minimum, these numerical parameters should be understood as the number of significant digits indicated and the value obtained by applying the general round method. Here, the numerical range is expressed from one endpoint to another segment or between two endpoints; unless otherwise stated, the numerical ranges described herein include the endpoints.

In some embodiments, the scope of the present invention also covers any sequence having at least 90% sequence similarity to any of the described sequences. The sequence similarity is preferably at least 93% or 95%, more preferably at least 98%.

The term “gene” as used herein refers to a functional nucleotide sequence (including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)) that contains specific genetic information, which It contains not only DNA regions that can encode gene products (RNA and proteins), but also regions for regulation. For example, regulatory regions include promoters, terminators, and translation regulatory sequences (eg, ribosome binding site and internal ribosome entry site (IRES)) , Enhancer, silencer, insulator, boundary element, origins of replication, matrix binding sites, and locus control region , LCR) and so on. The term "gene" may also include splicing from mRNA transcripts, as well as all introns and other DNA sequences from alternative splicing sites, as well as various variants thereof. As used herein, the term "gene" or "gene fragment" may include any part or all of a gene, in particular any part of each of the aforementioned DNA regions.

The term "mutations" refers to any molecular or tissue-level change in the gene sequence and the amino acid sequence encoded by the gene sequence. At the molecular level, mutations can be changes in the base pair composition or arrangement of a gene. These changes include point mutations, silent mutations, missense mutations, Nonsense mutation, deletion mutation, frameshift mutation, insertion mutation, splicing-site mutation, etc. In the present specification, "mutation" includes homozygous mutations, heterozygous mutations, uniallelic or monoallelic mutations, and dualelic mutations. As used herein, the term "mutant type" refers to genes and / or proteins of all the aforementioned mutant species, as well as organisms or biological specimens having the mutant genes and / or proteins.

As used herein, the term "wild type" is a relative term meaning an organism or a biological specimen of a gene and / or protein without the aforementioned mutation compared to the aforementioned mutant type. At the same time, the term "wild type" can also refer to organisms or biological specimens that have a genome make-up as seen in the wild, and can be applied to cell lines and specific individual genes. Therefore, the term "wild type" excludes genes that have been artificially altered in genetic sequence by a recombinant method, or organisms and biological specimens containing the aforementioned alterations.

In this disclosure, "polynucleotide", "nucleotide sequence" or "nucleic acid sequence" refers to single- or double-stranded polymers of RNA, DNA, or a combination thereof. The interpretation direction is From 5 'to 3' end. In the present disclosure, a "polynucleotide" may include one or more modified nucleotide residues and may serve as a primer or probe.

The term "primer" as used herein refers to an oligonucleotide that can hybridize to a target nucleic acid sequence (for example, the DNA template to be amplified) and can be used as a polymerase The starting point of the reaction to start the amplification. A "primer" may include modified oligonucleotides, such as those modified with biotinylation, phosphorylation, or addition of locked nucleic acids (LNA). "Introduction" can be single or double. As used herein, a "primer pair" refers to a group or pair of primers that contains a "forward primer" (hybrid primer) that is complementary and hybrid to the upstream sequence of the 5 'end of the sequence to be amplified. ) And a "reverse primer" complementary to and hybridized with the downstream sequence of the 3 'end of the sequence to be amplified. Those with ordinary knowledge in the field to which the present invention pertains should understand that the use of the "forward primer" and "reverse primer" herein is not intended to limit the primer, but merely to provide exemplary directions.

In the present specification, the term "specific primer" refers to a primer capable of specifically or specifically binding or hybridizing to a sequence to be amplified. In certain embodiments of the present disclosure, the specific primers have a polynucleotide sequence of about 10-35 nucleotides in length, preferably a polynucleotide sequence of 17-27 nucleotides.

The term "probe" as used herein refers to a single-stranded polynucleotide that can hybridize with a complementary single-stranded target sequence to form a double-stranded molecule (hybrid). In certain embodiments of the present disclosure, a "probe" may hybridize to a complementary single-stranded amplified gene fragment. In the present specification, the "specific probe" refers to a probe that can specifically or specifically complement or hybridize to a single-stranded sequence. In certain embodiments of the present disclosure, the specific probes are about 10-25 nucleotides in length, preferably 12-20 nucleotides in length. .

In the present disclosure, the term "hybridize" refers to any reaction involving a strand of nucleic acid bound to a complementary strand by base pairing. In general, heterozygosity and heterozygous strength (ie, the strength of binding between nucleic acids) are affected by the following factors: the degree of complementarity between nucleic acids, reaction conditions, the Tm value of forming a hybrid, and the G: C ratio in the nucleic acid. "Specific hybridization" or "specific hybridization specifically" refers to a binding reaction between two nucleic acid molecules whose nucleotide sequences have highly accurate complementarity with each other. The highly accurate complementarity may be about 90% or more, preferably about 95% or more, and more preferably about 99% or more.

The term "template" as used herein refers to any type of nucleic acid molecule to be amplified, preferably a DNA sequence to be amplified, and may also be referred to as a DNA template. The "nucleic acid template" or "DNA template" of the present disclosure includes at least a partial or complete single-stranded nucleic acid sequence or single-stranded DNA sequence. In a hybridization reaction performed on a nucleic acid template, the resulting complex may include single-stranded molecules and double-stranded molecules.

The term "label" as used herein may include any suitable entity capable of emitting a signal. In this case, the signal can be any physical, chemical, or biological signal. In this disclosure, the preferred signal is an electromagnetic wave. When excited by the excited state of electromagnetic waves (especially light), a photoluminescent mark that can emit photoluminescence is a better detection mark. Specifically, the fluorescent label and the photoluminescent label may include a fluorescent dye, a metal, and a semiconductor nanoparticle. According to some embodiments of the present disclosure, a preferred fluorescent label may include a fluorescent dye.

In addition, the number of labeled heterozygotes is not subject to any particular limitation and may be appropriately determined according to the intended purpose. The number of marks is at least one, and may be two, three, or more. Likewise, the position of the marker is not subject to any particular limitation, and the possible marker positions include its ends. When the hybrid is a polynucleotide or an oligonucleotide, the position of the detection label may be, for example, the 5 'end and / or the 3' end, but the possibility of other positions is not excluded. In certain embodiments of the present disclosure, the detection label may be attached to the hybrid in a covalently or non-covalently binding manner. In one embodiment of the present disclosure, the detection label can be linked to the oligonucleotide through a polymerase.

The term "prognosis" is used herein to indicate that it is committed to obtaining an assessment that is helpful, compared to an average or comparative individual (a healthy individual or an individual with similar symptoms). Information on whether there is or is likely to be a specific disease or condition now or in the future, to find out the development of the disease or possible development in the future, or to evaluate the patient's feedback on a specific course of treatment, for example Administer appropriate drugs (for example, drugs that delay or prevent the onset of disease in individuals at risk of developing Gitman syndrome before the onset of the disease; or continue to be administered after the symptoms of the Gitman syndrome have eased Drugs that delay or prevent the recurrence of Gitman syndrome). Therefore, in the embodiments of the present disclosure, "prejudging" includes not only a generally known diagnosis, but also monitoring the process of a disease or condition and / or predicting the risk of disease.

"Condition", "disease" and "disorder" are interchangeable words in this disclosure.

"Subject" and "patient" are used interchangeably in this article. The term "subject" broadly refers to a human individual (ie, a male or female of any age, such as a pediatric individual of an infant, toddler, or adolescent, or an adult individual of young, middle, or old age). "Patient" refers broadly to a human individual in need of treatment for a disease. According to the present disclosure, "individual" or "patient" refers to a human individual suffering from Gitman syndrome, suspected of having Gitman syndrome, and at risk of having Gitman syndrome. According to a preferred embodiment of the present invention, the individual may be a patient with the same clinical manifestations as the Gitman syndrome, a relative of the patient, or a healthy individual without any symptoms.

The term "sample" as used herein refers to a test subject isolated from the aforementioned "individual" or "patient" and processed or cultured in vitro. "Ex vivo samples" may include isolated body fluids, lymph node samples or tissue samples, especially biological samples that may contain individual gene fragments. According to an embodiment of the present disclosure, the isolated sample may include blood, plasma, blood cells, interstitial fluid, saliva, tears, intraocular fluid, urine, lymph fluid, spinal fluid, cervical fluid, vaginal fluid, spinal fluid sample, and cell tissue (Eg, muscle tissue section or kidney tissue section).

A "kit" as used herein may contain at least one primer pair of the present invention and a container (e.g., a microcentrifuge tube, vial, ampoule, bottle, syringe, and / or dispenser package, or other suitable container) ). In some embodiments of the present disclosure, the kit of the present invention refers to various combinations of materials, reagents, and operating instructions necessary for the embodiments.

2. Prediction of Gitman syndrome

Gitman syndrome is caused by mutations in the SLC12A3 gene. Mutations in more than 400 SLC12A3 genes are currently known worldwide, and these mutant genotypes are highly genetically heterogeneous in different human populations. The inventors conducted research on patients with Gitman syndrome in the Chinese ethnic group, and found that in the Chinese ethnic group, there are more than 50 mutant genotypes with a high genotype frequency, which also includes ethnic-specific mutations ( That is, the mutant exists only in the Chinese ethnic group).

On the other hand, the inventors also found that most patients with Gitman syndrome carry two different mutations of two different alleles simultaneously, and present heterozygous genotypes. In addition, a significant number (approximately 10% -15%) of patients even carry genetic information for three SLC12A3 gene mutations; less than 10% of patients carry only one atypical mutation. It can be seen that the complex mutational expression pattern of the SLC12A3 gene in ethnic groups makes clinical detection of Gitman syndrome difficult, resulting in increased time and money for diagnosis. Therefore, it is necessary to develop detection technology with more detection efficiency and accuracy to solve the aforementioned problems. The invention provides at least one specific primer pair capable of amplifying a SLC12A3 gene fragment to obtain an SLC12A3 gene fragment containing at least one mutation, thereby improving the detection accuracy and detection efficiency of Gitman syndrome. Detection method proposed in the present invention also provides a reliable detection method, specific amplification of SLC12A3 gene fragments to be screened out SLC12A3 gene fragment comprising at least one mutation, thereby quickly and accurately obtain detection and prognostic Jite Man Syndrome result.

In view of the above object, a first aspect of the present invention provides a method for detecting Gitman syndrome. The method mainly uses an in vitro sample of a body to predict whether the individual is suffering from Gitman syndrome or is at risk of having Gitman syndrome. The method of the present invention comprises the following steps: (a) extracting the DNA of the ex vivo sample; (b) using the DNA of step (a) as a template, using a first primer pair to amplify a first SLC12A3 gene fragment, wherein the first A primer pair includes a first forward primer and a first reverse primer; (c) determines whether the amplified first SLC12A3 gene fragment contains a first mutation of c.2881-2delAG; and (d) Evaluate whether the individual has or is at risk of having Gitman syndrome based on the results of step (c), and if the amplified first SLC12A3 gene fragment contains the first mutation, the individual is suffering from Gitman syndrome Gatman syndrome may be at risk for Gitman syndrome. Wherein, when the first mutation is c.2881-2delAG, the first forward primer and the first reverse primer have nucleotide sequences of sequence numbers: 1 and 2, respectively.

In carrying out the method of the present invention, the DNA of an ex vivo sample must first be obtained from a body (step (a)). According to some specific embodiments, an ex vivo sample is obtained from a patient suffering from or suspected of having Gitman syndrome, such as a whole blood sample or a blood cell sample of peripheral blood, preferably white blood cells. According to other specific embodiments, an ex vivo sample is obtained from a healthy human individual. The individual's genomic DNA can then be extracted from the obtained ex vivo sample (eg, white blood cells) using any method well known to those skilled in the art. The method of extracting DNA may include firstly lysing the cell membrane by physical action, chemical action or temperature difference; and then adding an organic solvent to purify the nucleic acid in the cell. The aforementioned physical action examples include, but are not limited to, ultrasonic vibration or grinding. Chemical action involves the use of a cell lysis buffer to lyse the cell membrane. Generally speaking, the cell lysis buffer may contain an acid (e.g., HCl, Ethylenediaminetetraacetic acid (EDTA)), a surfactant (e.g., sodium dodecyl sulfate (SDS)), a salt Components (such as NaCl) and proteases are used to lyse cell membranes. The aforementioned temperature difference method includes repeatedly freezing and thawing the cells under a temperature difference environment of 20 ° C, thereby rupturing the cell membrane. Next, ethanol or isopropanol can be added to purify the nucleic acids released from the cells. On the other hand, the same DNA extraction can be achieved by commercial kits. Commercial genomic DNA extraction kits suitable for the present invention include, but are not limited to: DNeasy blood and tissue kit (supplier: Qiagen), Puregene blood kit (supplier: Qiagen), DNAzol ™ reagent (supplier: Thermo Fisher), PureLink ™ Genomic DNA Mini Kit (Supplier: Thermo Fisher), PureLink ™ Top 96 Genomic DNA Purification Kit (Supplier: Thermo Fisher), and InstaGene ™ Matrix (Supplier: Bio-Rad). According to one embodiment of the present disclosure, the white blood cell genome DNA is extracted using a Puregene blood kit (supplier: Qiagen).

Next, in step (b), the DNA extracted in step (a) is used as an amplification template, and at least one gene fragment is amplified with at least one primer pair. In some embodiments of the present disclosure, step (b) is using a first primer pair to amplify the first SLC12A3 gene fragment, wherein the first primer pair includes a first forward primer and a first reverse primer. In this step, amplification refers to the process of selectively increasing the number of copies of a specific protein-encoding gene, while other genes are not increasing proportionally. The amplification of the present disclosure is to replicate and amplify the SLC12A3 gene or SLC12A3 gene fragment. The first primer pair is complementary hybridized with DNA as a template to serve as a starting point for nucleotide extension of DNA polymerase. According to the embodiments of the present disclosure, the amplification reaction can be performed according to any method well known to those having ordinary knowledge in the art, such as a polymerase chain reaction (PCR). According to an embodiment of the present embodiment, the first SLC12A3 gene fragment is amplified by PCR.

In step (c), it is determined whether at least one SLC12A3 gene fragment amplified in step (b) contains at least one mutation. For example, the mutation of c.2881-2delAG includes a method such as gel electrophoresis, The sequence of the gene is analyzed by DNA hybridization or other methods to analyze the amplified nucleotide product in step (b) to confirm whether the amplified SLC12A3 gene fragment contains specific mutation type information. For example, the gene fragment product amplified by PCR can be isolated, and sequence analysis such as sequencing and nucleotide length determination can be used to confirm whether the DNA template obtained from the isolated sample contains the mutant gene fragment.

Next, in step (d), according to the result of step (c), it is evaluated whether the individual has the Gitman syndrome or is at risk of having the Gitman syndrome. Specifically, if the amplified first SLC12A3 gene fragment contains at least one mutation, the individual may suffer from Gitman syndrome, or be at risk of developing Gitman syndrome.

According to some optional implementations of the present disclosure, in step (c), a probe may also be used to perform a DNA hybridization reaction to determine whether the amplified first SLC12A3 gene fragment contains a first mutation. In one embodiment of the present disclosure, the probe includes a first wild-type probe and a first mutant-type probe. The probe may be hybridized with the target first SLC12A3 gene fragment to form a hybrid. In this embodiment, the first wild-type probe is a probe that can complementaryly bind to the first SLC12A3 gene fragment without the first mutation (ie, wild-type); the first mutant-type probe is capable of binding The first mutated probe of the first SLC12A3 gene fragment is complementary to each other. Through the design of wild-type probes and mutant probes, it is possible to obtain information on whether the amplified SLC12A3 gene fragment contains a specific mutant type. In other words, when the mutant probe specifically hybridizes with one of the amplified SLC12A3 gene fragments, it means that the SLC12A3 gene fragment should contain a corresponding mutation. Therefore, when the first mutant probe forms a hybrid with the first SLC12A3 gene fragment, it means that the first SLC12A3 gene fragment should contain the corresponding first mutation. In this way, based on the heterozygous results, in the subsequent step (d), it can be evaluated whether the individual has the Gitman syndrome or is at risk for the Gitman syndrome.

According to another optional implementation of the present disclosure, in step (b), the method further includes using a second primer pair to amplify the second SLC12A3 gene fragment, thereby determining the amplified second in step (c). Whether the SLC12A3 gene fragment contains a second mutation, wherein the second primer pair includes a second forward primer and a second reverse primer. Similarly, the second primer pair is complementary hybridized with the DNA as a template to serve as a starting point for nucleotide extension of the DNA polymerase to perform DNA replication amplification on the SLC12A3 gene or a gene fragment thereof.

According to another optional implementation of the present disclosure, step (c) may further include using a second wild-type probe and a second mutant probe to determine whether the amplified second SLC12A3 gene fragment contains The second mutation. Similarly, the second wild-type probe is a probe that can complement the second SLC12A3 gene fragment without the second mutation (ie, wild-type); the second mutant-type probe is capable of Two SLC12A3 gene fragments complementarily bind to the probe. Through the specific design of the second wild-type probe, the second mutant-type probe and the second SLC12A3 gene fragment, information on whether the amplified SLC12A3 gene fragment contains a specific mutation type can be obtained. In summary, when the second mutant probe is specifically heterozygous with the amplified second SLC12A3 gene fragment, it means that the second SLC12A3 gene fragment should contain a corresponding second mutation. In this way, according to the heterozygous result, in the subsequent step (d), whether the individual has the Gitman syndrome or is at risk of having the Gitman syndrome.

According to the foregoing description, the types of probes suitable for the present invention may include, but are not limited to, TaqMan® probes, Molecular Beacon probes, LNA® probes, and Scorpion® probes. Those skilled in the art can select a suitable probe type according to actual needs. In a preferred embodiment, the probe is a TaqMan® probe.

According to one embodiment of the present disclosure, in step (c), in order to facilitate the determination of the hybridization situation between the probe and the amplified SLC12A3 gene fragment, the probe may be further connected to at least one detection label. The signal provided by the detection label is used to know whether a hybrid is successfully formed between the probe and the amplified SLC12A3 gene fragment. Specifically, in one embodiment, the first wild-type probe, the first mutant-type probe, the second wild-type probe, and the second mutant-type probe may be separately associated with the first detection marker and the second detection Mark, third detection mark and fourth detection mark are connected. At the same time, the signals sent by the first detection mark, the second detection mark, the third detection mark, and the fourth detection mark may be different from each other, so as to distinguish different hybrids. In one embodiment, the detection mark may be a fluorescent mark, and the signal may be a light signal. In yet another embodiment, the first, second, third and fourth detection marks can emit light with different wavelengths, respectively. Preferably, the wavelengths of these lights may be between 550 nm and 560 nm, between 575 nm and 585 nm, between 610 nm and 620 nm, and between 650 nm and 660 nm. In one embodiment, the detection marks can emit light wavelengths of 517 nm, 551 nm, 580 nm, and 617 nm, respectively. At the same time, the light wavelengths listed here are only exemplary and non-limiting, and the color of the optical signal is not limited to this. Detection markers suitable for use in the method of the present invention include, but are not limited to: VIC ^™ , FAM ^™ , JUN ^™ , ABY ^™ , HEX ^™ , NED ^™ , TAMRA ^™ , SYBR® Green, Texas Red®, and the like. Preferably, the detection marks are VIC ^™ , FAM ^™ , JUN ^™, and ABY ^™ .

According to the signal provided by the detection marker, it can be ascertained whether the first mutant probe and the amplified first SLC12A3 gene fragment, and the second mutant probe and the amplified second SLC12A3 gene fragment each exhibit specific heterogeneity. Together. When the first mutant probe and / or the second mutant probe are specifically hybridized with the amplified first SLC12A3 gene fragment and / or the second SLC12A3 gene fragment, respectively, it means that the first SLC12A3 gene fragment And / or the second SLC12A3 gene fragment should contain a corresponding first mutation and / or a second mutation. Conversely, if the first wild-type probe and the amplified first SLC12A3 gene fragment and / or the second wild-type probe and the amplified second SLC12A3 gene fragment exhibit a specific heterozygous reaction, it indicates that the The first SLC12A3 gene fragment and / or the second SLC12A3 gene fragment do not contain a corresponding first mutation and / or a second mutation. In this way, in the subsequent step (d), the signal provided by the detection marker can be used to evaluate whether the individual is suffering from Gittmann syndrome or is at risk of suffering from Gittmann syndrome.

3. Specific primer pairs and probes for mutations in the SLC12A3 gene

According to some embodiments of the present disclosure, the mutation included in the SLC12A3 gene fragment may include, but is not limited to: A13P, D26G, T60M, R83Q, H90Y, R145C, T163M, P213S, L215P, H234Q, L245P, IVS6-1G> A, c.835-836ins15bp, S283Y, T304M, IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, R334W, G403E, N426K, N442K, N426Y, c.1421delT, D486N, A514V, S614L, N640S, IVS15 + 2 T> G, R642H , R642C, T649M, IVS16-1 G> A, L671R, S710X, c.2069delA, W844X, L858H, R871H, G876S, IVS22 + 1 G> A, L892P, R896X, c.2881-2delAG, P947S, R974W, R977X , R1011K, c.1670-191C → T and c.2548 + 253C → T.

The SLC12A3 gene of the present invention is a protein-coding gene, which is located on the human chromosome 16 with a genome sequence of NC_000016.10 (56865207..56915850) and a Gene ID of 6559 (for details, see GeneBank, https: // www .ncbi.nlm.nih.gov / gene / 6559, updated: January 27, 2018). The aforementioned mutation contained in the SLC12A3 gene fragment of the present invention may be a point mutation, a mis-sense mutation, a meaningless mutation, a deletion mutation, a frame shift mutation, an insertion mutation, a splice mutation, and the like. Specifically, a missense mutation refers to a change in a base pair that causes a codon encoding a particular amino acid to become a codon encoding another amino acid, thereby changing the overall protein configuration. For example, those skilled in the art with ordinary knowledge can understand that the mutations A13P, D26G, and T60M included in the SLC12A3 gene fragment of the present invention are all missense mutations, where A13P represents the 13th residue of the amino acid sequence Alanine (abbreviated A) is mutated to Proline (abbreviated P); similarly, the mutation D26G represents the aspartic acid at the 26th residue of the amino acid sequence. , Abbreviation D) is mutated to glycine (Glycine, abbreviated G); and the mutation T60M represents the tyrosine (Tyrosine, abbreviated T) at the 60th residue of the amino acid sequence is mutated to methionine Abbreviation M). Those with ordinary knowledge in the technical field may similarly understand the misidentified mutation sites of the SLC12A3 gene fragment of the present invention, and therefore will not repeat them one by one. On the other hand, those skilled in the art can understand that insertion mutation refers to the insertion of a nucleotide sequence of varying length in the original normal nucleotide sequence. For example, the SLC12A3 gene fragment of the present invention may contain The mutation c.835-836ins15bp is an insertion mutation of 15 base pairs (sequence: TTGGCGTGGTCTCGG) from the 835th codon to the 836th codon. In addition, the SLC12A3 gene fragment of the present invention contains IVS6-1G> A, IVS15 + 2 T> G, IVS16-1 G> A, IVS22 + 1 G> A, c.1670-191C → T and c.2548 + 253C → A point mutation such as T, which is exemplified here. The mutation IVS6-1G> A is a nucleotide at the position (-1) 1 base pair before the 6th intron, which is mutated from the original guanine to adenine. ; Mutation IVS15 + 2 T> G is the nucleotide in the 15th intron and the last 2 base pairs (+2) position, and the original thymine (Thymine, abbreviated as T) is mutated into guanine . Therefore, those skilled in the art with ordinary knowledge can reason by analogy that these mutations are all point mutations that occur at specific base pair positions of introns, so they will not be described in detail. On the other hand, the mutation c.1670-191C → T refers to a mutation in which Cytosine (abbreviation C) becomes thymine at the position of the 191th base pair (-191) before the 1670th codon. By deletion mutation, it is meant that a base pair sequence is missing from the DNA. Taking the mutations c.1421delT, c.2069delA, and c.2881-2delAG as examples, those with ordinary knowledge in the art can understand this record. The mutation c.1421delT refers to the loss of a thymus at the 1421th codon Pyrimidine; mutation c.2069delA refers to the loss of an adenine at the 2069th codon; but c.2881-2delAG refers to the 2881th codon, the deletion of adenine and guanine two base pairs. In addition, in the case of IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, it means that the mutation is a nucleotide at a position (-1) before the 7th intron, which was originally guanine (Guanine) Adenine (Adenine, A for short) point mutation, plus a CGGACATTTTT nucleotide sequence deleted at the 971th nucleotide, and an ACCGAAAATTTT insertion sequence. Therefore, the method of naming and recording the aforementioned mutations can be known by those with ordinary knowledge in the art by logical analogy, so they will not be described in detail.

Please refer to Table 1 for the mutations contained in the SLC12A3 gene fragment of the present invention and the corresponding primer pair and probe sequences. Table 1: Mutations contained in the SLC12A3 gene fragment of the present invention and the nucleotide sequences of the corresponding primer pairs and probes mutation Nucleotide sequence Serial number Nucleotide sequence Serial number Nucleotide sequence Serial number Nucleotide sequence Serial number Forward primer Reverse primer Wild-type probe Mutant probe c.2881-2delAG GACTGCCCCTGGAAGATCTCA 1 TGTCCCTGACCCAGTGATGT 2 AAGAACAGAGTCAAGGTG 35 ACAGTCAAGGTGCAGAGA 36 T60M CATGCGCACCTTTGGCTA 3 TTGCTGTTGGCATAGTGCT 4 TTGGCTACAACAcGAT 37 CTACAACAtGATCGATGTG 38 c.1670-191 C → T TGGATGCTCCTGGTGAAATG 5 TCCTGGGCTGGGTCTACAG 6 CCAAAGCAGGcGTGT 39 CAGGtGTGTGATTTG 40 S710X TGGCTGAACAAGAGGAAGATCAA 7 TGGCACCTGCATGAGGATCT 8 CCTTCTACTcGGATGTCAT 41 CTACTaGGATGTCATTGCC 42 T163M TCCAGATTCGTTGCATGCTC 9 CAAGCCCTCCCTCCTCTTC 10 CTGCCCTGGATTAcGG 43 CTGGATTAtGGCCCAGG 44 c. 2548 + 253 C → T GTCGCCATGAGATGGAAACT 11 TCTTTCTATCTGTGACTCTATCAAAGG 12 CACAGGcAGGTGATAT 45 CACAGGtAGGTGATATAA 46 R871H AGAGGAGGTGGAGCAAATGC 13 TCTCCTGGTCCATCCTGTTACTC 14 AAATGCAAGATCCgTG 47 AAGATCCaTGTGTTCGTAGG 48 IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT CCTTACTCATCAGGCCTTGCTT 15 TCCAGTCAGGCACCAAGTTCT 16 GCGGACATTTTT 49 AACCGAAAATTTTTC 50 W844X TGGGATCGCCCTTCAGG 17 GATCGCCCTTGCAGGAG 18 ATCTACTGgCTCTTTG 51 CTACTGaCTCTTTGACG 52 R83Q TCGCACCTTTGGCTACAACAC 19 CTTCTGAGACAGCACTTACCTTGAG 20 TGGTGAGCCCCgGA 53 CCCCaGAAGGTC 54 H90Y GTGAGCCCCGGAAGGTGA twenty one CAGGGAAGTGGCCAGTCTT twenty two AAGGTGACCTGcACTC 55 ACCTGtACTCCTTCCT 56 R642H GGATCGCCCTTGGTACAGGC twenty three TGGGATCGCCCTTCAGG twenty four TCAAGAACTACcGGTGAG 57 ACTACtGGTGAGCAGAG 58 R642C GGATCGCCCTTGGTACAGGC 25 TGGGATCGCCCTTCAGG 26 TCAAGAACTACcGGTGAG 59 ACTACtGGTGAGCAGAG 60 T649M TGGCTCCTGCCCTTTTCC 27 TGCCGGGCGGAAGTTG 28 CCTGGTGCTCAcGC 61 CTGGTGCTCAtGCG 62 N442K CAGCACAGCTGCCACTACG 29 TTGCAGGCCTGGAAGTTTGT 30 CCTCATCAAcTATTACC 63 CCTCATCAAgTATTACC 64 N640S TCTGGCCCTCAGCTACTCG 31 AGGGTGGAGCCATCACTGG 32 CACATCAAGAaCTAC 65 ACATCAAGAgCTACCGG 66 D486N TTCCCAGCCTAAGGGTGAGTG 33 GAAGCCGATCAGTGGGTACAG 34 CGAGgACCAGCTGTA 67 CCTTTGCGAGaACC 68

According to some embodiments of the present disclosure, the first mutation and the second mutation are selected from c.2881-2delAG, T60M, c.1670-191C → T, S710X, T163M, c.2548 + 253 C → T, R871H, respectively. , IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, W844X, R83Q, H90Y, R642H, R642C, T649M, N442K, N640S and D486N.

In some embodiments of the present disclosure, the first mutation is selected from the group consisting of c.2881-2delAG, c.1670-191C → T and IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT; the second mutation is selected from T60M , S710X, T163M, c.2548 + 253C → T, R871H, W844X, R83Q, H90Y, R642H, R642C, T649M, N442K, N640S and D486N.

In certain embodiments of the present disclosure, the first mutation is c.2881-2delAG; the second mutation is selected from the group consisting of T60M, c.1670-191C → T, S710X, T163M, c.2548 + 253 C → T, A group of R871H, IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, W844X, R83Q, H90Y, R642H, R642C, T649M, N442K, N640S and D486N.

According to an embodiment of the present disclosure, when the first mutation is c.2881-2delAG, the first forward primer used in the aforementioned step (b) has a nucleotide sequence of sequence number: 1; the first reverse primer Nucleotide sequence with sequence number: 2. In another embodiment, the first wild-type probe used in step (c) has a nucleotide sequence of sequence number: 35; and the first mutant-type probe has a nucleotide sequence of sequence number: 36.

In detail, a first primer pair consisting of a first forward primer having a nucleotide sequence having the sequence number: 1 and a first reverse primer having a nucleotide sequence having the sequence number: 2 can be specifically bound to A SLC12A3 gene fragment on the DNA template, and the SLC12A3 gene fragment covers the region of codon 2881 in the 24th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The SLC12A3 amplified by the first wild-type probe having a nucleotide sequence of sequence number: 35 and the first mutant probe having a nucleotide sequence of sequence number: 36 can be used simultaneously or after amplification. Gene fragments are heterozygous. If the first mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the first mutation c.2881-2delAG. In this way, based on the heterozygous results, it is possible to evaluate the individual's risk of having Gitman syndrome or the possibility of developing Gitman syndrome in the future.

According to some embodiments of the present disclosure, the second SLC12A3 gene fragment in the DNA template of the same individual may additionally or alternatively further include a second mutation. The second mutation may include T60M, c.1670-191C → T, S710X, T163M, c.2548 + 253 C → T, R871H, IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, W844X, R83Q, H90Y, R642H, R642C, T649M, At least one of N442K, N640S and D486N. A second primer can be used to amplify the second SLC12A3 gene fragment, and in step (c), the second wild-type probe and the second mutant probe are used to determine whether the amplified second SLC12A3 gene fragment contains The aforementioned second mutation.

According to an embodiment of the present disclosure, when the second mutation is T60M, the second forward primer has a nucleotide sequence of sequence number: 3, and the second reverse primer has a nucleotide sequence of sequence number: 4; meanwhile, The second wild-type probe has a nucleotide sequence of sequence number: 37, and the second mutant-type probe has a nucleotide sequence of sequence number: 38. Specifically, the second primer pair consisting of the second forward primer (sequence number: 3) and the second reverse primer (sequence number: 4) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of T60M located in the first exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with the second wild-type probe (SEQ ID: 37) and the second mutant-type probe (SEQ ID: 38) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation T60M. When conceivable, the heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is c.1670-191 C → T, the second forward primer has a nucleotide sequence of sequence number: 5 and the second reverse primer has a sequence number: 6 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 39, and the second mutant-type probe has a nucleotide sequence of sequence number: 40. Specifically, the second primer pair consisting of the second forward primer (sequence number: 5) and the second reverse primer (sequence number: 6) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region c.1670-191 C → T located at the 13th intron. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 39) and a second mutant-type probe (sequence number: 40) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation c.1670-191 C → T. In this way, based on the heterozygous results, it is possible to evaluate the individual's risk of having Gitman syndrome or the possibility of developing Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is S710X, the second forward primer has a nucleotide sequence of sequence number: 7 and the second reverse primer has a nucleotide sequence of sequence number: 8; The second wild-type probe has a nucleotide sequence of sequence number: 41, and the second mutant-type probe has a nucleotide sequence of sequence number: 42. Specifically, the second primer pair consisting of the second forward primer (sequence number: 7) and the second reverse primer (sequence number: 8) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of S710X located in the 17th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The second wild-type probe (SEQ ID: 41) and the second mutant-type probe (SEQ ID: 42) can be used to hybridize the amplified SLC12A3 gene fragment at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation S710X. In this way, based on the heterozygous results, it is possible to evaluate the individual's risk of having Gitman syndrome or the possibility of developing Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is T163M, the second forward primer has a nucleotide sequence of sequence number: 9 and the second reverse primer has a nucleotide sequence of sequence number: 10; The second wild-type probe has a nucleotide sequence of sequence number: 43 and the second mutant-type probe has a nucleotide sequence of sequence number: 44. Specifically, the second primer pair consisting of the second forward primer (sequence number: 9) and the second reverse primer (sequence number: 10) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of T163M located in the third exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 43) and a second mutant-type probe (sequence number: 44) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation T163M. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is c.2548 + 253 C → T, the second forward primer has a nucleotide sequence of sequence number: 11 and the second reverse primer has a sequence number : The nucleotide sequence of 12; meanwhile, the second wild-type probe has a nucleotide sequence of sequence number: 45, and the second mutant-type probe has a nucleotide sequence of sequence number: 46. Specifically, a second primer pair consisting of a second forward primer (sequence number: 11) and a second reverse primer (sequence number: 12) can specifically bind to the second SLC12A3 gene fragment on the DNA template The SLC12A3 gene fragment covers the region c.2548 + 253 C → T located at the 21st intron. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. A second wild-type probe (sequence number: 45) and a second mutant-type probe (sequence number: 46) can be used to hybridize the amplified SLC12A3 gene fragment at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation c.2548 + 253 C → T. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is R871H, the second forward primer has a nucleotide sequence of sequence number: 13 and the second reverse primer has a nucleotide sequence of sequence number: 14 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 47, and the second mutant-type probe has a nucleotide sequence of sequence number: 48. Specifically, the second primer pair composed of the second forward primer (sequence number: 13) and the second reverse primer (sequence number: 14) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of R871H in the 22nd exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 47) and a second mutant-type probe (sequence number: 48) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation R871H. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, the second forward primer has a nucleotide sequence of sequence number: 15 and the second reverse primer has a sequence number: 16 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 49, and the second mutant-type probe has a nucleotide sequence of sequence number: 50. Specifically, the second primer pair consisting of the second forward primer (sequence number: 15) and the second reverse primer (sequence number: 16) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT located in the eighth exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 49) and a second mutant-type probe (sequence number: 50) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is W844X, the second forward primer has a nucleotide sequence of sequence number: 17 and the second reverse primer has a nucleotide sequence of sequence number: 18 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 51, and the second mutant-type probe has a nucleotide sequence of sequence number: 52. Specifically, the second primer pair consisting of the second forward primer (sequence number: 17) and the second reverse primer (sequence number: 18) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of W844X located at the 21st exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 51) and a second mutant-type probe (sequence number: 52) simultaneously or after amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation W844X. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is R83Q, the second forward primer has a nucleotide sequence of sequence number: 19, and the second reverse primer has a nucleotide sequence of sequence number: 20; Meanwhile, the second wild-type probe has a nucleotide sequence of sequence number: 53 and the second mutant-type probe has a nucleotide sequence of sequence number: 54. Specifically, the second primer pair consisting of the second forward primer (sequence number: 19) and the second reverse primer (sequence number: 20) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of R83Q located in the first exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 53) and a second mutant-type probe (sequence number: 54) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains a second mutation R83Q. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is H90Y, the second forward primer has a nucleotide sequence of sequence number: 21, and the second reverse primer has a nucleotide sequence of sequence number: 22; Meanwhile, the second wild-type probe has a nucleotide sequence of sequence number: 55, and the second mutant-type probe has a nucleotide sequence of sequence number: 56. Specifically, the second primer pair composed of the second forward primer (sequence number: 21) and the second reverse primer (sequence number: 22) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of H90Y located in the first exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 55) and a second mutant-type probe (sequence number: 56) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation H90Y. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is R642H, the second forward primer has a nucleotide sequence of sequence number: 23 and the second reverse primer has a nucleotide sequence of sequence number: 24 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 57 and the second mutant-type probe has a nucleotide sequence of sequence number: 58. Specifically, the second primer pair consisting of the second forward primer (sequence number: 23) and the second reverse primer (sequence number: 24) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of R642H located in the 15th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 57) and a second mutant-type probe (sequence number: 58) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation R642H. When conceivable, the aforementioned heterozygous results can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is R642C, the second forward primer has a nucleotide sequence of sequence number: 25 and the second reverse primer has a nucleotide sequence of sequence number: 26 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 59, and the second mutant-type probe has a nucleotide sequence of sequence number: 60. Specifically, the second primer pair consisting of the second forward primer (sequence number: 25) and the second reverse primer (sequence number: 26) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of R642C located in the 15th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 59) and a second mutant-type probe (sequence number: 60) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation R642C. In this way, based on the aforementioned heterozygosity results, it is possible to assess whether an individual is already suffering from Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is T649M, the second forward primer has a nucleotide sequence of sequence number: 27 and the second reverse primer has a nucleotide sequence of sequence number: 28 At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 61, and the second mutant-type probe has a nucleotide sequence of sequence number: 62. Specifically, the second primer pair consisting of the second forward primer (sequence number: 27) and the second reverse primer (sequence number: 28) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of T649M located in the 16th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 61) and a second mutant-type probe (sequence number: 62) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation T649M. In this way, based on the aforementioned heterozygosity results, it is possible to assess whether an individual is already suffering from Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is N442K, the second forward primer has a nucleotide sequence of sequence number: 29, and the second reverse primer has a nucleoside of sequence number: 30. Acid sequence; meanwhile, the second wild-type probe has a nucleotide sequence of sequence number: 63, and the second mutant-type probe has a nucleotide sequence of sequence number: 64. Specifically, the second primer pair composed of the second forward primer (sequence number: 29) and the second reverse primer (sequence number: 30) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of N442K located in the 10th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 63) and a second mutant-type probe (sequence number: 64) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation N442K. In this way, based on the aforementioned heterozygosity results, it is possible to assess whether an individual is already suffering from Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is N640S, the second forward primer has a nucleotide sequence of sequence number: 31, and the second reverse primer has a nucleoside of sequence number: 32. Acid sequence; meanwhile, the second wild-type probe has a nucleotide sequence of sequence number: 65, and the second mutant-type probe has a nucleotide sequence of sequence number: 66. Specifically, the second primer pair consisting of the second forward primer (sequence number: 31) and the second reverse primer (sequence number: 32) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of N640S in the 15th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 65) and a second mutant-type probe (sequence number: 66) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation N640S. In this way, based on the aforementioned heterozygosity results, it is possible to assess whether an individual is already suffering from Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In one embodiment of the present disclosure, when the second mutation is D486N, the second forward primer has a nucleotide sequence of sequence number: 33, and the second reverse primer has a nucleotide sequence of sequence number: 34. At the same time, the second wild-type probe has a nucleotide sequence of sequence number: 67, and the second mutant-type probe has a nucleotide sequence of sequence number: 68. Specifically, the second primer pair consisting of the second forward primer (sequence number: 33) and the second reverse primer (sequence number: 34) can specifically bind to the second SLC12A3 gene fragment on the DNA template. And the SLC12A3 gene fragment covers the region of D486N located in the 12th exon. After amplification, the SLC12A3 gene fragment was selectively replicated and amplified. The amplified SLC12A3 gene fragment can be hybridized with a second wild-type probe (sequence number: 67) and a second mutant-type probe (sequence number: 68) at the same time or after the amplification. If the second mutant probe can specifically hybridize with the SLC12A3 gene fragment, it means that the SLC12A3 gene fragment contains the second mutation D486N. When it is conceivable, the hybridization results between the aforementioned probes and gene fragments can be used to assess whether an individual has already developed Gitman syndrome or is likely to be at risk for Gitman syndrome in the future.

In general, the present invention provides a method for using an in vitro sample of a body to predict whether an individual has or is at risk of having Gitman syndrome. A specific primer pair can be used to amplify at least one specific SLC12A3 gene fragment. Then, the mutant probe is specifically hybridized with the amplified specific SLC12A3 gene fragment to obtain information on whether the specific SLC12A3 gene fragment contains any mutations. The hybridization results are used to evaluate whether the individual is suffering from Gitman syndrome or is suffering from the disease. Risk of Gitman syndrome. According to this, the method of the present invention can greatly increase the pre-break accuracy and detection efficiency.

In addition, in order to solve the conventional problems and achieve the purpose of the present invention, a second aspect of the present invention provides a detection kit. In some embodiments of the present disclosure, it is related to a kit for detecting whether an individual has or is at risk of having Gitman syndrome. The set includes a first primer pair for amplifying a first SLC12A3 gene fragment. The first primer pair includes a first forward primer having a nucleotide sequence having a sequence number: 1 and a first reverse primer having a nucleotide sequence having a sequence number: 2.

According to some embodiments of the present disclosure, the set further includes a first wild-type probe having a nucleotide sequence of sequence number: 35, and a first mutation having a nucleotide sequence of sequence number: 36 Type probe.

Specifically, the first primer pair includes a first forward primer (sequence number: 1) and a first reverse primer (sequence number: 2), which are used to amplify the first SLC12A3 gene fragment containing the corresponding specific mutation site. . At the same time, a first wild-type probe (sequence number: 35) and a first mutant-type probe (sequence number: 36) may be additionally included to determine whether the amplified first SLC12A3 gene fragment contains the specific mutation.

According to some embodiments of the present disclosure, the set further includes a second primer pair for amplifying the second SLC12A3 gene fragment. The second primer pair includes: a second forward primer having a nucleotide sequence having a sequence number: 3, and a second reverse primer having a nucleotide sequence having a sequence number: 4; a second primer having a sequence number; : A second forward primer with a nucleotide sequence of 5 and a second reverse primer with a nucleotide sequence of sequence number: 6; a second forward primer with a nucleotide sequence of sequence number: 7 , And a second reverse primer with a nucleotide sequence of sequence number: 8; a second forward primer with a nucleotide sequence of sequence number: 9; and a nucleotide sequence with sequence number: 10 A second reverse primer with a nucleotide sequence of sequence number: 11 and a second reverse primer with a nucleotide sequence of sequence number: 12; a second reverse primer with sequence number: 13 A second forward primer with a nucleotide sequence of sequence number: 14 and a second reverse primer with a nucleotide sequence of sequence number: 14; a second forward primer with a nucleotide sequence of sequence number: 15; and A nucleotide sequence with sequence number: 16 A second reverse primer; a second forward primer with a nucleotide sequence of sequence number: 17 and a second reverse primer with a nucleotide sequence of sequence number: 18; A second forward primer having a nucleotide sequence and a second reverse primer having a nucleotide sequence having a sequence number: 20; a second forward primer having a nucleotide sequence having a sequence number: 21; and a A second reverse primer with a nucleotide sequence of sequence number: 22; a second forward primer with a nucleotide sequence of sequence number: 23; and a second forward primer with a nucleotide sequence of sequence number: 24 Reverse primer; a second forward primer with a nucleotide sequence of sequence number: 25 and a second reverse primer with a nucleotide sequence of sequence number: 26; a nucleoside with sequence number: 27 A second forward primer with an acid sequence, and a second reverse primer with a nucleotide sequence of sequence number: 28; a second forward primer with a nucleotide sequence of sequence number: 29, and a sequence with a sequence Number: 30th of the nucleotide sequence A reverse primer; a second forward primer with a nucleotide sequence of sequence number: 31 and a second reverse primer with a nucleotide sequence of sequence number: 32; or a second primer with sequence number: 33 A second forward primer of the nucleotide sequence and a second reverse primer having a nucleotide sequence of SEQ ID NO: 34.

In some embodiments of the present disclosure, the kit of the present invention further includes a second wild-type probe and a second mutant-type probe.

According to the foregoing description, in one embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence with a sequence number: 3) and a second reverse primer (having a nucleotide with a sequence number: 4) Sequence), the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 37 and 38, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 5) and a second reverse primer (having a nucleotide sequence of sequence number: 6) , The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 39 and 40, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 7) and a second reverse primer (having a nucleotide sequence of sequence number: 8) , The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 41 and 42, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 9) and a second reverse primer (having a nucleotide sequence of sequence number: 10) , The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 43 and 44, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 11) and a second reverse primer (having a nucleotide sequence of sequence number: 12) , The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 45 and 46, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 13) and a second reverse primer (having a nucleotide sequence of sequence number: 14), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 47 and 48, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 15) and a second reverse primer (having a nucleotide sequence of sequence number: 16), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 49 and 50, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 17) and a second reverse primer (having a nucleotide sequence of sequence number: 18), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 51 and 52, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 19) and a second reverse primer (having a nucleotide sequence of sequence number: 20), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 53 and 54, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 21) and a second reverse primer (having a nucleotide sequence of sequence number: 22), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 55 and 56, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 23) and a second reverse primer (having a nucleotide sequence of sequence number: 24), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 57 and 58, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 25) and a second reverse primer (having a nucleotide sequence of sequence number: 26), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 59 and 60, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 27) and a second reverse primer (having a nucleotide sequence of sequence number: 28), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 61 and 62, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 29) and a second reverse primer (having a nucleotide sequence of sequence number: 30), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 63 and 64, respectively.

In another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 31) and a second reverse primer (having a nucleotide sequence of sequence number: 32), Then the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 65 and 66, respectively.

In yet another embodiment, when the second primer pair includes a second forward primer (having a nucleotide sequence of sequence number: 33) and a second reverse primer (having a nucleotide sequence of sequence number: 34), Then, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 67 and 68, respectively.

It should be noted that according to the embodiments of the present disclosure, the set of the present invention is not limited to two primer pairs, and may include a third primer pair, a fourth primer pair, or more primer pairs according to actual needs. These pairs may include any of the primer nucleotide sequences listed in Table 1 of the present invention, and may also include other different nucleotide sequences. Meanwhile, when the set of the present invention has a third primer pair or more primer pairs, it may further include a third wild-type probe and / or a third mutant having the probe nucleotide sequence listed in Table 1 of the present invention. Probes may also contain different nucleotide sequences.

According to some embodiments of the present disclosure, the first wild-type probe, the first mutant-type probe, the second wild-type probe, and the second mutant-type probe may be separately associated with the first detection label and the second The detection tag, the third detection tag, and the fourth detection tag are connected to present hybridization information between the probe and the target DNA. Specifically, the signals sent by the first detection mark, the second detection mark, the third detection mark, and the fourth detection mark may be different from each other, so as to distinguish different hybrids. In one embodiment, the detection mark may be a fluorescent mark, and the signal may be a light signal. In yet another embodiment, the first, second, third, and fourth detection marks emit light of different wavelengths, respectively. Preferably, the wavelengths of these lights may be between 510 nm and 520 nm, between 550 nm and 560 nm, between 575 nm and 585 nm, and between 610 nm and 620 nm. In one embodiment, the detection marks can emit light at wavelengths of 517 nm, 551 nm, 580 nm, and 617 nm, respectively. At the same time, the light wavelengths listed here are only exemplary and non-limiting, and the color of the optical signal is not limited to this. Detection tags applicable to the present invention include, but are not limited to, VIC ^™ , FAM ^™ , JUN ^™ , ABY ^™ , HEX ^™ , NED ^™ , TAMRA ^™ , SYBR® Green, Texas Red®, and the like. Preferred are VIC ^™ , FAM ^™ , JUN ^™, and ABY ^™ .

A number of experimental examples are provided below to illustrate some aspects of the present invention, so that those with ordinary knowledge in the technical field to which the present invention pertains can implement the present invention, and these experimental examples should not be regarded as limiting the scope of the present invention. It is believed that a person having ordinary knowledge in the technical field to which the present invention pertains may fully utilize and practice the present invention without undue interpretation after reading the description provided herein. All publications cited herein are considered as part of this specification in their entirety.

Experimental example

Materials and Methods

Collect individual isolated samples

Blood was collected from 176 patients suspected of having Gitman's syndrome in a medical unit (National Defense Medical Center, Taiwan). These patients all showed clinical symptoms of hypokalemia, metabolic alkalosis, and high urine salt. Subsequent experiments have obtained the consent of these patients. After blood collection, the patient's genomic DNA was obtained with a Puregene blood kit (supplier: Qiagen) and stored in an appropriate environment.

Mutation detection

Add the genomic DNA solution (1 μl in volume or 50 ng in weight) to the specific primer pair (volume: 2.5 μl), TaqMan ^TM specific probes (including specific wild-type probes and specific mutant probes) (2.5 μl each) in a 96-well plate. After adding a master mix to a total reaction volume of 10 μl per well, a real-time polymerase chain reaction was performed using a real-time PCR reaction machine (model: QuantStudio 5 Real-Time PCR System, supplier: Applied Biosytems) under appropriate conditions.

The aforementioned specific primer pair includes at least one of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 34, the aforementioned specific wild-type probe includes and SEQ ID NO: 35, 37, 39, 41, 43 , 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65 and 67 at least one of the nucleotide sequences shown, and the aforementioned specific mutant probes include, for example, a sequence number: At least one of the nucleotide sequences shown in 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, and 68 (see Table 1) . The 5 'end of the specific wild-type probe is connected to the green fluorescent label VIC ^TM or red JUN ^TM ; the 5' end of the specific mutant probe is connected to the blue fluorescent label FAM ^TM or yellow fluorescent label ABY ^TM .

The specific primer pairs and specific probes that identify specific mutations can be combined into a test combination and placed in the same well, and the specific probes are connected to fluorescent labels of different colors for easy differentiation (Table 2). There are a total of five test groups. The remaining specific primer pairs and specific probes are individually placed in independent reaction wells. The 12 vertical columns of the 96-well reaction plate correspond to different mutant genotypes, and the 8 horizontal rows correspond to different individual samples. Table 2: Types of mutations that can form test combinations combination Mutation I Specific wild-type probe Fluorescent detection mark Mutation II Specific wild-type probe Fluorescent detection mark Specific mutant probe Specific mutant probe 1 c.2881-2delAG Sequence Number: 35 JUN ^TM IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT Sequence Number: 49 VIC ^TM Sequence Number: 36 ABY ^TM Sequence Number: 50 FAM ^TM 2 c.1670-191 C → T Sequence Number: 39 JUN ^TM W844X Sequence Number: 51 VIC ^TM Sequence Number: 40 ABY ^TM Sequence Number: 52 FAM ^TM 3 N640S Sequence Number: 65 JUN ^TM S710X Sequence Number: 41 VIC ^TM Sequence Number: 66 ABY ^TM Sequence Number: 42 FAM ^TM 4 R83Q Sequence Number: 53 JUN ^TM R871H Sequence Number: 47 VIC ^TM Sequence Number: 54 ABY ^TM Sequence Number: 48 FAM ^TM 5 T649M Sequence Number: 61 VIC ^TM T163M Sequence Number: 43 VIC ^TM Sequence Number: 62 FAM ^TM Sequence Number: 44 FAM ^TM

The reaction conditions of real-time PCR are set as follows: Stage 1: Initial stage maintains 60 ° C for 30 seconds; Stage 2: Warm up to 95 ° C for 5 minutes; Stage 3: Separate two strands of DNA at 95 ° C for 30 seconds; Stage 4: Take 60 DNA extension at 1 ° C for 1 minute; return to stage 3 and repeat 40 cycles; stage 5: cool to 60 ° C for 30 seconds to complete the reaction.

3. Results analysis

The blood test results for these patients are shown in Figures 1 to 4. Each point on the graph can represent the genotype of each sample, and the genotype distribution of these individuals can be represented in the quadrant area of the graph. The dots in the first quadrant (light gray dots) indicate heterozygous mutations; the second quadrant (black dots): homozygous mutants; the third quadrant: no signal area; the fourth quadrant (grey dots): homozygous Wild type. Figure 1 presents the results of detection of c.2881-2delAG mutations in patients suspected of having Gitman syndrome. Based on specific primer pairs and specific probes, homomorphic mutations (second quadrant) and heterotypes can be distinguished. The mutation (first quadrant) is to determine that the patient has a c.2881-2delAG mutation. Figure 2 shows that these individuals have a mutation of IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT. Based on the specific primer pair and the specific probe, they can distinguish between the homotype mutation (second quadrant) and the heterotype mutation (first quadrant). Figure 3 presents the detection results for the c.1670-191 C → T mutation, which appears in this test group. Most individuals carry the homozygous c.1670-191 C → T mutation (second quadrant). Figure 4 also presents the test results of these patients, which shows that all of these test individuals carry the heterozygous mutation N442K (first quadrant).

Comparative example

Taking mutations T163M and R871H as examples, the specificity primer pairs and specificity probes of the mutations and the comparison primer pairs and comparison probes were tested for efficacy. Please refer to Table 3, which lists the sequences of specific primer pairs and specific probes for mutations T163M and R871H, and the sequences of comparison primer pairs and comparison probes. Table 3: Sequences of specific primer pairs, specific probes, comparison primer pairs, and comparison probes for mutations T163M and R871H mutation Forward primer Reverse primer Wild-type probe Mutant probe T163M Experimental example TCCAGATTCGTTGCATGCTC CAAGCCCTCCCTCCTCTTC CTGCCCTGGATTAcGG CTGGATTAtGGCCCAGG Comparative example TTC GTTG CATGCT CAAC ATTT GCTGGGAA GAA TGGGA TTC A A + TT + A + C G + G + CC + CA AT + T + A + T + GG + CC + CA R871H Experimental example AGAGGAGGTGGAGCAAATG TCTCCTGGTCCATCCTGTTA AAATGCAAGATCCg AAGATCCaTGTGTTCGTAGG Comparative example ACCCTCCTCATTCCCTATC CTCCTGGTCCATCCTGTTAATC A GA + TC + CG + TG + T + GT A GAT + C + C + A + TG + T + GT

FIG. 5 shows the detection results of the specific primer pair and the specific probe pair with the comparison primer pair and the comparison probe for the mutation T163M. Patients with mutation T163M and confirmed diagnosis of Gitman syndrome were selected from the isolated samples, and the heterozygous efficiency of mutant T163M was detected by comparing primer pairs and comparing probes with specific primer pairs and specific probes, respectively. Panel A shows the results of specific primer pairs (sequence numbers: 9 and 10) and specific probes (sequence numbers: 43 and 44) with mutation T163M. Among them, after a certain amplification cycle, a significant increase in the number of copies of the target gene fragment can be obtained (increased fluorescence signal), and the mutation status of the allele (wild) can be obtained by wild-type probes and mutant probes. The signals of both the type probe and the mutant probe increase with the number of cycles, indicating that the individual carries the heterozygous mutant genotype). Panel B shows the results of comparing primer pairs and probes. It can be clearly seen that these primer pairs fail to effectively amplify the target gene fragment, and at the same time, the wild-type probe and the mutant-type probe cannot be distinguished from each other.

FIG. 6 shows the detection results for the mutant R871H with a specific primer pair and a specific probe and a comparison primer pair and a comparison probe. Patients with mutation R871H and confirmed diagnosis of Gitman syndrome were selected, and isolated samples were taken, and the heterozygous efficiency of the mutant R871H was detected by specific primer pairs, specific probe pairs, comparison primer pairs, and comparison probes, respectively. Panel A shows the detection results of the specific primer pair (sequence numbers: 13 and 14) and the specific probe (sequence numbers: 47 and 48) with mutation R871H. Among them, after a certain amplification cycle, a significant increase in the number of copies of the target gene fragment can be obtained (increased fluorescence signal), and the mutation status of the allele (wild type) can be obtained through wild-type probes and mutant probes. The signals of both the type probe and the mutant probe increase with the number of cycles, indicating that the individual carries the heterozygous mutant genotype). Panel B shows the results of comparing primer pairs and probes. Among them, it can be clearly seen that the primer pairs failed to effectively amplify the target gene fragment containing the mutation R871H, and at the same time, the wild-type probe and the mutant probe could not be distinguished from each other.

In summary, the present invention provides a method and kit for using an in vitro sample of a body to predict whether an individual is suffering from or at risk of having Gitman syndrome. By using at least one specific primer pair, Amplify at least one specific SLC12A3 gene fragment, and at the same time, use a specific probe corresponding to the amplified SLC12A3 gene fragment to obtain whether the amplified SLC12A3 gene fragment contains at least one mutation. This can improve the detection accuracy and detection efficiency of the mutant genes associated with Gitman syndrome, so as to quickly and accurately obtain the prediction and detection results of Gitman syndrome.

At the same time, compared with non-specific primer pairs and probes (comparative example), the specific primer pairs and specific probes provided by the present invention have a better degree of heterozygosity with the target SLC12A3 gene fragment, which improves the genetic detection Accuracy and significant effect.

no

In order to make the above and other objects, features, advantages, and embodiments of the present invention more comprehensible, the description of the drawings is as follows:

FIG. 1 shows the test results of isolated samples of individuals suspected of having Gitman syndrome using the method and kit of the present invention, which shows whether the sample contains the mutation of c.2881-2delAG. Each point represents a sample unit value. The first quadrant: individuals carrying heterozygous mutation genotypes; the second quadrant: individuals carrying homozygous mutation genotypes; the fourth quadrant: individuals carrying wild-type (normal) genotypes.

Figure 2 shows the test results of an individual sample of an individual suspected of having Gittman syndrome using the method and kit of the present invention, which shows whether the sample contains IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT (referred to as IVS 7-1) mutation. Each point represents a sample unit value. The first quadrant: individuals carrying heterozygous mutation genotypes; the second quadrant: individuals carrying homozygous mutation genotypes; the fourth quadrant: individuals carrying wild-type (normal) genotypes.

FIG. 3 shows the test results of isolated samples of individuals suspected of having Gitman syndrome using the method and kit of the present invention, which shows whether the sample contains a mutation of c.1670-191C → T. Each point represents a sample unit value. The first quadrant: individuals carrying heterozygous mutation genotypes; the second quadrant: individuals carrying homozygous mutation genotypes; the fourth quadrant: individuals carrying wild-type (normal) genotypes.

FIG. 4 shows the test results of isolated samples of individuals suspected of having Gitman syndrome using the method and kit of the present invention, which shows whether the samples contain a mutation of N442K. Each point represents a sample unit value. The first quadrant: individuals carrying heterozygous mutation genotypes; the second quadrant: individuals carrying homozygous mutation genotypes; the fourth quadrant: individuals carrying wild-type (normal) genotypes.

FIG. 5 shows the detection results of the specific primer pair and the specific probe pair with the comparison primer pair and the comparison probe for the mutation T163M. Panel A: detection results using specific primer pairs (sequence numbers: 9 and 10) and specific probes (sequence numbers: 43 and 44). Panel B: the results of comparing primer pairs and comparing probes.

FIG. 6 shows the detection results for the mutant R871H with a specific primer pair and a specific probe and a comparison primer pair and a comparison probe. Panel A: detection results using specific primer pairs (sequence numbers: 13 and 14) and specific probes (sequence numbers: 47 and 48). Panel B: the results of comparing primer pairs and comparing probes.

Sequence List <110> National Defense Medical College <120> Method and Kit for Predicting Gitman Syndrome <130> P3083-TW <160> 68 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> artificial sequence <400> 1gactgcccct ggaagatctc a 21 <210> 2 <211> 20 <212> DNA <213> artificial sequence <400> 2tgtccctgac ccagtgatgt 20 <210> 3 <211> 18 <212> DNA <213 > Artificial Sequence <400> 3catgcgcacc tttggcta 18 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <400> 4ttgctgttgg catagtgct 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence < 400> 5tggatgctcc tggtgaaatg 20 <210> 6 <211> 19 <212> DNA <213> artificial sequence <400> 6tcctgggctg ggtctacag 19 <210> 7 <211> 23 <212> DNA <213> artificial sequence <400> 7tggctgaaca agaggaagat caa 23 <210> 8 <211> 20 <212> DNA <213> artificial sequence <400> 8tggcacctgc atgaggatct 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <400> 9tccagattcg ttgcatgctc 20 <210 > 10 <211> 19 <212> DNA <213> artificial sequence <400> 10caagccctcc ctcctcttc 19 <210> 11 <211> 20 <212> DNA <213> artificial sequence <400> 11gtcgccatga gatggaaact 20 <210> 12 <211 > 27 <212> DNA <213> Artificial sequence <400> 12tctttct atc tgtgactcta tcaaagg 27 <210> 13 <211> 20 <212> DNA <213> artificial sequence <400> 13agaggaggtg gagcaaatgc 20 <210> 14 <211> 23 <212> DNA <213> artificial sequence <400> 14tctcctggtc catcctgtta ctc 23 <210> 15 <211> 22 <212> DNA <213> artificial sequence <400> 15ccttactcat caggccttgc tt 22 <210> 16 <211> 21 <212> DNA <213> artificial sequence <400> 16tccagtcagg caccaagttc t 21 < 210> 17 <211> 17 <212> DNA <213> artificial sequence <400> 17tgggatcgcc cttcagg 17 <210> 18 <211> 17 <212> DNA <213> artificial sequence <400> 18gatcgccctt gcaggag 17 <210> 19 < 211> 21 <212> DNA <213> Artificial sequence <400> 19tcgcaccttt ggctacaaca c 21 <210> 20 <211> 25 <212> DNA <213> Artificial sequence <400> 20cttctgagac agcacttacc ttgag 25 <210> 21 <211> 18 <212> DNA <213> artificial sequence <400> 21gtgagccccg gaaggtga 18 <210> 22 <211> 19 <212> DNA <213> artificial sequence <400> 22cagggaagtg gccagtctt 19 <210> 23 <211> 20 <212> DNA <213> artificial sequence <400> 23ggatcgccct tggtacaggc 20 <210> 24 <211> 17 <212> DNA <213> artificial sequence <400> 24tgggatcgcc cttcagg 17 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25ggatcgccct tggtacag gc 20 <210> 26 <211> 17 <212> DNA <213> artificial sequence <400> 26tgggatcgcc cttcagg 17 <210> 27 <211> 18 <212> DNA <213> artificial sequence <400> 27tggctcctgc ccttttcc 18 <210 > 28 <211> 16 <212> DNA <213> artificial sequence <400> 28tgccgggcgg aagttg 16 <210> 29 <211> 19 <212> DNA <213> artificial sequence <400> 29cagcacagct gccactacg 19 <210> 30 <211 > 20 <212> DNA <213> artificial sequence <400> 30ttgcaggcct ggaagtttgt 20 <210> 31 <211> 19 <212> DNA <213> artificial sequence <400> 31tctggccctc agctactcg 19 <210> 32 <211> 19 <212 > DNA <213> artificial sequence <400> 32agggtggagc catcactgg 19 <210> 33 <211> 21 <212> DNA <213> artificial sequence <400> 33ttcccagcct aagggtgagt g 21 <210> 34 <211> 21 <212> DNA < 213> artificial sequence <400> 34gaagccgatc agtgggtaca g 21 <210> 35 <211> 18 <212> DNA <213> artificial sequence <400> 35aagaacagag tcaaggtg 18 <210> 36 <211> 18 <212> DNA <213> artificial Sequence <400> 36acagtcaagg tgcagaga 18 <210> 37 <211> 16 <212> DNA <213> artificial sequence <400> 37ttggctacaa cacgat 16 <210> 38 <211> 19 <212> DNA <213> artificial sequence <400> 38ctacaacatg atcgatgtg 19 <210> 39 <211> 15 <212> DNA <213> artificial Sequence <400> 39ccaaagcagg cgtgt 15 <210> 40 <211> 15 <212> DNA <213> artificial sequence <400> 40caggtgtgtg atttg 15 <210> 41 <211> 19 <212> DNA <213> artificial sequence <400> 41ccttctactc ggatgtcat 19 <210> 42 <211> 19 <212> DNA <213> artificial sequence <400> 42ctactaggat gtcattgcc 19 <210> 43 <211> 16 <212> DNA <213> artificial sequence <400> 43ctgccctgga ttacgg 16 < 210> 44 <211> 17 <212> DNA <213> artificial sequence <400> 44ctggattatg gcccagg 17 <210> 45 <211> 16 <212> DNA <213> artificial sequence <400> 45cacaggcagg tgatat 16 <210> 46 < 211> 18 <212> DNA <213> Artificial sequence <400> 46cacaggtagg tgatataa 18 <210> 47 <211> 16 <212> DNA <213> Artificial sequence <400> 47aaatgcaaga tccgtg 16 <210> 48 <211> 20 < 212> DNA <213> artificial sequence <400> 48aagatccatg tgttcgtagg 20 <210> 49 <211> 12 <212> DNA <213> artificial sequence <400> 49gcggacattt tt 12 <210> 50 <211> 15 <212> DNA < 213> artificial sequence <400> 50aaccgaaaat ttttc 15 <210> 51 <211> 16 <212> DNA <213> artificial sequence <400> 51atctactggc tctttg 16 <210> 52 <211> 17 <212> DNA <213> artificial sequence <400> 52ctactgactc tttgacg 17 <210> 53 <211> 14 <212> DNA <213> people Sequence <400> 53tggtgagccc cgga 14 <210> 54 <211> 12 <212> DNA <213> artificial sequence <400> 54ccccagaagg tc 12 <210> 55 <211> 16 <212> DNA <213> artificial sequence <400> 55aaggtgacct gcactc 16 <210> 56 <211> 16 <212> DNA <213> artificial sequence <400> 56acctgtactc cttcct 16 <210> 57 <211> 18 <212> DNA <213> artificial sequence <400> 57tcaagaacta ccggtgag 18 < 210> 58 <211> 17 <212> DNA <213> artificial sequence <400> 58actactggtg agcagag 17 <210> 59 <211> 18 <212> DNA <213> artificial sequence <400> 59tcaagaacta ccggtgag 18 <210> 60 < 211> 17 <212> DNA <213> artificial sequence <400> 60actactggtg agcagag 17 <210> 61 <211> 14 <212> DNA <213> artificial sequence <400> 61cctggtgctc acgc 14 <210> 62 <211> 14 < 212> DNA <213> artificial sequence <400> 62ctggtgctca tgcg 14 <210> 63 <211> 17 <212> DNA <213> artificial sequence <400> 63cctcatcaac tattacc 17 <210> 64 <211> 17 <212> DNA < 213> artificial sequence <400> 64cctcatcaag tattacc 17 <210> 65 <211> 15 <212> DNA <213> artificial sequence <400> 65cacatcaaga actac 15 <210> 66 <211> 17 <212> DNA <213> artificial sequence <400> 66acatcaagag ctaccgg 17 <210> 67 <211> 15 <212> DNA <213> Artificial sequence < 400> 67cgaggaccag ctgta 15 <210> 68 <211> 14 <212> DNA <213> Artificial sequence <400> 68cctttgcgag aacc 14

Claims (10)

A method for predicting whether an individual has Gitelman's syndrome or is at risk of developing Gitman's syndrome using an in vitro sample of an individual, comprising: (a) extracting DNA from the isolated sample; (b) Using the DNA of step (a) as a template, a first primer pair is used to amplify a first SLC12A3 gene fragment, wherein the first primer pair includes a first forward primer and a first reverse primer; (c) Determine whether the amplified first SLC12A3 gene fragment contains a first mutation of c.2881-2delAG; and (d) evaluate whether the individual has a Gitman syndrome or has a gyratory disease based on the result of step (c) The risk of Gatman syndrome, wherein if the amplified first SLC12A3 gene fragment contains the first mutation, the individual is suffering from Gatman syndrome or is at risk of Gitman syndrome; wherein when the first mutation is c. 2881-2delAG, the first forward primer and the first reverse primer have nucleotide sequences of sequence numbers: 1 and 2, respectively. The method according to claim 1, wherein step (c) is to use a first wild-type probe and a first mutant probe to determine whether the amplified first SLC12A3 gene fragment contains the first mutation. The first wild-type probe and the first mutant-type probe have nucleotide sequences of sequence numbers: 35 and 36, respectively. The method according to claim 1, wherein step (b) further comprises using a second primer pair to amplify a second SLC12A3 gene fragment, thereby determining the amplified second SLC12A3 in step (c). Whether the gene fragment contains one selected from T60M, c.1670-191C → T, S710X, T163M, c.2548 + 253C → T, R871H, IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, W844X, R83Q, H90Y, R642H, R642C, The second mutation of the group consisting of T649M, N442K, N640S and D486N, wherein the second primer pair includes a second forward primer and a second reverse primer, and when the second mutation is T60M, the The second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 3 and 4, respectively; when the second mutation is c.1670-191 C → T, the second forward primer and The second reverse primer has nucleotide sequences of sequence numbers: 5 and 6, respectively; when the second mutation is S710X, the second forward primer and the second reverse primer have sequence numbers: 7 and Nucleotide sequence of 8; when the second mutation is T163M, the second forward primer and the second The reverse primers have nucleotide sequences of sequence numbers: 9 and 10 respectively; when the second mutation is c.2548 + 253 C → T, the second forward primer and the second reverse primer each have sequences Numbers: 11 and 12 nucleotide sequences; when the second mutation is R871H, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 13 and 14, respectively; when the When the second mutation is IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 15 and 16, respectively; when the second mutation is W844X, Then the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 17 and 18 respectively; when the second mutation is R83Q, the second forward primer and the second reverse primer The primers have nucleotide sequences of sequence numbers: 19 and 20 respectively; when the second mutation is H90Y, the second forward primer and the second reverse primer have nucleotides of sequence numbers: 21 and 22, respectively Sequence; when the second mutation is R642H, the second forward primer and the second The forward primer has nucleotide sequences of sequence numbers: 23 and 24 respectively; when the second mutation is R642C, the second forward primer and the second reverse primer have nucleosides of sequence numbers: 25 and 26, respectively Acid sequence; when the second mutation is T649M, the second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 27 and 28, respectively; when the second mutation is N442K, then The second forward primer and the second reverse primer have nucleotide sequences of sequence numbers: 29 and 30, respectively; when the second mutation is N640S, the second forward primer and the second reverse primer Nucleotide sequences with sequence numbers: 31 and 32 respectively; or when the second mutation is D486N, the second forward primer and the second reverse primer have nucleosides of sequence numbers: 33 and 34 Acid sequence. The method according to claim 3, wherein step (c) is to use a second wild-type probe and a second mutant probe to determine whether the amplified second SLC12A3 gene fragment contains the second mutation. Wherein, when the second mutation is T60M, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 37 and 38, respectively; when the second mutation is c.1670 -191 C → T, the second wild-type probe and the second mutant probe have nucleotide sequences of sequence numbers: 39 and 40, respectively; when the second mutation is S710X, the second The wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 41 and 42, respectively; when the second mutation is T163M, the second wild-type probe and the second mutant-type probe The needles each have a nucleotide sequence of sequence numbers: 43 and 44; when the second mutation is c. 2548 + 253 C → T, the second wild-type probe and the second mutant probe each have a sequence No .: 45 and 46 nucleotide sequences; when the second mutation is R871H, the second wild-type probe and the second mutation Type probes each have a nucleotide sequence of sequence numbers: 47 and 48; when the second mutation is IVS7-1G → A + 971delCGGACATTTTTInsACCGAAAATTTT, the second wild-type probe and the second mutant-type probe have SEQ ID NOs: 49 and 50 nucleotide sequences; when the second mutation is W844X, the second wild-type probe and the second mutant probe have nucleotide sequences of sequence numbers: 51 and 52, respectively ; When the second mutation is R83Q, the second wild-type probe and the second mutant probe have nucleotide sequences of sequence numbers: 53 and 54, respectively; when the second mutation is H90Y, then The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 55 and 56, respectively; when the second mutation is R642H, the second wild-type probe and the second mutant-type probe The mutant probe has a nucleotide sequence of sequence numbers: 57 and 58 respectively; when the second mutation is R642C, the second wild-type probe and the second mutant probe have sequence numbers: 59 and Nucleotide sequence 60; when the second mutation is T649M, the second mutation The wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 61 and 62, respectively; when the second mutation is N442K, the second wild-type probe and the second mutant-type probe The needles have nucleotide sequences of sequence numbers: 63 and 64 respectively; when the second mutation is N640S, the second wild-type probe and the second mutant probe have cores of sequence numbers: 65 and 66, respectively Nucleotide sequence; or when the second mutation is D486N, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 67 and 68, respectively. The method of claim 1, wherein the isolated sample is selected from the group consisting of blood, plasma, interstitial fluid, saliva, tear fluid, intraocular fluid, urine, lymph fluid, spinal fluid, cervical fluid, and vaginal fluid . A kit for detecting whether an individual has or is at risk of having Gitman syndrome, comprising: a first primer pair for amplifying a first SLC12A3 gene fragment, which comprises a sequence number A first forward primer of the nucleotide sequence of: 1 and a first reverse primer of the nucleotide sequence of sequence number: 2. The kit according to claim 6, further comprising a first wild-type probe having a nucleotide sequence of sequence number: 35, and a first mutant-type probe having a nucleotide sequence of sequence number: 36 . The kit according to claim 6, further comprising a second primer pair for amplifying a second SLC12A3 gene fragment, which includes a second forward primer having a nucleotide sequence having a sequence number: 3, and A second reverse primer with a nucleotide sequence of sequence number: 4; a second forward primer with a nucleotide sequence of sequence number: 5; and a second forward primer with a nucleotide sequence of sequence number: 6 Two reverse primers; a second forward primer with a nucleotide sequence of sequence number: 7 and a second reverse primer with a nucleotide sequence of sequence number: 8; a core with sequence number: 9 A second forward primer with a nucleotide sequence of SEQ ID NO: 10; a second forward primer with a nucleotide sequence of SEQ ID: 11; and a second forward primer with a nucleotide sequence of SEQ ID: 11 Sequence number: second reverse primer with a nucleotide sequence of 12; a second forward primer with a nucleotide sequence of sequence number: 13; and a second reverse primer with a nucleotide sequence of sequence number: 14 Forward primer; a nucleoside with sequence number: 15 A second forward primer of the sequence, and a second reverse primer having a nucleotide sequence of sequence number: 16; a second forward primer of a nucleotide sequence of sequence number: 17; and a sequence number : A second reverse primer with a nucleotide sequence of 18; a second forward primer with a nucleotide sequence of sequence number: 19; and a second reverse primer with a nucleotide sequence of sequence number: 20 A second forward primer with a nucleotide sequence of sequence number: 21 and a second reverse primer with a nucleotide sequence of sequence number: 22; a second primer with a nucleotide sequence of sequence number: 23 A second forward primer and a second reverse primer having a nucleotide sequence of sequence number: 24; a second forward primer having a nucleotide sequence of sequence number: 25; and a second forward primer of sequence number: 26 A second reverse primer with a nucleotide sequence of sequence number: 27, and a second reverse primer with a nucleotide sequence of sequence number: 28; a Nucleoside with sequence number: 29 A second forward primer with an acid sequence, and a second reverse primer with a nucleotide sequence of sequence number: 30; a second forward primer with a nucleotide sequence of sequence number: 31, and a sequence with a sequence Number: the second reverse primer of the nucleotide sequence of 32; or a second forward primer of the nucleotide sequence of sequence number: 33, and a second of the second nucleotide sequence of sequence number: 34 Back primer. The kit according to claim 8, further comprising a second wild-type probe and a second mutant-type probe, wherein when the second primer pair includes the second nucleotide sequence having the sequence number: 3 When the forward primer and the second reverse primer having the nucleotide sequence of sequence number 4 are used, the second wild-type probe and the second mutant probe have nucleosides of sequence numbers 37 and 38, respectively. Acid sequence; when the second primer pair includes the second forward primer with the nucleotide sequence of sequence number: 5 and the second reverse primer with the nucleotide sequence of sequence number: 6, the first The two wild-type probes and the second mutant-type probe have nucleotide sequences of sequence numbers: 39 and 40, respectively; when the second primer pair includes the second forward direction of the nucleotide sequence of sequence number: 7 When the primer and the second reverse primer having a nucleotide sequence of sequence number: 8 are used, the second wild-type probe and the second mutant probe have nucleotide sequences of sequence numbers: 41 and 42 respectively ; When the second primer pair includes the first nucleotide sequence having the nucleotide sequence having the sequence number: 9 When the forward primer and the second reverse primer having the nucleotide sequence of sequence number: 10, the second wild-type probe and the second mutant-type probe have nucleosides of sequence numbers: 43 and 44 respectively Acid sequence; when the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 11 and the second reverse primer having the nucleotide sequence of sequence number: 12, the first The two wild-type probes and the second mutant-type probe have nucleotide sequences of sequence numbers: 45 and 46, respectively; when the second primer pair includes the second forward direction of the nucleotide sequence of sequence number: 13 When the primer and the second reverse primer having the nucleotide sequence of sequence number 14 are used, the second wild-type probe and the second mutant probe have nucleotide sequences of sequence numbers 47 and 48, respectively ; When the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 15 and the second reverse primer having the nucleotide sequence of sequence number: 16, the second wild primer Type probe and the second mutant probe have sequence numbers: 49 A nucleotide sequence of 50; when the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 17 and the second reverse primer having the nucleotide sequence of sequence number: 18 , The second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 51 and 52, respectively; when the second primer pair includes the nucleotide sequence of sequence numbers: 19 When the second forward primer and the second reverse primer having a nucleotide sequence having a sequence number: 20, the second wild-type probe and the second mutant type probe have sequence numbers: 53 and 54 respectively. Nucleotide sequence; when the second primer pair includes the second forward primer having the nucleotide sequence of sequence number: 21 and the second reverse primer having the nucleotide sequence of sequence number: 22, then The second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence numbers: 55 and 56; when the second primer pair includes the second nucleotide sequence of the sequence number: 23 Forward primer and the first nucleotide sequence of the nucleotide sequence having the sequence number: 24 In the case of a reverse primer, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence number: 57 and 58; when the second primer pair includes the core with sequence number: 25 When the second forward primer of the nucleotide sequence and the second reverse primer of the nucleotide sequence having the sequence number: 26, the second wild-type probe and the second mutant probe each have a sequence number: Nucleotide sequences of 59 and 60; when the second primer pair includes the second forward primer having the nucleotide sequence having the sequence number: 27 and the second reverse primer having the nucleotide sequence having the sequence number: 28 In the case of a primer, the second wild-type probe and the second mutant-type probe each have a nucleotide sequence of sequence number: 61 and 62; when the second primer pair includes the nucleotide of sequence number: 29 When the second forward primer of the sequence and the second reverse primer of the nucleotide sequence having the sequence number: 30, the second wild-type probe and the second mutant-type probe have sequence numbers: 63 and A nucleotide sequence of 64; when the second primer pair contains the possessing sequence When the second forward primer with the nucleotide sequence of 31 and the second reverse primer with the nucleotide sequence of 32 are, the second wild-type probe and the second mutant probe Respectively having a nucleotide sequence of sequence number: 65 and 66; or when the second primer pair includes the second forward primer of the nucleotide sequence of sequence number: 33 and the nucleoside of sequence number: 34 When the second reverse primer of the acid sequence is used, the second wild-type probe and the second mutant-type probe have nucleotide sequences of sequence numbers: 67 and 68, respectively. The kit according to claim 9, wherein the first wild-type probe, the first mutant-type probe, the second wild-type probe, and the second mutant-type probe are respectively connected to a first and a first The second, third, and fourth detection marks are connected, and the first, second, third, and fourth detection marks can emit light wavelengths different from each other.