CN101423865B - Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof - Google Patents
Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof Download PDFInfo
- Publication number
- CN101423865B CN101423865B CN2007100476361A CN200710047636A CN101423865B CN 101423865 B CN101423865 B CN 101423865B CN 2007100476361 A CN2007100476361 A CN 2007100476361A CN 200710047636 A CN200710047636 A CN 200710047636A CN 101423865 B CN101423865 B CN 101423865B
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- primer
- seq
- tlr7
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a method for testing mononucleotide polymorphism of human TLR7 gene, and discloses a method for testing susceptibility of a tested person to systemic lupus erythematosus through testing allele and genotype on nucleotide polymorphism locus of TLR7 gene 3'UTR region from a stop codon 880bp. The invention also discloses a test kit for the systemic lupus erythematosus. The invention proves that polymorphism locus of TLR7 gene 3'UTR is related to SLE, and can influence expression regulation or stability of mRNA.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to a kind of human Toll-like receptor 7 body 7 gene mononucleotide polymorphisms and the application in diagnosis and therapy system lupus erythematosus thereof.
Background technology
(systemic lupus erythematosus SLE) is considered to the prototype of autoimmune disease to systemic lupus erythematous, is distinguishing feature with the autoantibodies that produce in a large number at nuclear antigen.The IFN-α that discovers in recent years plays an important role in SLE.The lupus The Animal Model Study is found that a plurality of lupus candidate genes site is interferon-induced genes involved, after lupus mouse NZB and the hybridization of IFN acceptor gene knock-out mice, its filial generation (IFN acceptor defect), the state of an illness obviously alleviates, and prolongs lifetime, and has lupus background NZB x NZW/F1 mouse injects IFN-α in its body after, the state of an illness obviously increases the weight of, shorten lifetime (Santiago-Raber, et al.J Exp Med 2003,197:777-788).The IFN-alpha levels obviously increases among the SLE patients serum, and some itself behind patient's multiple injection IFN-α of the patient of autoimmune disease such as malignant tumour or virus infection, can produce antinuclear antibody (ANA), even bring out SLE symptom (Han, G.M., et al.Genes Immun, 2003,4:177-186).There is a feature in the SLE peripheral blood of patients mononuclearcell gene expression profile that studies show that of gene level: one group of Interferon, rabbit regulatory gene (OAS1, IFIT3, IFIT1, Ly6e etc.) abnormal expression rising (Diebold, etal.Science, 2004,303:1529-1531).These results show that all Interferon, rabbit path abnormal activation is main molecular phenotype of SLE.By cell surface or intracellular receptor identification virus, bacterium or protozoacide DNA, RNA causes the crucial induction factor of IFN-α excretory, and wherein Toll sample acceptor (TLRs) has been brought into play vital role.People's plasmocyte sample dendritic cell (pDC) is the main cell of secretion I type Interferon, rabbit, expresses the TLR7 acceptor.TLR7 can discern single stranded RNA, and can trigger a series of signal molecule and activate dendritic cell generation IFN-α.Find that with TLR7 ligand stimulation people's pDC the IFN-alpha levels women of generation is higher than the male sex, and the inactivation of the sex bias of this IFN-alpha levels and X chromosome or effect of estrogen have nothing to do.Other discovers that the disease phenotype of TLR7 defective type lupus mouse improves, and IgG reduction in the serum (Christensenet al.Immunity, 2006,25:417-4280).These results all point out the TLR7 gene especially may work in female patient in SLE patient.Therefore, the mononucleotide polymorphism site (SNPs) of research TLR7 gene inside is significant with the relation of SLE.
Summary of the invention
The object of the present invention is to provide the dependency of human TLR7 gene and single nucleotide polymorphism (SNP) thereof and systemic lupus erythematous, and the purposes aspect detection system lupus erythematosus susceptibility.
The invention provides a kind of method that detects the single nucleotide polymorphism of human TLR7 gene, comprise step:
A, determine the Nucleotide at TLR7 gene 3 ' UTR region distance terminator codon 880bp place;
Whether b, detection exist single nucleotide polymorphism in described position.
Described single nucleotide polymorphism is the polymorphism that there is C → G in the Nucleotide at 3 ' UTR region distance terminator codon 880bp place, promptly corresponding to the 97th polymorphism that has C → G of the sequence shown in the SEQ ID NO:1.
The present invention also provides a kind of isolating nucleic acid, and it has the sequence shown in the SEQ ID NO:1, and the 97th of this sequence is G.
The present invention also provides one group of allele specific nucleic acid primer, this primer sequence and amplifies shown in the SEQ ID NO:1 that contains TLR7 gene 3 ' UTR zone the amplified production of the 97th single nucleotide polymorphism in the sequence specifically shown in SEQ ID NO:2 and SEQ ID NO:3.
The present invention also provides a kind of method that is used for detection system lupus erythematosus susceptibility, this method is extracting measured's a genomic dna, the allelotrope of the 97th mononucleotide polymorphism site in the sequence detects the susceptibility of this measured to systemic lupus erythematous shown in the SEQ ID NO:1 in detection measured's TLR7 gene 3 ' UTR zone; If the measured is that women and the 97th allelotrope are G, this measured is higher to the susceptibility of systemic lupus erythematous.
The present invention also provides a kind of method that is used for detection system lupus erythematosus susceptibility, this method is extracting measured's a genomic dna, the genotype of the 97th mononucleotide polymorphism site in the sequence detects the susceptibility of this measured to systemic lupus erythematous shown in the SEQ ID NO:1 in detection measured's TLR7 gene 3 ' UTR zone; If the measured is that women and the 97th genotype are G/G, this measured is higher to the susceptibility of systemic lupus erythematous; If the measured is that women and the 97th genotype are C/G, this measured is lower than G/G type to the susceptibility of systemic lupus erythematous, but than C/C type height; If the measured is that women and the 97th genotype are C/C, this measured is lower to the susceptibility of systemic lupus erythematous.
The present invention also provides a kind of diagnostic kit of systemic lupus erythematous, comprising:
The primer of a, specific amplification TLR7 gene is right, and wherein said primer is to having the sequence shown in SEQ ID NO:2 and 3;
The sequencing primer of the sequence of b, detection product that step a) amplifies, described sequencing primer has the sequence shown in the SEQ ID NO:4;
C, be used for specific amplification and detect amplified production and compare sequence with normal TLR7 gene and whether exist and change required reagent.
Contriver's result of study shows that all this pleomorphism site of TLR7 gene 3 ' UTR is relevant with SLE, so this site can be used as the detection of systemic lupus erythematous genetic predisposition.The pleomorphism site in 3 ' UTR zone can influence expression regulation or the stability of mRNA, and contriver's research has confirmed that also rs3853839 allelotrope G has raised the expression of TLR7mRNA.Therefore this site again can be as the drug intervention target spot, filtering out suitable medicine at this site makes the expression of TLR7mRNA be tending towards normal, thereby can effectively reduce SLE patient TLR7 expression of gene, the secretion of final downward modulation IFN-α provides new approaches for instructing autoimmune disorders such as treating SLE and other by TLR7 gene or the caused disease of IFN-α unconventionality expression.
Description of drawings
Fig. 1 is TLR7 gene structure and polymorphic site synoptic diagram, shown the position of mononucleotide polymorphism site rs2897827, rs5935436, rs2302267, rs3853839.
Fig. 2 is the expression of three kinds of pairing TLR7 peripheral blood mononuclear cell of different genes type of rs3853839 mRNA.
Fig. 3 is that the fluorescent signal of expression vector in the Hela cell of rs3853839GG type and CC type compares.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples only are used to the present invention is described but not are used to limit scope of the present invention.
Used following term in specification sheets of the present invention, they are defined as follows described:
" allelotrope " (allele) refers to be positioned at the gene of the different shape of a certain proterties of control on the same position of a pair of homologous chromosomes, the i.e. different versions of one section nucleotide sequence.
The genetic material that " genotype " (genotype) refers to organism is formed.Or rather, its allelic type of being meant in the individuality to be contained.Body or a dna sample are one by one carried out genotype detection " Genotyping " refer on nucleotide level, determine that body is in the allelotrope sequence of specific pleomorphism site one by one.
Certain part that " polymorphism " (polymorphism) refers to certain gene or gene exists more than a kind of form in the crowd.
" pleomorphism site " (polymorphic site) refers to the locus that nucleotide sequence morphs.
" single nucleotide polymorphism " is meant that single Nucleotide changes in the genome sequence.The site at the Nucleotide place that changes is exactly a mononucleotide polymorphism site.
" exon " (exon) refers to the dna sequence dna of coded protein in the gene.
" intron " (intron) refers to the sequence that those interrupt the dna sequence dna of coded protein in the gene.Intron sequences can be transcribed into RNA, but can be cut before RNA is translated as protein.
" susceptibility " refers to be easy to suffer from the tendency of certain disease." tumor susceptibility gene " refers to determine that individuality is easy to suffer from the gene of certain disease.
" tetra-sodium order-checking " (Pyrosequencing) technology is dna sequence analysis technology of new generation, and this technology need not be carried out electrophoresis, and dna fragmentation also need not fluorescent mark.The Pyrosequencing technology is by the enzyme cascade chemiluminescence reaction in 4 kinds of enzymatic same reaction systems, take turns in the sequencing reaction at each, only add a kind of dNTP, if this dNTP and template are matched, polysaccharase just can be incorporated into it in primer strand and the tetra-sodium group (PPi) of mole number such as discharge.PPi can finally be converted into visible light signal, and is converted into a peak value by PyrogramTM.The height of each peak value is directly proportional with the Nucleotide number that mixes in the reaction, adds a kind of dNTP down then, continues the synthetic of DNA chain.
PSQ 96 systems that use in following examples are available from Gene Company Limited, and this system both can carry out dna sequence analysis, can carry out again detecting and gene frequency mensuration based on the SNP of sequential analysis, and system carries Pyrosequencing
TMAssay Design software and IdentiFire software.
Embodiment 1, sample collection and DNA extracting
All SLE patients all come from rheumatism immunity section's outpatient service of Shanghai benevolence Ji hospital and ward patient, and diagnosis all meets the SLE criteria for classification that 1997 Americanism diseases caused by dampness association (ARA) revise.Be used for SLE patient's 605 examples that the case-control of SNP allelic gene typing is analyzed, the male sex's 65 examples wherein, women's 540 examples; Normal people's 263 examples, the male sex's 38 examples wherein, women's 225 examples, the age all mates.The family crowd who is used for the SNP allelic gene typing is made up of 244 China Han cores, SLE 248 examples (male sex's 30 examples, women's 218 examples) wherein, (average 32 ± 12) year in age 5-62 year.The dna sample in examination SNP site of being used to check order comes from 48 SLE patients.
Phenol chloroform method extracting Trizol (Invitrogen company) routinely extracts genomic dna from people's blood, concentration correction is to 100ng/ μ l.
2.1, (http://www.ncbi.nlm.nih.gov/) inquiry TLR7 gene 5 ' end upstream 2kb and all exons (comprises 5 ' UTR from the NCBI website, 3 ' UTR) sequence (Gene ID 51284), use Oligo6.71 software (MolecularBiology Insights) design primer, primer sequence is as shown in table 1, primer is given birth to worker company synthetic (wherein F represents forward primer, and R represents reverse primer) by Shanghai.
Table 1, sequencing primer
| Exon1、2 | 1F 1R | 5’-cccgacctgatctttgtag-3’5’-gagagcagagcatgagagg-3’ |
| 2F 2R | 5’-tggttttctggaatatgtctc-3’5’-ccccaattcaaacatctg-3’ | |
| Exon3 | 1F 1R | 5’-aaatgctgcttctaccctct-3’5’-gcggtatctctagtagctggt-3’ |
| 2F 2R | 5’-gaggtattcccacgaacac-3’5’-ttaattctgtcagcgcatc-3’ | |
| 3F 3R | 5’-tccctactgttttgccatct-3’5’-tgcacgatagacctgaagttc-3’ | |
| 4F 4R | 5’-cagtaactctcttcagcatgtg-3’5’-gacagattcaggcatttgag-3’ | |
| 5F 5R | 5’-agtatgggcagaccttggat-3’5’-ggtccaaagtttccaggttc-3’ | |
| 6F 6R | 5’-tggagagaaggtgataacagat-3’5’-tcccagaaatagaggtgactt-3’ | |
| 7F 7R | 5’-cccagaaaatgtcctcaac-3’5’-tctttgcatacttgtctgtcat-3’ | |
| 8F | 5’-gttgctatgatgcttttattgt-3’ | |
| 8R | 5’-gcctctccttggtaaactag-3’ | |
| 9F 9R | 5’-ctggcagtgtctaaagaacg-3’5’-attacaagcatgagccacc-3’ | |
| 10F 10R | 5’-aaacatggggctctgattc-3’5’-aggaagcactgaagcagc-3’ | |
| 11F 11R | 5’-accccgtctgtactaaaaat-3’5’-ctcctttagggtttaccatc-3’ | |
| 12F | 5’-accaattgcttccgtgtcat-3’ |
| 12R | 5’-gtttcttctcccatcctccag-3’ | |
| 13F3R | 5’-cctttgataatttacctgctt-3’5’-agaacggaaactatgaaacac-3’ | |
| 5 ' upstream 2kb | 1F1R | 5’-agccagttgcccaataatc-3’5’-ctcactttaacatgccgtctg-3’ |
| 2F2R | 5’-gcaccccagtttagaatcagt-3’5’ -gctcttgtttggtgatgctc-3’ | |
| 3F3R | 5’-atatctttgtgtctgggcag-3’5’-ggcagtaaaaaccaaatgtc-3’ | |
| 4F4R | 5’-gtaaagcattatagtccccatc-3’5’-gttggttcactcactttcct-3’ | |
| 5F5R | 5’-aaaaccctcaataaatgtcact-3’5’-cccttgctctatacccact-3’ | |
| 6F6R | 5’-agaggaaagtgagtgaaccaac-3’5’-ccaactacaaagatcaggtcg-3’ | |
| 7F7R | 5’-gtgattgtcataactggaagg-3’5’-atatgatttcggttccctct-3’ |
2.2, the amplification of PCR
The PCR reaction conditions is as shown in table 2, and the dna profiling in order-checking examination SNP site comes from 48 SLE patients.
Table 2
| Amplification system | Amplification condition | ||
| 20μl | 10 * PCR damping fluid MgCl 2DNTP Hotsta polysaccharase (Qiagen) forward and reverse primer (table 1) dna profiling | Each 1 μ l (10pmol/ μ l), 4 μ l (100ng/ μ l) of 2 μ l 1 μ l (25mmol/L), 0.4 μ l (10mmol/L), 0.06 μ l (10U/ μ l) | 95 ℃ of sex change 15min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 45s (totally 30 circulations); 72 ℃ are extended 10min, 4 ℃ of preservations |
| Deionized water | 10.54μl |
2.3, the PCR product purification
Purification system: pcr amplification product 3 μ l, SAP (1U/ μ L) 1 μ l, Exo I (10U/ μ L) 0.05 μ l;
Purification condition: 37 ℃ of 30min, 80 ℃ of 15min, 4 ℃ of preservations.
2.4, sequencing reaction
Sequencing reaction system: PCR product 1 μ l behind the purifying, BigDye
TMTerminator 0.25 μ l, 5 * Bigdye Seq Buffer1.875 μ l, the forward primer in the table 1 (being diluted to 3.2pmol/ μ l) 1 μ l, deionized water 5.875 μ l.
The sequencing reaction circulation is provided with: 96 ℃ of 1min, 96 ℃ of 10s, 50 ℃ of 5s, 60 ℃ of 4min (totally 40 circulations).
After the sex change of sequencing reaction product, (ABI company) carries out automatic sequencing through the 3730DNA sequenator, uses Seqscape software (Applied Biosystems company) analyzing DNA base sequence.
The TLR7 gene polymorphism sites that order-checking is found distributes, reaches the order-checking frequency resultant and sees Table 3, and wherein the rs3853839 amplified fragments has the sequence shown in the SEQ ID NO:1.
The distributing position of table 3, four kinds of SNP and order-checking frequency
| SNP | Distributed areas | The NCBI position | Allelotrope | Frequency (MAF) |
| rs2897827 | 5 ' upstream | 12793467 | C/T | 0.066 |
| rs5935436 | 5 ' upstream | 12793812 | C/T | 0.084 |
| rs2302267 | 5 ' UTR intron | 12795499 | G/T | 0.046 |
| rs3853839 | 3’UTR | 12817579 | G/C | 0.140 |
By analysis, three exons coding districts of TLR7 do not find pleomorphism site, and the listed frequency of pleomorphism site in Chinese population is zero on the database.There is a pleomorphism site in 3 ' UTR zone, and apart from terminator codon 880bp, allelotrope is C, G, and is through NCBI sequence alignment (http://www.ncbi.nlm.nih.gov/BLAST/), consistent with the rs3853839 sequence.Pleomorphism site is not found in 5 ' UTR zone.Because first exon of TLR7 gene coded amino acid not, therefore first with second exon between have a bit of intron, a pleomorphism site is arranged in this zone, distance is transcribed and is opened downstream, the site 376bp that begins, allelotrope is T, G.Through the NCBI sequence alignment, consistent with the rs2302267 sequence.Two pleomorphism sites are found in order-checking to TLR7 gene 5 ' upstream 2000bp, and a distance is transcribed and opened beginning upstream, site 1311bp, and allelotrope is C, T; A distance is transcribed and is opened beginning upstream, site 1656bp, and allelotrope is C, T.Through the NCBI sequence alignment, consistent with rs5935436, rs2897827 sequence respectively.
Embodiment 3, tetra-sodium order-checking (Pyrosequencing) method detects SNP rs3853839 on a large scale
3.1, design of primers
The pleomorphism site rs3853839 of TLR7 gene internal frequency 〉=10% of finding checking order carries software " Pyrosequencing by PSQ 96 MA systems
TMAssay Design Software ", Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3) and Oligo 6.71 softwares (Molecular Biology Insights) design primer.Requiring the primer length of amplification template is about 20bp; The inner GC ratio of primer is 45～55%, and the Tm value is about about 60 ℃; There is not secondary structure between primer self and the primer; Primer base and non-amplification region do not have homology and exist.Sequencing primer 3 ' least significant end base distance site to be measured is no more than 20bp, can be combined in PCR primer strand specifically, and designed pyrosequencing primer sees Table 4.Amplimer is synthetic by the white good biological company limited in Shanghai, and sequencing primer is given birth to worker company by Shanghai and synthesized.
Table 4
| The mononucleotide polymorphism site title | rs3853839 |
| Forward primer | ccaattgcttccgtgtcat(SEQ?ID?NO：2) |
| Reverse primer | tgtaggtggaccatatgcattt(SEQ?ID?NO：3) |
| Sequencing primer | gtgcttcctgctcttt(SEQ?ID?NO：4) |
3.2, amplification, purifying and the order-checking of PCR
The PCR reaction conditions is as shown in table 5, and wherein dna profiling is SLE patient's 605 examples, the male sex's 65 examples wherein, women's 540 examples; Normal people's 263 examples, the male sex's 38 examples wherein, women's 225 examples, the age all mates.
Table 5
| Amplification system | Amplification condition | ||
| 20μl | 10 * PCR damping fluid MgCl 2DNTP Hotsta polysaccharase (Qiagen) forward and reverse primer (table 3) dna profiling deionized water | Each 1 μ l (10pmol/ μ l), 4 μ l (100ng/ μ l), 10.54 μ l of 2 μ l 1 μ l (25mmol/L), 0.4 μ l (10mmol/L), 0.06 μ l (10U/ μ l) | 95 ℃ of sex change 15min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 45s (totally 30 circulations); 72 ℃ are extended 10min, 4 ℃ of preservations |
The PCR product is put into PSQ 96 orifice plates, operate, adopt tetra-sodium sequencing (Pyrosequencing) order-checking by the method that Gene Company Limited provides.
Embodiment 4, the case-control of rs3853839 allelic gene typing research
4.1, the difference that in case group and control group, distributes of three kinds of genotype of rs3853839
Use PSQ 96MA system to carry IdentiFire software the sequencing result among the embodiment 3.2 is carried out genotypic interpretation.Use the chi-square analysis in the SAS software (http://www.sas.com/software/sas9/), 605 routine SLE patients and three kinds of genotype frequencies of 263 routine normal people rs3853839 are analyzed, the results are shown in Table 6.
The rs3853839 genotype frequency relatively between table 6, case group and the normal control group
| SLE patient's sum | Normal people's sum | Women SLE patient | Normal women | Male sex SLE patient | Normal male | |
| GG | ?482(79.67％) | 184(69.96％) | 420(77.78％) | 151(67.11％) | 62(95.38％) | 33(86.84％) |
| CG | ?106(17.52％) | 65(24.71％) | 106(19.63％) | 65(28.89％) | ||
| CC | ?17(2.81％) | 14(5.32％) | 14(2.59％) | 9(4.00％) | 3(4.62％) | 5(13.16％) |
| ?x 2＝10.309，p＝0.006 | x 2＝9.559，p＝0.008 | x 2＝2.419，p＝0.141 | ||||
As can be known from the results of Table 6, the distributional difference of three kinds of genotype of rs3853839 in case group and control group has significance (x
2=10.309, p=0.006), this species diversity especially has significance (x in female patient and women normal people
2=9.559, p=0.008), the GG type is apparently higher than CG type and CC type in the women, and the GG type has increased women SLE morbid risk, and the difference among male patient and the male sex normal people does not reach statistical significance (x
2=2.419, p=0.141).
4.2, the difference that in case group and control group, distributes of two kinds of allelotrope of rs3853839
Use PSQ 96MA system to carry IdentiFire software the sequencing result among the embodiment 3.2 is carried out allelic interpretation, sentence read result is input to Haploview software (http://www.broad.mit.edu/mpg/haploview/), 605 routine SLE patients and 263 routine normal people rs3853839 gene frequencies are analyzed, use the credibility interval of SAS computed in software odds rations (OR) and 95% again, the results are shown in Table 7.
The rs3853839 gene frequency relatively between table 7, case group and the normal control group
| SLE patient's sum | Normal people's sum | Women SLE patient | Normal women | Male sex SLE patient | Normal male | |
| G | ?1008(88.03％) | 400(81.97％) | 946(87.59％) | 367(81.56％) | 62(95.38％) | 33(86.84％) |
| C | ?137(11.97％) | 88(18.03％) | 134(12.41％) | 83(18.44％) | 3(4.62％) | 5(13.16％) |
| ?x 2＝11.308，p＝0.0011 | x 2＝10.183，p＝0.0024 | x 2＝2.419，p＝0.141 | ||||
| ?OR＝1.619 | OR＝1.597 | OR＝3.131 | ||||
| ?95％CI(1.211，2.163) | 95％CI(1.186，2.150) | 95％CI(0.743，13.195) | ||||
(OR：odds?rations；CI：confidence?intervals)
As can be known from the results of Table 7, two kinds of allelotrope of TLR7 gene rs3853839 C/G distributional difference in case group and control group has significance (X
2=11.308, p=0.0011), allelotrope G has increased the morbid risk (OR=1.619, P=0.0011,95%CI 1.211-2.163) of SLE.This effect of allelotrope G especially is presented among the women SLE patient, and G has increased the morbid risk (OR=1.597, P=0.0024,95%CI 1.186-2.150) of women SLE, and this acts on not statistically significant (P=0.141) in male sex SLE patient.
4.3, the rs3853839 genetic analysis
Allelic gene typing research to 244 China Han core SLE familys, SLE248 example wherein, the male sex's 30 examples, women's 218 examples in year in age 5-62 year (average 32 ± 12), are carried out family transmission disequilibrium check (TDT) with Haploview software and are found, rs3853839 allelotrope G advantage passes to the patient, transmit: do not transmit (T: U)=31: 15, p=0.0183, calibrated back p=0.0260.Carrying out compliance test with Genehunter software (http://www.broad.mit.edu/ftp/distribution/software/genehunter/) finds, rs3853839 allelotrope G advantage passes to the patient, transmit: do not transmit (T: U)=31: 15, p=0.0183.
5.1, design of primers
The human TLR7 gene cDNA of inquiry ncbi database full length sequence, the primer of using Oligo 6.71 software design amplification templates is as follows, and primer is given birth to worker company by Shanghai and is synthesized.
Forward primer: 5 '-GGAAGAAGACTAAAAATGGTGTT-3 ';
Reverse primer: 5 '-TGACATCACAGGGCAGAGTT-3 '.
5.2, RAN extracting and reverse transcription
Choose the 77 routine women SLE patient whole blood samples that carry out the rs3853839 gene type, use the total RNA of phenol chloroform method extracting Trizol (Invitrogen company), use oligo dT, Superscript II reversed transcriptive enzyme test kit (Invitrogen company) reverse transcription is cDNA.At first add RNA 8 μ l, oligo dT 1 μ l, the centrifugal back 65 ℃ of 5min of dNTP 4 μ l mixings, place fast and add 5 * FS Buffer, 4 μ l, the centrifugal back 42 ℃ of 2min of 0.1M DTT 2 μ l mixings on ice again, the SSRT II mixing that adds 1 μ l at last is centrifugal back in 42 ℃ of 50min, 70 ℃ of 15min.
5.3, real-time fluorescence quantitative PCR (Real-time PCR)
Reaction system (5 μ l): SYBR Green Master Mix 2.5 μ l, ROX 0.1 μ l, forward primer 0.1 μ l, reverse primer 0.1 μ l, cDNA template 1 μ l, deionized water 1.2 μ l.
The PCR setting that circulates: 95 ℃, 15s; 95 ℃, 5s, 60 ℃, 30s (totally 40 circulations).
Use ABI Prism7900 sequenator (Applied Biosystems company) to detect fluorescent signal, use SDS2.1 software (Applied Biosystems company) the TLR7 gene mRNA expression is analyzed.Two groups of independent sample data are relatively used the distribution free Mann-Whitney check in the Graph Pad4.03 software (http://www.graphpad.com/prism/Prism.htm).The P value represents statistics meaningful less than 0.05.The results are shown in Table 8, and make Fig. 2 according to table 8 data.
Table 8, TLR7mRNA express quantitative values
| TLR7mRNA(2 -ΔΔcTValue) | GG | CG | CC |
| Mean±Std | 1.26±0.2115 | 0.4215±0.0969 | 0.1882±0.1362 |
| The example number | 59 | 15 | 3 |
| P＝0.0244 | |||
By table 8 and Fig. 2 result as can be known, find through expression study to 77 routine women SLE peripheral blood mononuclear cell TLR7mRNA, different rs3853839 gene types, the expression difference of its TLR7mRNA, the expression amount of GG type is higher than CG, CC type (p=0.0244).Be positioned at 3 ' UTR zone this pleomorphism site rs3853839 can by with the expression amount that combines or finally influence mRNA of some transcription factor by the stability that influences mRNA.TLR7 is a kind of signal transduction acceptor that is expressed on people's plasmocyte sample dendritic cell (pDC) endosome film, activates TLR7 and can raise downstream a series of signal molecule, causes the secretion of I type Interferon, rabbit (IFN-α).And the high expression level of I type Interferon, rabbit has vital role in the morbidity of SLE and evolution.There is the scholar to infer that the high expression level of TLR7 itself may also be the reason that causes downstream I type Interferon, rabbit high expression level.The expression amount of the rs3853839 GG type that contriver research obtains is higher than CG, CC type can illustrate that the allelotrope G in this site has increased the possibility that the women suffers from SLE really, and this result with embodiment 4 is consistent.
Embodiment 6, the two fluorescence report system experimentations of 3 ' UTR region S NP rs3853839
6.1, vector construction
Each 1 example of dna sample of choosing rs3853839 genotype GG and CC is as template, and the about 260bp of amplification people's TLR7 3 ' UTR fragment makes the rs3853839C/G site be positioned at the fragment center, and design of primers is as follows, gives birth to worker company by Shanghai and synthesizes.
Upstream primer: 5 '-GTCACGCGTCAGCTTCTTAACCAAT-3 ';
Downstream primer: 5 '-ACAAAGCTTATCAAAGGTAGAGAAT-3 '.
Amplification obtains the cloned sequence of rs3853839C and rs3853839G respectively, inserts 3 ' UTR position of luciferase genes on pMIR-REPORT (Ambion) carrier, and the clone gets rid of sudden change through order-checking.
6.2, the experiment of transfection and reporting system
Transfection method is selected liposome transfection for use.The HeLa clone (ATCC) that will be incubated at the day before yesterday in the DMEM nutrient solution conditions that has added 10%FBS is laid on 96 orifice plates.Elder generation is mixed the reporting system carrier of 50ng rs3853839C or rs3853839G during transfection with 10ng pRL-TK carrier (Promega), is each separately transfected into every hole HeLa cell; Cell cultures is 24 hours after the transfection, can use two fluorescence report system test kits (Promega) to go up at detector TR717 (Applied Biosystems) after the cracking and detect.Can obtain the fluorescent signal ratio of a Firefly and Renilla for each hole, the mean value of getting three negative holes is the relative fluorescence level difference between two groups relatively, the results are shown in Table 9, to the mapping of gained data, the results are shown in Figure 3.
The fluorescent signal value of rs3853839 different genotype relatively in table 9, the Hela clone
| rs3853839?GG | rs3853839?CC | |
| Firefly/Renilla ratio | 2.0090 | 0.4424 |
| 2.3673 | 0.2802 | |
| 2.6842 | 0.3603 | |
| Mean±Std | 2.354±0.1950 | 0.3610±0.04682 |
| P＝0.0006 | ||
As Fig. 3, shown in the table 9, the fluorescent signal of rs3853839 site allelotrope G is better than allele C (p=0.0006) in external Hela clone, consistent with the result of study of mRNA level among the embodiment 5, the rs3853839 pleomorphism site that shows TLR7 gene 3 ' UTR is relevant with SLE, so this site can be used as the detection of systemic lupus erythematous genetic predisposition.
Embodiment 7, at the detection kit of systemic lupus erythematous
The test kit of preparation detection system lupus erythematosus susceptibility, comprising:
20 μ l, 10 * PCR damping fluid
10μl 25mmol/LMgCl
2
4μl 10mmol/LdNTP
0.6 μ l 10U/ μ lHotsta polysaccharase (Qiagen)
10 μ l 10pmol/ μ l forward primers: SEQ ID NO:2
10 μ l 10pmol/ μ l reverse primers: SEQ ID NO:3
20 μ l 10pmol/ μ l sequencing primers: SEQ ID NO:4
Using method (person-portion):
1), by pcr amplification TLR7 gene 3 ' UTR zone: the preparation mixed solution adds genomic dna solution 4ng, 10 * PCR damping fluid, 2 μ l, 25mmol/LMgCl
21 μ l, 10mmol/LdNTP0.4 μ l, 10U/ μ lHotsta polysaccharase (Qiagen) 0.06 μ l, 10pmol/ μ l just/each 1 μ l, deionized water 10.54 μ l of reverse primer, cumulative volume is 20 μ l.Be reflected at 95 ℃ of sex change 15min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 45s (totally 30 circulations); 72 ℃ are extended 10min.
2), get the PCR product, add 2 μ l, 10pmol/ μ l sequencing primer uses the order-checking of PSQ 96 systems also to analyze mononucleotide polymorphism site.
This test kit is that 10 person-portions detect application, and the storage temperature of test kit is-20 ℃.
Reported first of the present invention the dependency of TLR7 gene mononucleotide polymorphism site and SLE.The contriver is by having found 4 SNP:rs2897827, rs5935436, rs2302267, rs3853839 to the order-checking of TLR7 gene important area.To the pleomorphism site rs3853839 of 3 ' UTR of frequency 〉=10%, find that by case control study and the check of family transmission disequilibrium allelotrope G is relevant with SLE.Especially in women SLE patient, allelotrope G can increase the morbid risk of SLE.The discovery that again expression of rs3853839 different genes type and women TLR7mRNA interrelated, the TLR7mRNA of GG type expresses and is higher than CG, CC type.Use two fluorescence report systems simultaneously and be better than allele C at the external fluorescent signal of allelotrope G that confirmed.These results show that all this pleomorphism site of TLR7 gene 3 ' UTR is relevant with SLE, so this site can be used as the detection of systemic lupus erythematous genetic predisposition.The pleomorphism site in 3 ' UTR zone can influence expression regulation or the stability of mRNA, and contriver's research has confirmed that also rs3853839 allelotrope G has raised the expression of TLR7 mRNA.Therefore this site again can be as the drug intervention target spot, filtering out suitable medicine at this site makes the expression of TLR7mRNA be tending towards normal, thereby can effectively reduce SLE patient TLR7 expression of gene, the secretion of final downward modulation IFN-α provides new approaches for instructing autoimmune disorders such as treating SLE and other by TLR7 gene or the caused disease of IFN-α unconventionality expression.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉human Toll-like receptor 7 body 7 gene mononucleotide polymorphisms and application thereof
<130>P5071076
<160>4
<170>PatentIn?version?3.3
<210>1
<211>516
<212>DNA
<213>human
<400>1
accaattgct?tccgtgtcat?ccagggcccc?attctgtgca?gattgagtgt?gggcaccaca 60
caggtggttg?ctgcttcagt?gcttcctgct?ctttttcctt?gggcctgctt?ctgggttcca 120
tagggaaaca?gtaagaaaga?aagacacatc?cttaccataa?atgcatatgg?tccacctaca 180
aatagaaaaa?tatttaaatg?atctgccttt?atacaaagtg?atattctcta?cctttgataa 240
tttacctgct?taaatgtttt?tatctgcact?gcaaagtact?gtatccaaag?taaaatttcc 300
tcatccaata?tctttcaaac?tgttttgtta?actaatgcca?tatatttgta?agtatctgca 360
cacttgatac?agcaacgtta?gatggttttg?atggtaaacc?ctaaaggagg?actccaagag 420
tgtgtattta?tttatagttt?tatcagagat?gacaattatt?tgaatgccaa?ttatatggat 480
tcctttcatt?ttttgctgga?ggatgggaga?agaaac 516
<210>2
<211>19
<212>DNA
<213>human
<400>2
ccaattgctt?ccgtgtcat 19
<210>3
<211>22
<212>DNA
<213>human
<400>3
tgtaggtgga?ccatatgcat?tt 22
<210>4
<211>16
<212>DNA
<213>human
<400>4
gtgcttcctg?ctcttt 16
Claims (2)
1. one group of allele specific nucleic acid primer, it is characterized in that, its amplimer sequence and amplifies shown in the SEQ ID NO:1 that contains TLR7 gene 3 ' UTR zone the amplified production of the 97th single nucleotide polymorphism in the sequence specifically shown in SEQ ID NO:2 and SEQ ID NO:3; The sequencing primer sequence of the sequence of described amplified production is shown in SEQ ID NO:4.
2. the diagnostic kit of a systemic lupus erythematous is characterized in that, comprising:
The primer of a, specific amplification TLR7 gene is right, and the right sequence of wherein said amplimer is shown in SEQ ID NO:2 and 3;
The sequencing primer of the sequence of b, detection step product that a amplifies, the sequence of described sequencing primer is shown in SEQ ID NO:4;
C, be used for specific amplification and detect amplified production and compare sequence with normal TLR7 gene and whether exist and change required reagent.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100476361A CN101423865B (en) | 2007-10-31 | 2007-10-31 | Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof |
| PCT/CN2008/072906 WO2009059554A1 (en) | 2007-10-31 | 2008-10-31 | Single nucleotide polymorphism in human toll-like receptor 7 gene and its use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100476361A CN101423865B (en) | 2007-10-31 | 2007-10-31 | Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101423865A CN101423865A (en) | 2009-05-06 |
| CN101423865B true CN101423865B (en) | 2011-10-26 |
Family
ID=40614746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100476361A Active CN101423865B (en) | 2007-10-31 | 2007-10-31 | Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101423865B (en) |
| WO (1) | WO2009059554A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293901A (en) * | 2013-07-19 | 2015-01-21 | 金弗康生物科技(上海)有限公司 | Detection kit for early diagnosis of systemic lupus erythematosus |
| WO2024012578A1 (en) * | 2022-07-15 | 2024-01-18 | 百奥赛图(北京)医药科技股份有限公司 | Non-human animal with humanized modification of tlr7 and/or tlr8 gene |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8026063B2 (en) * | 2005-01-11 | 2011-09-27 | Riken | Method of examining inflammatory disease and method of screening remedy for imflammatory disease |
-
2007
- 2007-10-31 CN CN2007100476361A patent/CN101423865B/en active Active
-
2008
- 2008-10-31 WO PCT/CN2008/072906 patent/WO2009059554A1/en active Application Filing
Non-Patent Citations (4)
| Title |
|---|
| 徐宗怡.系统性红斑狼疮候选基因的多态性及其与疾病的关联研究.《华东师范大学硕士学位论文》.2006,7-8. * |
| 未知.accession no. rs3853839.《DATABASE NCBI》.2002, * |
| 田地等.Toll样受体及其基因多态性与感染性疾病关系的研究进展.《世界华人消化杂志》.2007,第15卷(第12期),1393-1399. * |
| 闫小毅.TLR7介导抗病毒免疫应答研究进展.《国外医学.免疫学分册》.2005,第28卷(第5期),292-295. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101423865A (en) | 2009-05-06 |
| WO2009059554A1 (en) | 2009-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Human tumor microRNA signatures derived from large‐scale oligonucleotide microarray datasets | |
| Popova et al. | Ploidy and large-scale genomic instability consistently identify basal-like breast carcinomas with BRCA1/2 inactivation | |
| US9702011B2 (en) | Markers for breast cancer | |
| US20160222468A1 (en) | Diagnosis, prognosis and treatment of glioblastoma multiforme | |
| Enjuanes et al. | Genetic variants in apoptosis and immunoregulation-related genes are associated with risk of chronic lymphocytic leukemia | |
| US20140179546A1 (en) | Genetic variants on chr 5p12 and 10q26 as markers for use in breast cancer risk assessment, diagnosis, prognosis and treatment | |
| EP2185726B1 (en) | Novel single nucleotide polymorphisms and combinations of novel and known polymorphisms for determining the allele-specific expression of the igf2 gene | |
| WO2021036620A1 (en) | Application of a group of genes related to ovarian cancer prognosis | |
| CN109952383B (en) | Methods and compositions for predicting enzatocin activity | |
| JP2018523488A (en) | Compositions and methods for combined use for the treatment and diagnosis of autoimmune diseases | |
| WO2014200952A2 (en) | Genetic markers of antipsychotic response | |
| Yuan et al. | Current advances in lupus genetic and genomic studies in Asia | |
| Hecker et al. | A genetic variant associated with multiple sclerosis inversely affects the expression of CD58 and microRNA-548ac from the same gene | |
| Yu et al. | High expression of CKS2 predicts adverse outcomes: a potential therapeutic target for Glioma | |
| CN111662973B (en) | SNP locus related to auxiliary diagnosis of susceptibility of chronic obstructive pulmonary disease and application thereof | |
| CN101423865B (en) | Human Toll-like receptor 7 gene mononucleotide polymorphism and use thereof | |
| Venugopal et al. | Association of microRNA-125a and microRNA-499a polymorphisms in chronic periodontitis in a sample south Indian population: a hospital-based genetic association study | |
| Yang et al. | Genetic variation in miR-146a is not associated with susceptibility to IgA nephropathy in adults from a Chinese Han population | |
| US10557173B2 (en) | Prognostic methods, compositions and kits for prediction of acute lymphoblastic leukemia (ALL) relapse | |
| Peng et al. | Association between polymorphisms in the signal transducer and activator of transcription and dilated cardiomyopathy in the Chinese Han population | |
| US20140045717A1 (en) | Single Nucleotide Polymorphism Biomarkers for Diagnosing Autism | |
| US20170240965A1 (en) | Methods for prognosing heart transplant | |
| WO2009103992A1 (en) | Genetic variation associated with coeliac disease | |
| Narasimhan et al. | A genome wide association study to identify germline variants associated with cancer-associated cachexia-a preliminary analysis | |
| CN116287247A (en) | Application of mitochondrial apoptosis-related gene polymorphism in acute myelogenous leukemia anthracycline chemotherapy response and susceptibility prediction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee after: Shanghai Institute of nutrition and health, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |